Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID DTD0331 Transporter Info
Gene Name SLC38A4
Transporter Name Sodium-coupled neutral amino acid transporter 4
Gene ID
55089
UniProt ID
Q969I6
Epigenetic Regulations of This DT (EGR)

Histone acetylation

  Retinoic acid receptors (RAR) expression cells

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Hypocetylation of SLC38A4 in retinoic acid receptors (RAR) expression cells (compare with counterpart RAR knockout cells) [ 1 ]

Location

 Promoter

Epigenetic Type

 Histone acetylation Experiment Method Chromatin immunoprecipitation

Related Molecular Changes

 Down regulation of SLC38A4 Experiment Method RT-qPCR

Studied Phenotype

 Retinoic acid receptors (RAR) expression cells

Experimental Material

 Multiple cell lines of human

Additional Notes

 Increased SLC38A4 transcript levels was associated with decreased promoter CpG-island methylation and increased permissive histone modifications (H3K9/K14ac) in RAR knockout cells.

  Epigenetic Phenomenon 2

 Hypocetylation of SLC38A4 in retinoic acid receptors (RAR) expression cells (compare with counterpart RAR knockout cells) [ 1 ]

Location

 Promoter

Epigenetic Type

 Histone acetylation Experiment Method Chromatin immunoprecipitation

Related Molecular Changes

 Down regulation of SLC38A4 Experiment Method RT-qPCR

Studied Phenotype

 Retinoic acid receptors (RAR) expression cells

Experimental Material

 Multiple cell lines of human

Additional Notes

 Increased SLC38A4 transcript levels was associated with decreased promoter CpG-island methylation and increased permissive histone modifications (H3K9/K14ac) in RAR knockout cells.

Histone trimethylation

  Retinoic acid receptors (RAR) expression cells

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Lower level of histone trimethylation of SLC38A4 in retinoic acid receptors (RAR) expression cells (compare with counterpart RAR knockout cells) [ 1 ]

Location

 Promoter

Epigenetic Type

 Histone trimethylation Experiment Method Chromatin immunoprecipitation

Related Molecular Changes

 Down regulation of SLC38A4 Experiment Method RT-qPCR

Studied Phenotype

 Retinoic acid receptors (RAR) expression cells

Experimental Material

 Multiple cell lines of human

Additional Notes

 Increased SLC38A4 transcript levels was associated with decreased promoter CpG-island methylation and increased permissive histone modifications (H3K4me3) in RAR knockout cells.

microRNA

  Unclear Phenotype

          16 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 miR-1207 directly targets SLC38A4 [ 2 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-1207 miRNA Mature ID miR-1207-5p

miRNA Sequence

 UGGCAGGGAGGCUGGGAGGGG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 2

 miR-1255a directly targets SLC38A4 [ 2 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-1255a miRNA Mature ID miR-1255a

miRNA Sequence

 AGGAUGAGCAAAGAAAGUAGAUU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 3

 miR-1255b directly targets SLC38A4 [ 2 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-1255b miRNA Mature ID miR-1255b-5p

miRNA Sequence

 CGGAUGAGCAAAGAAAGUGGUU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 4

 miR-139 directly targets SLC38A4 [ 2 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-139 miRNA Mature ID miR-139-3p

miRNA Sequence

 UGGAGACGCGGCCCUGUUGGAGU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 5

 miR-1909 directly targets SLC38A4 [ 2 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-1909 miRNA Mature ID miR-1909-3p

miRNA Sequence

 CGCAGGGGCCGGGUGCUCACCG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 6

 miR-3150b directly targets SLC38A4 [ 2 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-3150b miRNA Mature ID miR-3150b-3p

miRNA Sequence

 UGAGGAGAUCGUCGAGGUUGG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 7

 miR-3153 directly targets SLC38A4 [ 2 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-3153 miRNA Mature ID miR-3153

miRNA Sequence

 GGGGAAAGCGAGUAGGGACAUUU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 8

 miR-335 directly targets SLC38A4 [ 3 ]

Epigenetic Type

 microRNA Experiment Method Microarray

miRNA Stemloop ID

 miR-335 miRNA Mature ID miR-335-5p

miRNA Sequence

 UCAAGAGCAAUAACGAAAAAUGU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 9

 miR-4689 directly targets SLC38A4 [ 2 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4689 miRNA Mature ID miR-4689

miRNA Sequence

 UUGAGGAGACAUGGUGGGGGCC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 10

 miR-4763 directly targets SLC38A4 [ 2 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4763 miRNA Mature ID miR-4763-3p

miRNA Sequence

 AGGCAGGGGCUGGUGCUGGGCGGG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 11

 miR-4784 directly targets SLC38A4 [ 2 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4784 miRNA Mature ID miR-4784

miRNA Sequence

 UGAGGAGAUGCUGGGACUGA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 12

 miR-6722 directly targets SLC38A4 [ 2 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6722 miRNA Mature ID miR-6722-3p

miRNA Sequence

 UGCAGGGGUCGGGUGGGCCAGG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 13

 miR-6733 directly targets SLC38A4 [ 2 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6733 miRNA Mature ID miR-6733-5p

miRNA Sequence

 UGGGAAAGACAAACUCAGAGUU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 14

 miR-6739 directly targets SLC38A4 [ 2 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6739 miRNA Mature ID miR-6739-5p

miRNA Sequence

 UGGGAAAGAGAAAGAACAAGUA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 15

 miR-6783 directly targets SLC38A4 [ 2 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6783 miRNA Mature ID miR-6783-5p

miRNA Sequence

 UAGGGGAAAAGUCCUGAUCCGG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 16

 miR-6858 directly targets SLC38A4 [ 2 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6858 miRNA Mature ID miR-6858-5p

miRNA Sequence

 GUGAGGAGGGGCUGGCAGGGAC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

Methylation

  Brain neuroblastoma

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Moderate hypomethylation of SLC38A4 in brain neuroblastoma than that in healthy individual

Studied Phenotype

 Brain neuroblastoma [ICD-11:2A00.11]

The Methylation Level of Disease Section Compare with the Healthy Individual

 p-value: 7.67E-08; Fold-change: -0.273660277; Z-score: -1.764817623
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue
Download DT methylation data in the tissue of healthy individual

  Melanoma

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Significant hypomethylation of SLC38A4 in melanoma than that in healthy individual

Studied Phenotype

 Melanoma [ICD-11:2C30]

The Methylation Level of Disease Section Compare with the Healthy Individual

 p-value: 0.002825619; Fold-change: -0.322844513; Z-score: -2.504565801
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue
Download DT methylation data in the tissue of healthy individual

  Multilayered rosettes embryonal tumour

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Significant hypomethylation of SLC38A4 in multilayered rosettes embryonal tumour than that in healthy individual

Studied Phenotype

 Multilayered rosettes embryonal tumour [ICD-11:2A00.1]

The Methylation Level of Disease Section Compare with the Healthy Individual

 p-value: 1.08E-25; Fold-change: -0.685232287; Z-score: -4.429837805
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue
Download DT methylation data in the tissue of healthy individual
References
1 Epigenetic regulation by RAR-alpha maintains ligand-independent transcriptional activity. Nucleic Acids Res. 2012 Jan;40(1):102-15.
2 In-depth analysis of the interaction of HIV-1 with cellular microRNA biogenesis and effector mechanisms. MBio. 2013 Apr 16;4(2):e000193.
3 Endogenous human microRNAs that suppress breast cancer metastasis. Nature. 2008 Jan 10;451(7175):147-52.

If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.