General Information of Drug Transporter (DT)
DT ID DTD0322 Transporter Info
Gene Name SLC37A1
Transporter Name Glycerol-3-phosphate permease
Gene ID
54020
UniProt ID
P57057
Epigenetic Regulations of This DT (EGR)

Methylation

  Atypical teratoid rhabdoid tumor

         20 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

Methylation of SLC37A1 in atypical teratoid rhabdoid tumor [ 1 ]

Location

5'UTR (cg00549412)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.34E+00 Statistic Test p-value: 5.33E-09; Z-score: 1.54E+00

Methylation in Case

7.56E-01 (Median) Methylation in Control 5.63E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 2

Methylation of SLC37A1 in atypical teratoid rhabdoid tumor [ 1 ]

Location

5'UTR (cg01879556)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.34E+00 Statistic Test p-value: 1.18E-08; Z-score: 1.93E+00

Methylation in Case

8.52E-01 (Median) Methylation in Control 6.34E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 3

Methylation of SLC37A1 in atypical teratoid rhabdoid tumor [ 1 ]

Location

5'UTR (cg06579790)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.51E+00 Statistic Test p-value: 6.48E-08; Z-score: -1.42E+00

Methylation in Case

3.27E-01 (Median) Methylation in Control 4.93E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 4

Methylation of SLC37A1 in atypical teratoid rhabdoid tumor [ 1 ]

Location

5'UTR (cg09546172)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.90E+00 Statistic Test p-value: 1.85E-07; Z-score: -1.86E+00

Methylation in Case

1.55E-01 (Median) Methylation in Control 2.95E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 5

Methylation of SLC37A1 in atypical teratoid rhabdoid tumor [ 1 ]

Location

5'UTR (cg12993026)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.09E+00 Statistic Test p-value: 4.23E-07; Z-score: -1.29E+00

Methylation in Case

8.10E-01 (Median) Methylation in Control 8.80E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 6

Methylation of SLC37A1 in atypical teratoid rhabdoid tumor [ 1 ]

Location

5'UTR (cg17398613)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.32E+00 Statistic Test p-value: 1.93E-06; Z-score: -1.34E+00

Methylation in Case

3.21E-01 (Median) Methylation in Control 4.23E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 7

Methylation of SLC37A1 in atypical teratoid rhabdoid tumor [ 1 ]

Location

5'UTR (cg22599036)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.17E+00 Statistic Test p-value: 6.35E-06; Z-score: 7.76E-01

Methylation in Case

8.09E-01 (Median) Methylation in Control 6.90E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 8

Methylation of SLC37A1 in atypical teratoid rhabdoid tumor [ 1 ]

Location

5'UTR (cg23336810)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.26E+00 Statistic Test p-value: 7.03E-06; Z-score: 1.34E+00

Methylation in Case

8.62E-01 (Median) Methylation in Control 6.83E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 9

Methylation of SLC37A1 in atypical teratoid rhabdoid tumor [ 1 ]

Location

Body (cg00288945)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.31E+00 Statistic Test p-value: 1.99E-05; Z-score: -1.08E+00

Methylation in Case

5.69E-01 (Median) Methylation in Control 7.46E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 10

Methylation of SLC37A1 in atypical teratoid rhabdoid tumor [ 1 ]

Location

Body (cg04096368)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.15E+00 Statistic Test p-value: 5.55E-04; Z-score: -9.61E-01

Methylation in Case

6.69E-01 (Median) Methylation in Control 7.66E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 11

Methylation of SLC37A1 in atypical teratoid rhabdoid tumor [ 1 ]

Location

Body (cg04192258)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.93E+00 Statistic Test p-value: 5.99E-04; Z-score: -8.37E-01

Methylation in Case

1.26E-01 (Median) Methylation in Control 2.42E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 12

Methylation of SLC37A1 in atypical teratoid rhabdoid tumor [ 1 ]

Location

Body (cg08193480)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.06E+00 Statistic Test p-value: 5.60E-03; Z-score: 2.81E-01

Methylation in Case

1.88E-02 (Median) Methylation in Control 1.77E-02 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 13

Methylation of SLC37A1 in atypical teratoid rhabdoid tumor [ 1 ]

Location

Body (cg08407901)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.23E+00 Statistic Test p-value: 6.16E-03; Z-score: -9.02E-01

Methylation in Case

5.36E-01 (Median) Methylation in Control 6.57E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 14

Methylation of SLC37A1 in atypical teratoid rhabdoid tumor [ 1 ]

Location

Body (cg08529312)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.01E+00 Statistic Test p-value: 7.23E-03; Z-score: 6.31E-02

Methylation in Case

8.50E-02 (Median) Methylation in Control 8.38E-02 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 15

Methylation of SLC37A1 in atypical teratoid rhabdoid tumor [ 1 ]

Location

Body (cg11453546)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.01E+00 Statistic Test p-value: 2.25E-02; Z-score: -4.95E-01

Methylation in Case

9.58E-01 (Median) Methylation in Control 9.67E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 16

Methylation of SLC37A1 in atypical teratoid rhabdoid tumor [ 1 ]

Location

Body (cg12409874)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.08E+00 Statistic Test p-value: 2.76E-02; Z-score: 3.37E-01

Methylation in Case

3.37E-01 (Median) Methylation in Control 3.14E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 17

Methylation of SLC37A1 in atypical teratoid rhabdoid tumor [ 1 ]

Location

Body (cg12913778)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.16E+00 Statistic Test p-value: 3.17E-02; Z-score: 5.11E-01

Methylation in Case

5.29E-01 (Median) Methylation in Control 4.55E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 18

Methylation of SLC37A1 in atypical teratoid rhabdoid tumor [ 1 ]

Location

Body (cg13128052)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.04E+00 Statistic Test p-value: 3.29E-02; Z-score: 5.14E-01

Methylation in Case

8.81E-01 (Median) Methylation in Control 8.45E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 19

Methylation of SLC37A1 in atypical teratoid rhabdoid tumor [ 1 ]

Location

Body (cg13960334)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.15E+00 Statistic Test p-value: 4.02E-02; Z-score: -2.01E-01

Methylation in Case

1.57E-01 (Median) Methylation in Control 1.80E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 20

Methylation of SLC37A1 in atypical teratoid rhabdoid tumor [ 1 ]

Location

3'UTR (cg24141725)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.32E+00 Statistic Test p-value: 1.21E-09; Z-score: -1.49E+00

Methylation in Case

4.89E-01 (Median) Methylation in Control 6.45E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

Patient tissue samples

  Bladder cancer

         12 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

Methylation of SLC37A1 in bladder cancer [ 2 ]

Location

5'UTR (cg23336810)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -2.41E+00 Statistic Test p-value: 3.00E-08; Z-score: -7.60E+00

Methylation in Case

2.97E-01 (Median) Methylation in Control 7.14E-01 (Median)

Studied Phenotype

Bladder cancer [ ICD-11: 2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 2

Methylation of SLC37A1 in bladder cancer [ 2 ]

Location

5'UTR (cg00549412)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.55E+00 Statistic Test p-value: 7.23E-06; Z-score: -5.05E+00

Methylation in Case

4.21E-01 (Median) Methylation in Control 6.53E-01 (Median)

Studied Phenotype

Bladder cancer [ ICD-11: 2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 3

Methylation of SLC37A1 in bladder cancer [ 2 ]

Location

5'UTR (cg09546172)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.31E+00 Statistic Test p-value: 1.28E-05; Z-score: -3.65E+00

Methylation in Case

1.00E-01 (Median) Methylation in Control 1.32E-01 (Median)

Studied Phenotype

Bladder cancer [ ICD-11: 2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 4

Methylation of SLC37A1 in bladder cancer [ 2 ]

Location

TSS1500 (cg08599496)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.16E+00 Statistic Test p-value: 5.37E-06; Z-score: -4.54E+00

Methylation in Case

7.05E-01 (Median) Methylation in Control 8.17E-01 (Median)

Studied Phenotype

Bladder cancer [ ICD-11: 2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 5

Methylation of SLC37A1 in bladder cancer [ 2 ]

Location

TSS1500 (cg17218342)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.08E+00 Statistic Test p-value: 1.90E-04; Z-score: -3.78E+00

Methylation in Case

7.22E-01 (Median) Methylation in Control 7.79E-01 (Median)

Studied Phenotype

Bladder cancer [ ICD-11: 2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 6

Methylation of SLC37A1 in bladder cancer [ 2 ]

Location

TSS1500 (cg13265003)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.11E+00 Statistic Test p-value: 3.90E-03; Z-score: -2.07E+00

Methylation in Case

5.89E-01 (Median) Methylation in Control 6.52E-01 (Median)

Studied Phenotype

Bladder cancer [ ICD-11: 2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 7

Methylation of SLC37A1 in bladder cancer [ 2 ]

Location

Body (cg04096368)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.32E+00 Statistic Test p-value: 1.54E-07; Z-score: -6.03E+00

Methylation in Case

5.24E-01 (Median) Methylation in Control 6.93E-01 (Median)

Studied Phenotype

Bladder cancer [ ICD-11: 2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 8

Methylation of SLC37A1 in bladder cancer [ 2 ]

Location

Body (cg12409874)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.20E+00 Statistic Test p-value: 3.52E-05; Z-score: -4.91E+00

Methylation in Case

7.13E-01 (Median) Methylation in Control 8.52E-01 (Median)

Studied Phenotype

Bladder cancer [ ICD-11: 2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 9

Methylation of SLC37A1 in bladder cancer [ 2 ]

Location

Body (cg18478353)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.08E+00 Statistic Test p-value: 3.52E-03; Z-score: 4.04E+00

Methylation in Case

7.31E-01 (Median) Methylation in Control 6.76E-01 (Median)

Studied Phenotype

Bladder cancer [ ICD-11: 2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 10

Methylation of SLC37A1 in bladder cancer [ 2 ]

Location

Body (cg08193480)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.02E+00 Statistic Test p-value: 7.55E-03; Z-score: -1.02E+00

Methylation in Case

8.27E-01 (Median) Methylation in Control 8.46E-01 (Median)

Studied Phenotype

Bladder cancer [ ICD-11: 2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 11

Methylation of SLC37A1 in bladder cancer [ 2 ]

Location

Body (cg08529312)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.01E+00 Statistic Test p-value: 1.69E-02; Z-score: -6.18E-01

Methylation in Case

8.00E-01 (Median) Methylation in Control 8.09E-01 (Median)

Studied Phenotype

Bladder cancer [ ICD-11: 2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 12

Methylation of SLC37A1 in bladder cancer [ 2 ]

Location

Body (cg00288945)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.03E+00 Statistic Test p-value: 3.14E-02; Z-score: -1.27E+00

Methylation in Case

8.35E-01 (Median) Methylation in Control 8.60E-01 (Median)

Studied Phenotype

Bladder cancer [ ICD-11: 2C94]

Experimental Material

Patient tissue samples

  Breast cancer

         17 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

Methylation of SLC37A1 in breast cancer [ 3 ]

Location

5'UTR (cg17398613)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.07E+00 Statistic Test p-value: 3.70E-09; Z-score: 1.02E+00

Methylation in Case

7.53E-01 (Median) Methylation in Control 7.04E-01 (Median)

Studied Phenotype

Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 2

Methylation of SLC37A1 in breast cancer [ 3 ]

Location

5'UTR (cg23336810)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.19E+00 Statistic Test p-value: 2.89E-06; Z-score: -1.22E+00

Methylation in Case

5.50E-01 (Median) Methylation in Control 6.55E-01 (Median)

Studied Phenotype

Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 3

Methylation of SLC37A1 in breast cancer [ 3 ]

Location

5'UTR (cg09546172)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.39E+00 Statistic Test p-value: 4.50E-06; Z-score: -1.10E+00

Methylation in Case

9.30E-02 (Median) Methylation in Control 1.29E-01 (Median)

Studied Phenotype

Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 4

Methylation of SLC37A1 in breast cancer [ 3 ]

Location

TSS1500 (cg13265003)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.05E+00 Statistic Test p-value: 3.15E-06; Z-score: -6.75E-01

Methylation in Case

6.74E-01 (Median) Methylation in Control 7.04E-01 (Median)

Studied Phenotype

Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 5

Methylation of SLC37A1 in breast cancer [ 3 ]

Location

TSS1500 (cg17218342)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.06E+00 Statistic Test p-value: 1.36E-05; Z-score: -1.20E+00

Methylation in Case

7.55E-01 (Median) Methylation in Control 8.01E-01 (Median)

Studied Phenotype

Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 6

Methylation of SLC37A1 in breast cancer [ 3 ]

Location

TSS1500 (cg08599496)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.11E+00 Statistic Test p-value: 2.28E-02; Z-score: -8.74E-01

Methylation in Case

6.64E-01 (Median) Methylation in Control 7.39E-01 (Median)

Studied Phenotype

Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 7

Methylation of SLC37A1 in breast cancer [ 3 ]

Location

TSS200 (cg20002045)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.05E+00 Statistic Test p-value: 4.59E-02; Z-score: 1.12E+00

Methylation in Case

8.46E-01 (Median) Methylation in Control 8.07E-01 (Median)

Studied Phenotype

Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 8

Methylation of SLC37A1 in breast cancer [ 3 ]

Location

Body (cg04096368)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.14E+00 Statistic Test p-value: 9.92E-09; Z-score: -1.69E+00

Methylation in Case

5.75E-01 (Median) Methylation in Control 6.55E-01 (Median)

Studied Phenotype

Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 9

Methylation of SLC37A1 in breast cancer [ 3 ]

Location

Body (cg18478353)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.07E+00 Statistic Test p-value: 3.41E-08; Z-score: 1.17E+00

Methylation in Case

7.23E-01 (Median) Methylation in Control 6.76E-01 (Median)

Studied Phenotype

Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 10

Methylation of SLC37A1 in breast cancer [ 3 ]

Location

Body (cg13960334)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.08E+00 Statistic Test p-value: 2.98E-06; Z-score: 9.40E-01

Methylation in Case

9.54E-01 (Median) Methylation in Control 8.83E-01 (Median)

Studied Phenotype

Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 11

Methylation of SLC37A1 in breast cancer [ 3 ]

Location

Body (cg08529312)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.09E+00 Statistic Test p-value: 1.03E-05; Z-score: 9.00E-01

Methylation in Case

7.86E-01 (Median) Methylation in Control 7.20E-01 (Median)

Studied Phenotype

Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 12

Methylation of SLC37A1 in breast cancer [ 3 ]

Location

Body (cg12409874)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.03E+00 Statistic Test p-value: 1.58E-04; Z-score: -7.28E-01

Methylation in Case

8.55E-01 (Median) Methylation in Control 8.79E-01 (Median)

Studied Phenotype

Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 13

Methylation of SLC37A1 in breast cancer [ 3 ]

Location

Body (cg13128052)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.02E+00 Statistic Test p-value: 2.12E-03; Z-score: -6.30E-01

Methylation in Case

8.18E-01 (Median) Methylation in Control 8.33E-01 (Median)

Studied Phenotype

Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 14

Methylation of SLC37A1 in breast cancer [ 3 ]

Location

Body (cg08193480)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.04E+00 Statistic Test p-value: 2.45E-02; Z-score: 4.64E-01

Methylation in Case

7.86E-01 (Median) Methylation in Control 7.57E-01 (Median)

Studied Phenotype

Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 15

Methylation of SLC37A1 in breast cancer [ 3 ]

Location

Body (cg12913778)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.06E+00 Statistic Test p-value: 2.81E-02; Z-score: 5.43E-01

Methylation in Case

5.06E-01 (Median) Methylation in Control 4.79E-01 (Median)

Studied Phenotype

Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 16

Methylation of SLC37A1 in breast cancer [ 3 ]

Location

Body (cg00288945)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.02E+00 Statistic Test p-value: 2.86E-02; Z-score: -2.12E-01

Methylation in Case

8.41E-01 (Median) Methylation in Control 8.56E-01 (Median)

Studied Phenotype

Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 17

Methylation of SLC37A1 in breast cancer [ 3 ]

Location

3'UTR (cg24141725)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.01E+00 Statistic Test p-value: 5.79E-03; Z-score: -4.14E-01

Methylation in Case

9.25E-01 (Median) Methylation in Control 9.31E-01 (Median)

Studied Phenotype

Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

Patient tissue samples

  Renal cell carcinoma

           4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

Methylation of SLC37A1 in clear cell renal cell carcinoma [ 4 ]

Location

5'UTR (cg09546172)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.50E+00 Statistic Test p-value: 4.50E-09; Z-score: -1.36E+00

Methylation in Case

5.91E-02 (Median) Methylation in Control 8.88E-02 (Median)

Studied Phenotype

Renal cell carcinoma [ ICD-11: 2C90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 2

Methylation of SLC37A1 in clear cell renal cell carcinoma [ 4 ]

Location

5'UTR (cg23336810)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.19E+00 Statistic Test p-value: 5.62E-04; Z-score: -2.38E+00

Methylation in Case

6.86E-01 (Median) Methylation in Control 8.17E-01 (Median)

Studied Phenotype

Renal cell carcinoma [ ICD-11: 2C90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 3

Methylation of SLC37A1 in clear cell renal cell carcinoma [ 4 ]

Location

5'UTR (cg22599036)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.10E+00 Statistic Test p-value: 2.22E-02; Z-score: 4.36E-01

Methylation in Case

2.13E-02 (Median) Methylation in Control 1.94E-02 (Median)

Studied Phenotype

Renal cell carcinoma [ ICD-11: 2C90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 4

Methylation of SLC37A1 in clear cell renal cell carcinoma [ 4 ]

Location

Body (cg08193480)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.01E+00 Statistic Test p-value: 5.13E-03; Z-score: -1.05E+00

Methylation in Case

9.33E-01 (Median) Methylation in Control 9.43E-01 (Median)

Studied Phenotype

Renal cell carcinoma [ ICD-11: 2C90]

Experimental Material

Patient tissue samples

  Colorectal cancer

         13 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

Methylation of SLC37A1 in colorectal cancer [ 5 ]

Location

5'UTR (cg00549412)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.09E+00 Statistic Test p-value: 2.03E-04; Z-score: -1.03E+00

Methylation in Case

6.99E-01 (Median) Methylation in Control 7.63E-01 (Median)

Studied Phenotype

Colorectal cancer [ ICD-11: 2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 2

Methylation of SLC37A1 in colorectal cancer [ 5 ]

Location

5'UTR (cg06579790)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.29E+00 Statistic Test p-value: 4.55E-03; Z-score: -5.25E-01

Methylation in Case

2.60E-02 (Median) Methylation in Control 3.35E-02 (Median)

Studied Phenotype

Colorectal cancer [ ICD-11: 2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 3

Methylation of SLC37A1 in colorectal cancer [ 5 ]

Location

5'UTR (cg17398613)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.01E+00 Statistic Test p-value: 1.51E-02; Z-score: -3.27E-01

Methylation in Case

8.98E-01 (Median) Methylation in Control 9.07E-01 (Median)

Studied Phenotype

Colorectal cancer [ ICD-11: 2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 4

Methylation of SLC37A1 in colorectal cancer [ 5 ]

Location

TSS1500 (cg08599496)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.03E+00 Statistic Test p-value: 1.12E-08; Z-score: -2.10E+00

Methylation in Case

8.92E-01 (Median) Methylation in Control 9.17E-01 (Median)

Studied Phenotype

Colorectal cancer [ ICD-11: 2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 5

Methylation of SLC37A1 in colorectal cancer [ 5 ]

Location

TSS1500 (cg13265003)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.07E+00 Statistic Test p-value: 3.63E-05; Z-score: -1.15E+00

Methylation in Case

7.89E-01 (Median) Methylation in Control 8.43E-01 (Median)

Studied Phenotype

Colorectal cancer [ ICD-11: 2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 6

Methylation of SLC37A1 in colorectal cancer [ 5 ]

Location

TSS200 (cg20002045)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.00E+00 Statistic Test p-value: 4.77E-02; Z-score: -1.52E-01

Methylation in Case

9.35E-01 (Median) Methylation in Control 9.37E-01 (Median)

Studied Phenotype

Colorectal cancer [ ICD-11: 2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 7

Methylation of SLC37A1 in colorectal cancer [ 5 ]

Location

Body (cg08529312)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.01E+00 Statistic Test p-value: 7.53E-05; Z-score: -9.78E-01

Methylation in Case

9.05E-01 (Median) Methylation in Control 9.17E-01 (Median)

Studied Phenotype

Colorectal cancer [ ICD-11: 2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 8

Methylation of SLC37A1 in colorectal cancer [ 5 ]

Location

Body (cg08193480)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.01E+00 Statistic Test p-value: 8.91E-04; Z-score: -6.57E-01

Methylation in Case

9.35E-01 (Median) Methylation in Control 9.40E-01 (Median)

Studied Phenotype

Colorectal cancer [ ICD-11: 2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 9

Methylation of SLC37A1 in colorectal cancer [ 5 ]

Location

Body (cg11453546)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.09E+00 Statistic Test p-value: 1.29E-03; Z-score: -8.77E-01

Methylation in Case

6.59E-01 (Median) Methylation in Control 7.17E-01 (Median)

Studied Phenotype

Colorectal cancer [ ICD-11: 2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 10

Methylation of SLC37A1 in colorectal cancer [ 5 ]

Location

Body (cg04192258)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.00E+00 Statistic Test p-value: 3.51E-03; Z-score: -1.46E-01

Methylation in Case

9.68E-01 (Median) Methylation in Control 9.69E-01 (Median)

Studied Phenotype

Colorectal cancer [ ICD-11: 2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 11

Methylation of SLC37A1 in colorectal cancer [ 5 ]

Location

Body (cg13960334)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.00E+00 Statistic Test p-value: 3.18E-02; Z-score: -5.60E-01

Methylation in Case

9.64E-01 (Median) Methylation in Control 9.69E-01 (Median)

Studied Phenotype

Colorectal cancer [ ICD-11: 2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 12

Methylation of SLC37A1 in colorectal cancer [ 5 ]

Location

Body (cg18478353)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.01E+00 Statistic Test p-value: 4.46E-02; Z-score: -2.41E-01

Methylation in Case

8.78E-01 (Median) Methylation in Control 8.82E-01 (Median)

Studied Phenotype

Colorectal cancer [ ICD-11: 2B91]

Experimental Material

Patient tissue samples

  Hepatocellular carcinoma

         15 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

Methylation of SLC37A1 in hepatocellular carcinoma [ 6 ]

Location

5'UTR (cg23336810)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.07E+00 Statistic Test p-value: 4.59E-03; Z-score: 9.06E-01

Methylation in Case

8.30E-01 (Median) Methylation in Control 7.76E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 2

Methylation of SLC37A1 in hepatocellular carcinoma [ 6 ]

Location

TSS1500 (cg08599496)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.05E+00 Statistic Test p-value: 8.19E-07; Z-score: -1.47E+00

Methylation in Case

7.98E-01 (Median) Methylation in Control 8.37E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 3

Methylation of SLC37A1 in hepatocellular carcinoma [ 6 ]

Location

TSS1500 (cg17218342)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.01E+00 Statistic Test p-value: 1.34E-02; Z-score: -2.79E-01

Methylation in Case

8.35E-01 (Median) Methylation in Control 8.46E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 4

Methylation of SLC37A1 in hepatocellular carcinoma [ 6 ]

Location

Body (cg13730736)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.71E+00 Statistic Test p-value: 2.71E-19; Z-score: -3.83E+00

Methylation in Case

2.96E-01 (Median) Methylation in Control 5.07E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 5

Methylation of SLC37A1 in hepatocellular carcinoma [ 6 ]

Location

Body (cg08033262)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.67E+00 Statistic Test p-value: 1.13E-18; Z-score: -9.23E+00

Methylation in Case

5.02E-01 (Median) Methylation in Control 8.38E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 6

Methylation of SLC37A1 in hepatocellular carcinoma [ 6 ]

Location

Body (cg13960334)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.02E+00 Statistic Test p-value: 1.59E-05; Z-score: 9.05E-01

Methylation in Case

9.61E-01 (Median) Methylation in Control 9.41E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 7

Methylation of SLC37A1 in hepatocellular carcinoma [ 6 ]

Location

Body (cg12409874)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.04E+00 Statistic Test p-value: 1.86E-05; Z-score: -1.35E+00

Methylation in Case

8.42E-01 (Median) Methylation in Control 8.76E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 8

Methylation of SLC37A1 in hepatocellular carcinoma [ 6 ]

Location

Body (cg12913778)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.13E+00 Statistic Test p-value: 3.02E-05; Z-score: 2.54E+00

Methylation in Case

6.37E-01 (Median) Methylation in Control 5.65E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 9

Methylation of SLC37A1 in hepatocellular carcinoma [ 6 ]

Location

Body (cg04096368)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.02E+00 Statistic Test p-value: 4.96E-04; Z-score: -3.69E-01

Methylation in Case

7.94E-01 (Median) Methylation in Control 8.08E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 10

Methylation of SLC37A1 in hepatocellular carcinoma [ 6 ]

Location

Body (cg18478353)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.02E+00 Statistic Test p-value: 2.95E-03; Z-score: -5.54E-01

Methylation in Case

7.15E-01 (Median) Methylation in Control 7.31E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 11

Methylation of SLC37A1 in hepatocellular carcinoma [ 6 ]

Location

Body (cg00288945)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.02E+00 Statistic Test p-value: 4.00E-03; Z-score: -5.45E-01

Methylation in Case

8.39E-01 (Median) Methylation in Control 8.58E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 12

Methylation of SLC37A1 in hepatocellular carcinoma [ 6 ]

Location

Body (cg11453546)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.04E+00 Statistic Test p-value: 1.12E-02; Z-score: 5.77E-01

Methylation in Case

7.16E-01 (Median) Methylation in Control 6.87E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 13

Methylation of SLC37A1 in hepatocellular carcinoma [ 6 ]

Location

Body (cg08193480)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.01E+00 Statistic Test p-value: 1.56E-02; Z-score: 4.79E-01

Methylation in Case

8.52E-01 (Median) Methylation in Control 8.43E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 14

Methylation of SLC37A1 in hepatocellular carcinoma [ 6 ]

Location

Body (cg04192258)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.00E+00 Statistic Test p-value: 1.85E-02; Z-score: -4.29E-01

Methylation in Case

9.62E-01 (Median) Methylation in Control 9.67E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 15

Methylation of SLC37A1 in hepatocellular carcinoma [ 6 ]

Location

3'UTR (cg24141725)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.01E+00 Statistic Test p-value: 1.25E-02; Z-score: -4.50E-01

Methylation in Case

9.09E-01 (Median) Methylation in Control 9.18E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

Patient tissue samples

  HIV infection

           9 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

Methylation of SLC37A1 in HIV infection [ 7 ]

Location

5'UTR (cg00549412)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.10E+00 Statistic Test p-value: 1.32E-12; Z-score: 1.45E+00

Methylation in Case

7.80E-01 (Median) Methylation in Control 7.11E-01 (Median)

Studied Phenotype

HIV infection [ ICD-11: 1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 2

Methylation of SLC37A1 in HIV infection [ 7 ]

Location

5'UTR (cg17398613)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.11E+00 Statistic Test p-value: 4.91E-12; Z-score: 1.56E+00

Methylation in Case

8.52E-01 (Median) Methylation in Control 7.66E-01 (Median)

Studied Phenotype

HIV infection [ ICD-11: 1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 3

Methylation of SLC37A1 in HIV infection [ 7 ]

Location

TSS1500 (cg13265003)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.48E+00 Statistic Test p-value: 2.83E-17; Z-score: 5.44E+00

Methylation in Case

8.23E-01 (Median) Methylation in Control 5.55E-01 (Median)

Studied Phenotype

HIV infection [ ICD-11: 1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 4

Methylation of SLC37A1 in HIV infection [ 7 ]

Location

Body (cg18478353)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.04E+00 Statistic Test p-value: 1.29E-05; Z-score: 7.23E-01

Methylation in Case

8.04E-01 (Median) Methylation in Control 7.75E-01 (Median)

Studied Phenotype

HIV infection [ ICD-11: 1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 5

Methylation of SLC37A1 in HIV infection [ 7 ]

Location

Body (cg00288945)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.04E+00 Statistic Test p-value: 1.71E-03; Z-score: -1.09E+00

Methylation in Case

9.09E-01 (Median) Methylation in Control 9.47E-01 (Median)

Studied Phenotype

HIV infection [ ICD-11: 1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 6

Methylation of SLC37A1 in HIV infection [ 7 ]

Location

Body (cg12913778)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.04E+00 Statistic Test p-value: 1.73E-03; Z-score: 6.52E-01

Methylation in Case

6.73E-01 (Median) Methylation in Control 6.46E-01 (Median)

Studied Phenotype

HIV infection [ ICD-11: 1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 7

Methylation of SLC37A1 in HIV infection [ 7 ]

Location

Body (cg04096368)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.05E+00 Statistic Test p-value: 2.75E-03; Z-score: -1.38E+00

Methylation in Case

8.20E-01 (Median) Methylation in Control 8.62E-01 (Median)

Studied Phenotype

HIV infection [ ICD-11: 1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 8

Methylation of SLC37A1 in HIV infection [ 7 ]

Location

Body (cg13128052)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.02E+00 Statistic Test p-value: 5.53E-03; Z-score: -6.34E-01

Methylation in Case

8.34E-01 (Median) Methylation in Control 8.49E-01 (Median)

Studied Phenotype

HIV infection [ ICD-11: 1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 9

Methylation of SLC37A1 in HIV infection [ 7 ]

Location

Body (cg08529312)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.02E+00 Statistic Test p-value: 6.17E-03; Z-score: -7.43E-01

Methylation in Case

8.61E-01 (Median) Methylation in Control 8.78E-01 (Median)

Studied Phenotype

HIV infection [ ICD-11: 1C62.Z]

Experimental Material

Patient tissue samples

  Lung adenocarcinoma

           2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

Methylation of SLC37A1 in lung adenocarcinoma [ 8 ]

Location

5'UTR (cg17398613)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.11E+00 Statistic Test p-value: 2.86E-03; Z-score: 1.68E+00

Methylation in Case

7.87E-01 (Median) Methylation in Control 7.11E-01 (Median)

Studied Phenotype

Lung adenocarcinoma [ ICD-11: 2C25.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 2

Methylation of SLC37A1 in lung adenocarcinoma [ 8 ]

Location

5'UTR (cg01879556)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.05E+00 Statistic Test p-value: 3.32E-03; Z-score: -1.52E+00

Methylation in Case

7.36E-01 (Median) Methylation in Control 7.75E-01 (Median)

Studied Phenotype

Lung adenocarcinoma [ ICD-11: 2C25.0]

Experimental Material

Patient tissue samples

  Papillary thyroid cancer

         10 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

Methylation of SLC37A1 in papillary thyroid cancer [ 9 ]

Location

5'UTR (cg17398613)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.11E+00 Statistic Test p-value: 1.16E-08; Z-score: 1.36E+00

Methylation in Case

7.71E-01 (Median) Methylation in Control 6.93E-01 (Median)

Studied Phenotype

Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 2

Methylation of SLC37A1 in papillary thyroid cancer [ 9 ]

Location

5'UTR (cg09546172)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.08E+00 Statistic Test p-value: 4.46E-02; Z-score: -5.46E-01

Methylation in Case

1.04E-01 (Median) Methylation in Control 1.12E-01 (Median)

Studied Phenotype

Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 3

Methylation of SLC37A1 in papillary thyroid cancer [ 9 ]

Location

TSS1500 (cg17218342)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.04E+00 Statistic Test p-value: 1.61E-04; Z-score: -7.74E-01

Methylation in Case

7.54E-01 (Median) Methylation in Control 7.81E-01 (Median)

Studied Phenotype

Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 4

Methylation of SLC37A1 in papillary thyroid cancer [ 9 ]

Location

Body (cg12409874)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.07E+00 Statistic Test p-value: 7.03E-09; Z-score: -2.45E+00

Methylation in Case

8.61E-01 (Median) Methylation in Control 9.21E-01 (Median)

Studied Phenotype

Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 5

Methylation of SLC37A1 in papillary thyroid cancer [ 9 ]

Location

Body (cg13128052)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.04E+00 Statistic Test p-value: 2.81E-05; Z-score: -1.19E+00

Methylation in Case

8.58E-01 (Median) Methylation in Control 8.91E-01 (Median)

Studied Phenotype

Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 6

Methylation of SLC37A1 in papillary thyroid cancer [ 9 ]

Location

Body (cg18478353)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.05E+00 Statistic Test p-value: 7.53E-05; Z-score: 1.24E+00

Methylation in Case

7.98E-01 (Median) Methylation in Control 7.59E-01 (Median)

Studied Phenotype

Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 7

Methylation of SLC37A1 in papillary thyroid cancer [ 9 ]

Location

Body (cg08193480)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.02E+00 Statistic Test p-value: 2.51E-04; Z-score: -8.41E-01

Methylation in Case

8.92E-01 (Median) Methylation in Control 9.06E-01 (Median)

Studied Phenotype

Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 8

Methylation of SLC37A1 in papillary thyroid cancer [ 9 ]

Location

Body (cg08529312)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.01E+00 Statistic Test p-value: 7.43E-04; Z-score: -5.63E-01

Methylation in Case

8.92E-01 (Median) Methylation in Control 9.03E-01 (Median)

Studied Phenotype

Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 9

Methylation of SLC37A1 in papillary thyroid cancer [ 9 ]

Location

Body (cg13960334)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.01E+00 Statistic Test p-value: 1.32E-03; Z-score: -6.81E-01

Methylation in Case

9.35E-01 (Median) Methylation in Control 9.45E-01 (Median)

Studied Phenotype

Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 10

Methylation of SLC37A1 in papillary thyroid cancer [ 9 ]

Location

Body (cg04096368)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.13E+00 Statistic Test p-value: 3.75E-02; Z-score: -7.88E-01

Methylation in Case

3.69E-01 (Median) Methylation in Control 4.19E-01 (Median)

Studied Phenotype

Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

Patient tissue samples

  Systemic lupus erythematosus

           4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

Methylation of SLC37A1 in systemic lupus erythematosus [ 10 ]

Location

5'UTR (cg01879556)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.01E+00 Statistic Test p-value: 7.41E-03; Z-score: -7.18E-02

Methylation in Case

7.75E-01 (Median) Methylation in Control 7.79E-01 (Median)

Studied Phenotype

Systemic lupus erythematosus [ ICD-11: 4A40.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 2

Methylation of SLC37A1 in systemic lupus erythematosus [ 10 ]

Location

TSS1500 (cg08599496)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.01E+00 Statistic Test p-value: 2.16E-02; Z-score: -1.39E-01

Methylation in Case

8.58E-01 (Median) Methylation in Control 8.63E-01 (Median)

Studied Phenotype

Systemic lupus erythematosus [ ICD-11: 4A40.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 3

Methylation of SLC37A1 in systemic lupus erythematosus [ 10 ]

Location

Body (cg11453546)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.01E+00 Statistic Test p-value: 1.97E-02; Z-score: -1.44E-01

Methylation in Case

5.48E-01 (Median) Methylation in Control 5.56E-01 (Median)

Studied Phenotype

Systemic lupus erythematosus [ ICD-11: 4A40.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 4

Methylation of SLC37A1 in systemic lupus erythematosus [ 10 ]

Location

Body (cg04192258)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.00E+00 Statistic Test p-value: 3.92E-02; Z-score: -1.43E-01

Methylation in Case

9.55E-01 (Median) Methylation in Control 9.57E-01 (Median)

Studied Phenotype

Systemic lupus erythematosus [ ICD-11: 4A40.0]

Experimental Material

Patient tissue samples

  Pancretic ductal adenocarcinoma

         14 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

Methylation of SLC37A1 in pancretic ductal adenocarcinoma [ 11 ]

Location

TSS1500 (cg17816637)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.26E+00 Statistic Test p-value: 1.99E-11; Z-score: -2.09E+00

Methylation in Case

4.13E-01 (Median) Methylation in Control 5.19E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 2

Methylation of SLC37A1 in pancretic ductal adenocarcinoma [ 11 ]

Location

TSS1500 (cg14777768)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -3.26E+00 Statistic Test p-value: 2.72E-11; Z-score: -2.46E+00

Methylation in Case

1.12E-01 (Median) Methylation in Control 3.65E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 3

Methylation of SLC37A1 in pancretic ductal adenocarcinoma [ 11 ]

Location

TSS1500 (cg14153919)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.24E+00 Statistic Test p-value: 1.38E-10; Z-score: 1.99E+00

Methylation in Case

6.21E-01 (Median) Methylation in Control 5.03E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 4

Methylation of SLC37A1 in pancretic ductal adenocarcinoma [ 11 ]

Location

TSS1500 (cg13491563)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.10E+00 Statistic Test p-value: 2.09E-09; Z-score: -1.32E+00

Methylation in Case

5.83E-01 (Median) Methylation in Control 6.42E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 5

Methylation of SLC37A1 in pancretic ductal adenocarcinoma [ 11 ]

Location

TSS1500 (cg22685369)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.26E+00 Statistic Test p-value: 5.27E-09; Z-score: 8.24E-01

Methylation in Case

5.24E-02 (Median) Methylation in Control 4.17E-02 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 6

Methylation of SLC37A1 in pancretic ductal adenocarcinoma [ 11 ]

Location

TSS1500 (cg04395689)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 2.14E+00 Statistic Test p-value: 1.70E-06; Z-score: 1.65E+00

Methylation in Case

3.97E-01 (Median) Methylation in Control 1.86E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 7

Methylation of SLC37A1 in pancretic ductal adenocarcinoma [ 11 ]

Location

TSS1500 (cg04433322)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.17E+00 Statistic Test p-value: 1.05E-03; Z-score: -1.06E+00

Methylation in Case

5.40E-01 (Median) Methylation in Control 6.34E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 8

Methylation of SLC37A1 in pancretic ductal adenocarcinoma [ 11 ]

Location

Body (cg18865990)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.40E+00 Statistic Test p-value: 1.77E-11; Z-score: -1.96E+00

Methylation in Case

3.79E-01 (Median) Methylation in Control 5.31E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 9

Methylation of SLC37A1 in pancretic ductal adenocarcinoma [ 11 ]

Location

Body (cg08894629)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.39E+00 Statistic Test p-value: 2.15E-04; Z-score: -8.12E-01

Methylation in Case

9.52E-02 (Median) Methylation in Control 1.32E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 10

Methylation of SLC37A1 in pancretic ductal adenocarcinoma [ 11 ]

Location

Body (cg15507500)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.02E+00 Statistic Test p-value: 8.02E-03; Z-score: 1.13E+00

Methylation in Case

9.28E-01 (Median) Methylation in Control 9.12E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 11

Methylation of SLC37A1 in pancretic ductal adenocarcinoma [ 11 ]

Location

Body (cg09050775)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.19E+00 Statistic Test p-value: 8.70E-03; Z-score: 8.40E-01

Methylation in Case

5.11E-01 (Median) Methylation in Control 4.28E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 12

Methylation of SLC37A1 in pancretic ductal adenocarcinoma [ 11 ]

Location

Body (cg21821674)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.14E+00 Statistic Test p-value: 1.12E-02; Z-score: 6.66E-01

Methylation in Case

4.92E-01 (Median) Methylation in Control 4.30E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 13

Methylation of SLC37A1 in pancretic ductal adenocarcinoma [ 11 ]

Location

Body (cg06660015)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.19E+00 Statistic Test p-value: 1.14E-02; Z-score: -7.14E-01

Methylation in Case

2.47E-01 (Median) Methylation in Control 2.94E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 14

Methylation of SLC37A1 in pancretic ductal adenocarcinoma [ 11 ]

Location

Body (cg15999077)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.06E+00 Statistic Test p-value: 2.24E-02; Z-score: -4.81E-01

Methylation in Case

5.07E-01 (Median) Methylation in Control 5.37E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

Patient tissue samples

  Prostate cancer

           3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

Methylation of SLC37A1 in prostate cancer [ 12 ]

Location

TSS1500 (cg15930596)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.49E+00 Statistic Test p-value: 4.01E-02; Z-score: 6.00E+00

Methylation in Case

1.40E-01 (Median) Methylation in Control 9.36E-02 (Median)

Studied Phenotype

Prostate cancer [ ICD-11: 2C82]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 2

Methylation of SLC37A1 in prostate cancer [ 12 ]

Location

TSS1500 (cg22685369)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.35E+00 Statistic Test p-value: 4.74E-02; Z-score: -3.96E+00

Methylation in Case

3.00E-02 (Median) Methylation in Control 4.04E-02 (Median)

Studied Phenotype

Prostate cancer [ ICD-11: 2C82]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 3

Methylation of SLC37A1 in prostate cancer [ 12 ]

Location

Body (cg06903325)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.03E+00 Statistic Test p-value: 3.57E-02; Z-score: 1.29E+00

Methylation in Case

9.60E-01 (Median) Methylation in Control 9.36E-01 (Median)

Studied Phenotype

Prostate cancer [ ICD-11: 2C82]

Experimental Material

Patient tissue samples

  Colon cancer

           4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

Methylation of SLC37A1 in colon adenocarcinoma [ 13 ]

Location

Body (cg13551505)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.44E+00 Statistic Test p-value: 1.12E-07; Z-score: -3.44E+00

Methylation in Case

3.96E-01 (Median) Methylation in Control 5.70E-01 (Median)

Studied Phenotype

Colon cancer [ ICD-11: 2B90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 2

Methylation of SLC37A1 in colon adenocarcinoma [ 13 ]

Location

Body (cg01082559)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.09E+00 Statistic Test p-value: 1.26E-04; Z-score: -2.45E+00

Methylation in Case

7.65E-01 (Median) Methylation in Control 8.37E-01 (Median)

Studied Phenotype

Colon cancer [ ICD-11: 2B90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 3

Methylation of SLC37A1 in colon adenocarcinoma [ 13 ]

Location

Body (cg08581937)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 3.05E+00 Statistic Test p-value: 8.16E-04; Z-score: 3.57E+00

Methylation in Case

2.15E-01 (Median) Methylation in Control 7.06E-02 (Median)

Studied Phenotype

Colon cancer [ ICD-11: 2B90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 4

Methylation of SLC37A1 in colon adenocarcinoma [ 13 ]

Location

Body (cg24944109)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.32E+00 Statistic Test p-value: 3.29E-03; Z-score: 1.32E+00

Methylation in Case

3.09E-01 (Median) Methylation in Control 2.34E-01 (Median)

Studied Phenotype

Colon cancer [ ICD-11: 2B90]

Experimental Material

Patient tissue samples

  Panic disorder

           2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

Methylation of SLC37A1 in panic disorder [ 14 ]

Location

Body (cg12409874)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.06E+00 Statistic Test p-value: 1.68E-03; Z-score: 6.03E-01

Methylation in Case

2.79E+00 (Median) Methylation in Control 2.62E+00 (Median)

Studied Phenotype

Panic disorder [ ICD-11: 6B01]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 2

Methylation of SLC37A1 in panic disorder [ 14 ]

Location

Body (cg08529312)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.08E+00 Statistic Test p-value: 2.07E-02; Z-score: 5.71E-01

Methylation in Case

2.80E+00 (Median) Methylation in Control 2.60E+00 (Median)

Studied Phenotype

Panic disorder [ ICD-11: 6B01]

Experimental Material

Patient tissue samples

  Cerebellar liponeurocytoma

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

Moderate hypermethylation of SLC37A1 in cerebellar liponeurocytoma than that in healthy individual

Studied Phenotype

Cerebellar liponeurocytoma [ICD-11:2A00.0Y]

The Methylation Level of Disease Section Compare with the Healthy Individual

p-value: 0.007416241; Fold-change: 0.236321798; Z-score: 1.528412788
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples

  Chordoma

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

Moderate hypermethylation of SLC37A1 in chordoma than that in healthy individual

Studied Phenotype

Chordoma [ICD-11:5A61.0]

The Methylation Level of Disease Section Compare with the Healthy Individual

p-value: 0.00189494; Fold-change: 0.259010689; Z-score: 1.485990013
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples

  Craniopharyngioma

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

Moderate hypermethylation of SLC37A1 in craniopharyngioma than that in healthy individual

Studied Phenotype

Craniopharyngioma [ICD-11:2F9A]

The Methylation Level of Disease Section Compare with the Healthy Individual

p-value: 2.87E-09; Fold-change: 0.211924252; Z-score: 1.398096231
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples

  Melanocytoma

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

Moderate hypermethylation of SLC37A1 in melanocytoma than that in healthy individual

Studied Phenotype

Melanocytoma [ICD-11:2F36.2]

The Methylation Level of Disease Section Compare with the Healthy Individual

p-value: 2.24E-11; Fold-change: 0.277512459; Z-score: 2.351163478
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples

  Oligodendroglioma

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

Moderate hypermethylation of SLC37A1 in oligodendroglioma than that in healthy individual

Studied Phenotype

Oligodendroglioma [ICD-11:2A00.0Y]

The Methylation Level of Disease Section Compare with the Healthy Individual

p-value: 8.75E-20; Fold-change: 0.207985187; Z-score: 1.519737076
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples

  Chronic myelogenous leukemia

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

Moderate hypomethylation of SLC37A1 in chronic myelogenous leukaemia than that in healthy individual

Studied Phenotype

Chronic myelogenous leukemia [ICD-11:2A20.0]

The Methylation Level of Disease Section Compare with the Healthy Individual

p-value: 0.014111374; Fold-change: -0.299646286; Z-score: -1.346764594
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples

  Multilayered rosettes embryonal tumour

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

Significant hypomethylation of SLC37A1 in multilayered rosettes embryonal tumour than that in healthy individual

Studied Phenotype

Multilayered rosettes embryonal tumour [ICD-11:2A00.1]

The Methylation Level of Disease Section Compare with the Healthy Individual

p-value: 6.71E-20; Fold-change: -0.365086283; Z-score: -2.690029482
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples

microRNA

  Unclear Phenotype

           3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

miR-19a directly targets SLC37A1 [ 15 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-19a miRNA Mature ID miR-19a-3p

miRNA Sequence

UGUGCAAAUCUAUGCAAAACUGA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon 2

miR-19b directly targets SLC37A1 [ 15 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-19b miRNA Mature ID miR-19b-3p

miRNA Sequence

UGUGCAAAUCCAUGCAAAACUGA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon 3

miR-335 directly targets SLC37A1 [ 16 ]

Epigenetic Type

microRNA Experiment Method Microarray

miRNA Stemloop ID

miR-335 miRNA Mature ID miR-335-5p

miRNA Sequence

UCAAGAGCAAUAACGAAAAAUGU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human
References
1 Atypical Teratoid/Rhabdoid Tumors Are Comprised of Three Epigenetic Subgroups with Distinct Enhancer Landscapes. Cancer Cell. 2016 Mar 14;29(3):379-393.
2 DNA Methylation Dynamics in Urological Tumors.
3 Genome-wide Scan for Methylation Profiles in Breast Cancer
4 A CpG-methylation-based assay to predict survival in clear cell renal cell carcinoma. Nat Commun. 2015 Oct 30;6:8699.
5 Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
6 Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
7 HIV-1 Infection Accelerates Age According to the Epigenetic Clock. J Infect Dis. 2015 Nov 15;212(10):1563-73.
8 DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
9 Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
10 Genome-wide DNA methylation analysis of systemic lupus erythematosus reveals persistent hypomethylation of interferon genes and compositional changes to CD4+ T-cell populations. PLoS Genet. 2013;9(8):e1003678.
11 Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
12 Reducing the risk of false discovery enabling identification of biologically significant genome-wide methylation status using the HumanMethylation450 array. BMC Genomics. 2014 Jan 22;15:51.
13 Genome-scale analysis of DNA methylation in colorectal cancer using Infinium HumanMethylation450 BeadChips. Epigenetics. 2013 Sep;8(9):921-34.
14 DNA Methylation signatures in panic disorder. Transl Psychiatry. 2017 Dec 18;7(12):1287.
15 EBV and human microRNAs co-target oncogenic and apoptotic viral and human genes during latency. EMBO J. 2012 May 2;31(9):2207-21.
16 Endogenous human microRNAs that suppress breast cancer metastasis. Nature. 2008 Jan 10;451(7175):147-52.

If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.