Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID DTD0364 Transporter Info
Gene Name SLC44A2
Transporter Name Choline transporter-like protein 2
Gene ID
57153
UniProt ID
Q8IWA5
Epigenetic Regulations of This DT (EGR)

Methylation

  Bladder cancer

            3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC44A2 in bladder cancer [ 1 ]

Location

 TSS1500 (cg26489057)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.21E+00 Statistic Test p-value: 3.44E-02; Z-score: 2.52E+00

Methylation in Case

 2.28E-01 (Median) Methylation in Control 1.88E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC44A2 in bladder cancer [ 1 ]

Location

 Body (cg06943912)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -3.92E+00 Statistic Test p-value: 5.56E-13; Z-score: -1.22E+01

Methylation in Case

 1.61E-01 (Median) Methylation in Control 6.30E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC44A2 in bladder cancer [ 1 ]

Location

 Body (cg08275454)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.06E+00 Statistic Test p-value: 5.20E-04; Z-score: -2.67E+00

Methylation in Case

 7.80E-01 (Median) Methylation in Control 8.26E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Breast cancer

            5 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC44A2 in breast cancer [ 2 ]

Location

 TSS1500 (cg26489057)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 2.12E+00 Statistic Test p-value: 1.53E-14; Z-score: 4.29E+00

Methylation in Case

 3.66E-01 (Median) Methylation in Control 1.73E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC44A2 in breast cancer [ 2 ]

Location

 TSS1500 (cg19392998)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 2.29E+00 Statistic Test p-value: 3.57E-12; Z-score: 2.94E+00

Methylation in Case

 2.35E-01 (Median) Methylation in Control 1.03E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC44A2 in breast cancer [ 2 ]

Location

 Body (cg06943912)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.37E+00 Statistic Test p-value: 7.32E-11; Z-score: -2.11E+00

Methylation in Case

 4.27E-01 (Median) Methylation in Control 5.84E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC44A2 in breast cancer [ 2 ]

Location

 Body (cg08275454)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.03E+00 Statistic Test p-value: 2.90E-05; Z-score: -9.00E-01

Methylation in Case

 8.03E-01 (Median) Methylation in Control 8.27E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC44A2 in breast cancer [ 2 ]

Location

 Body (cg11345505)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.99E+00 Statistic Test p-value: 3.47E-04; Z-score: -1.68E+00

Methylation in Case

 1.04E-01 (Median) Methylation in Control 2.06E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Renal cell carcinoma

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC44A2 in clear cell renal cell carcinoma [ 3 ]

Location

 TSS1500 (cg26489057)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.14E+00 Statistic Test p-value: 4.25E-02; Z-score: -7.35E-01

Methylation in Case

 3.29E-01 (Median) Methylation in Control 3.75E-01 (Median)

Studied Phenotype

 Renal cell carcinoma [ ICD-11: 2C90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC44A2 in clear cell renal cell carcinoma [ 3 ]

Location

 Body (cg12156831)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.05E+00 Statistic Test p-value: 2.76E-03; Z-score: 5.19E-01

Methylation in Case

 1.46E-02 (Median) Methylation in Control 1.39E-02 (Median)

Studied Phenotype

 Renal cell carcinoma [ ICD-11: 2C90]

Experimental Material

 Patient tissue samples

  Colorectal cancer

            5 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC44A2 in colorectal cancer [ 4 ]

Location

 TSS1500 (cg14792002)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.01E+00 Statistic Test p-value: 2.17E-02; Z-score: -6.70E-01

Methylation in Case

 8.90E-01 (Median) Methylation in Control 9.01E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC44A2 in colorectal cancer [ 4 ]

Location

 Body (cg06943912)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.64E+00 Statistic Test p-value: 7.19E-12; Z-score: -2.89E+00

Methylation in Case

 4.20E-01 (Median) Methylation in Control 6.90E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC44A2 in colorectal cancer [ 4 ]

Location

 Body (cg08275454)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.04E+00 Statistic Test p-value: 8.85E-08; Z-score: -2.90E+00

Methylation in Case

 8.82E-01 (Median) Methylation in Control 9.20E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC44A2 in colorectal cancer [ 4 ]

Location

 Body (cg01247891)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.06E+00 Statistic Test p-value: 1.40E-02; Z-score: 3.75E-01

Methylation in Case

 1.45E-01 (Median) Methylation in Control 1.37E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  HIV infection

            6 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC44A2 in HIV infection [ 5 ]

Location

 TSS1500 (cg19392998)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.26E+00 Statistic Test p-value: 2.64E-03; Z-score: 7.06E-01

Methylation in Case

 2.05E-01 (Median) Methylation in Control 1.63E-01 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC44A2 in HIV infection [ 5 ]

Location

 Body (cg06943912)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 3.43E+00 Statistic Test p-value: 1.06E-09; Z-score: 5.63E+00

Methylation in Case

 3.38E-01 (Median) Methylation in Control 9.87E-02 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC44A2 in HIV infection [ 5 ]

Location

 Body (cg08275454)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.03E+00 Statistic Test p-value: 1.51E-04; Z-score: -1.05E+00

Methylation in Case

 8.39E-01 (Median) Methylation in Control 8.64E-01 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC44A2 in HIV infection [ 5 ]

Location

 Body (cg01247891)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.18E+00 Statistic Test p-value: 1.04E-03; Z-score: 9.92E-01

Methylation in Case

 9.13E-02 (Median) Methylation in Control 7.74E-02 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC44A2 in HIV infection [ 5 ]

Location

 Body (cg15503663)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.28E+00 Statistic Test p-value: 7.27E-03; Z-score: 7.25E-01

Methylation in Case

 1.23E-02 (Median) Methylation in Control 9.60E-03 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLC44A2 in HIV infection [ 5 ]

Location

 Body (cg11345505)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.23E+00 Statistic Test p-value: 3.66E-02; Z-score: 8.48E-01

Methylation in Case

 6.64E-02 (Median) Methylation in Control 5.37E-02 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Papillary thyroid cancer

            5 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC44A2 in papillary thyroid cancer [ 6 ]

Location

 TSS1500 (cg26489057)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.18E+00 Statistic Test p-value: 7.10E-03; Z-score: 1.04E+00

Methylation in Case

 3.96E-01 (Median) Methylation in Control 3.34E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC44A2 in papillary thyroid cancer [ 6 ]

Location

 TSS1500 (cg19392998)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.10E+00 Statistic Test p-value: 3.95E-02; Z-score: 6.05E-01

Methylation in Case

 2.54E-01 (Median) Methylation in Control 2.31E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC44A2 in papillary thyroid cancer [ 6 ]

Location

 Body (cg11345505)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.13E+00 Statistic Test p-value: 1.18E-04; Z-score: -9.35E-01

Methylation in Case

 4.73E-01 (Median) Methylation in Control 5.34E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC44A2 in papillary thyroid cancer [ 6 ]

Location

 Body (cg08275454)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.02E+00 Statistic Test p-value: 4.10E-04; Z-score: -9.10E-01

Methylation in Case

 9.02E-01 (Median) Methylation in Control 9.17E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC44A2 in papillary thyroid cancer [ 6 ]

Location

 Body (cg01247891)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.11E+00 Statistic Test p-value: 4.28E-04; Z-score: -7.18E-01

Methylation in Case

 5.85E-02 (Median) Methylation in Control 6.48E-02 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Systemic lupus erythematosus

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC44A2 in systemic lupus erythematosus [ 7 ]

Location

 TSS200 (cg05567294)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.05E+00 Statistic Test p-value: 3.52E-02; Z-score: -1.44E-01

Methylation in Case

 1.85E-01 (Median) Methylation in Control 1.95E-01 (Median)

Studied Phenotype

 Systemic lupus erythematosus [ ICD-11: 4A40.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC44A2 in systemic lupus erythematosus [ 7 ]

Location

 Body (cg15503663)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.04E+00 Statistic Test p-value: 4.19E-02; Z-score: -1.18E-01

Methylation in Case

 1.08E-02 (Median) Methylation in Control 1.12E-02 (Median)

Studied Phenotype

 Systemic lupus erythematosus [ ICD-11: 4A40.0]

Experimental Material

 Patient tissue samples

  Atypical teratoid rhabdoid tumor

            5 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC44A2 in atypical teratoid rhabdoid tumor [ 8 ]

Location

 Body (cg01247891)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.24E+00 Statistic Test p-value: 5.68E-05; Z-score: -1.02E+00

Methylation in Case

 4.99E-01 (Median) Methylation in Control 6.19E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC44A2 in atypical teratoid rhabdoid tumor [ 8 ]

Location

 Body (cg06943912)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.22E+00 Statistic Test p-value: 3.09E-03; Z-score: 2.31E-01

Methylation in Case

 8.17E-02 (Median) Methylation in Control 6.68E-02 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC44A2 in atypical teratoid rhabdoid tumor [ 8 ]

Location

 Body (cg08275454)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.08E+00 Statistic Test p-value: 5.64E-03; Z-score: 7.08E-01

Methylation in Case

 8.28E-01 (Median) Methylation in Control 7.66E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC44A2 in atypical teratoid rhabdoid tumor [ 8 ]

Location

 Body (cg11345505)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.13E+00 Statistic Test p-value: 2.14E-02; Z-score: -1.32E-01

Methylation in Case

 2.94E-02 (Median) Methylation in Control 3.33E-02 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC44A2 in atypical teratoid rhabdoid tumor [ 8 ]

Location

 Body (cg12156831)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.01E+00 Statistic Test p-value: 2.68E-02; Z-score: -6.74E-02

Methylation in Case

 1.34E-01 (Median) Methylation in Control 1.36E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Colon cancer

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC44A2 in colon adenocarcinoma [ 9 ]

Location

 Body (cg01550915)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.12E+00 Statistic Test p-value: 4.48E-04; Z-score: -3.31E+00

Methylation in Case

 7.36E-01 (Median) Methylation in Control 8.22E-01 (Median)

Studied Phenotype

 Colon cancer [ ICD-11: 2B90]

Experimental Material

 Patient tissue samples

  Depression

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC44A2 in depression [ 10 ]

Location

 Body (cg11345505)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.04E+00 Statistic Test p-value: 4.22E-02; Z-score: -2.19E-01

Methylation in Case

 6.05E-02 (Median) Methylation in Control 6.28E-02 (Median)

Studied Phenotype

 Depression [ ICD-11: 6A8Z]

Experimental Material

 Patient tissue samples

  Hepatocellular carcinoma

            5 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC44A2 in hepatocellular carcinoma [ 11 ]

Location

 Body (cg08275454)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.16E+00 Statistic Test p-value: 6.14E-09; Z-score: -1.73E+00

Methylation in Case

 6.79E-01 (Median) Methylation in Control 7.88E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC44A2 in hepatocellular carcinoma [ 11 ]

Location

 Body (cg11345505)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.34E+00 Statistic Test p-value: 7.82E-06; Z-score: 1.29E+00

Methylation in Case

 5.27E-01 (Median) Methylation in Control 3.94E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC44A2 in hepatocellular carcinoma [ 11 ]

Location

 Body (cg01247891)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.01E+00 Statistic Test p-value: 1.97E-03; Z-score: 2.31E-02

Methylation in Case

 8.64E-02 (Median) Methylation in Control 8.58E-02 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC44A2 in hepatocellular carcinoma [ 11 ]

Location

 Body (cg15503663)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.02E+00 Statistic Test p-value: 6.75E-03; Z-score: -2.86E-02

Methylation in Case

 2.43E-02 (Median) Methylation in Control 2.47E-02 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC44A2 in hepatocellular carcinoma [ 11 ]

Location

 Body (cg12156831)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.02E+00 Statistic Test p-value: 2.52E-02; Z-score: 4.05E-02

Methylation in Case

 2.17E-02 (Median) Methylation in Control 2.13E-02 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Pancretic ductal adenocarcinoma

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC44A2 in pancretic ductal adenocarcinoma [ 12 ]

Location

 Body (cg17836790)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.07E+00 Statistic Test p-value: 4.24E-08; Z-score: 1.30E+00

Methylation in Case

 6.00E-01 (Median) Methylation in Control 5.60E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC44A2 in pancretic ductal adenocarcinoma [ 12 ]

Location

 Body (cg02614661)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.08E+00 Statistic Test p-value: 9.12E-06; Z-score: -1.28E+00

Methylation in Case

 7.82E-01 (Median) Methylation in Control 8.43E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Panic disorder

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC44A2 in panic disorder [ 13 ]

Location

 Body (cg06943912)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -9.68E-01 Statistic Test p-value: 8.12E-03; Z-score: -2.23E-01

Methylation in Case

 -4.24E+00 (Median) Methylation in Control -4.10E+00 (Median)

Studied Phenotype

 Panic disorder [ ICD-11: 6B01]

Experimental Material

 Patient tissue samples

  Prostate cancer

            4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC44A2 in prostate cancer [ 14 ]

Location

 Body (cg25543755)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.28E+00 Statistic Test p-value: 8.77E-04; Z-score: 3.94E+00

Methylation in Case

 7.43E-01 (Median) Methylation in Control 5.81E-01 (Median)

Studied Phenotype

 Prostate cancer [ ICD-11: 2C82]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC44A2 in prostate cancer [ 14 ]

Location

 Body (cg18949702)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.09E+00 Statistic Test p-value: 9.32E-03; Z-score: 2.57E+00

Methylation in Case

 9.02E-01 (Median) Methylation in Control 8.26E-01 (Median)

Studied Phenotype

 Prostate cancer [ ICD-11: 2C82]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC44A2 in prostate cancer [ 14 ]

Location

 Body (cg15035421)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.39E+00 Statistic Test p-value: 1.56E-02; Z-score: -8.15E+00

Methylation in Case

 2.83E-01 (Median) Methylation in Control 3.94E-01 (Median)

Studied Phenotype

 Prostate cancer [ ICD-11: 2C82]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC44A2 in prostate cancer [ 14 ]

Location

 3'UTR (cg08094280)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.07E+00 Statistic Test p-value: 2.20E-02; Z-score: 2.40E+00

Methylation in Case

 9.19E-01 (Median) Methylation in Control 8.62E-01 (Median)

Studied Phenotype

 Prostate cancer [ ICD-11: 2C82]

Experimental Material

 Patient tissue samples

  Brain neuroepithelial tumour

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Moderate hypomethylation of SLC44A2 in brain neuroepithelial tumour than that in healthy individual

Studied Phenotype

 Brain neuroepithelial tumour [ICD-11:2A00.2Y]

The Methylation Level of Disease Section Compare with the Healthy Individual

 p-value: 4.71E-10; Fold-change: -0.259907327; Z-score: -0.985386494
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue
Download DT methylation data in the tissue of healthy individual

  Vestibular melanotic schwannoma

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Moderate hypomethylation of SLC44A2 in vestibular melanotic schwannoma than that in healthy individual

Studied Phenotype

 Vestibular melanotic schwannoma [ICD-11:2A02.3]

The Methylation Level of Disease Section Compare with the Healthy Individual

 p-value: 0.046576913; Fold-change: -0.216972363; Z-score: -1.447537479
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue adjacent to the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Download DT methylation data of patients in the disease section of the tissue
Download DT methylation data of patients in the normal section of the tissue adjacent to the disease section
Download DT methylation data in the tissue of healthy individual

microRNA

  Unclear Phenotype

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 miR-124 directly targets SLC44A2 [ 15 ]

Epigenetic Type

 microRNA Experiment Method Microarray

miRNA Stemloop ID

 miR-124 miRNA Mature ID miR-124-3p

miRNA Sequence

 UAAGGCACGCGGUGAAUGCCAA

miRNA Target Type

 Direct

Experimental Material

 Human cervical cancer cell line (Hela)
References
1 DNA Methylation Dynamics in Urological Tumors.
2 Genome-wide Scan for Methylation Profiles in Breast Cancer
3 A CpG-methylation-based assay to predict survival in clear cell renal cell carcinoma. Nat Commun. 2015 Oct 30;6:8699.
4 Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
5 HIV-1 Infection Accelerates Age According to the Epigenetic Clock. J Infect Dis. 2015 Nov 15;212(10):1563-73.
6 Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
7 Genome-wide DNA methylation analysis of systemic lupus erythematosus reveals persistent hypomethylation of interferon genes and compositional changes to CD4+ T-cell populations. PLoS Genet. 2013;9(8):e1003678.
8 Atypical Teratoid/Rhabdoid Tumors Are Comprised of Three Epigenetic Subgroups with Distinct Enhancer Landscapes. Cancer Cell. 2016 Mar 14;29(3):379-393.
9 Genome-scale analysis of DNA methylation in colorectal cancer using Infinium HumanMethylation450 BeadChips. Epigenetics. 2013 Sep;8(9):921-34.
10 DNA methylation and inflammation marker profiles associated with a history of depression. Hum Mol Genet. 2018 Aug 15;27(16):2840-2850.
11 Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
12 Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
13 DNA Methylation signatures in panic disorder. Transl Psychiatry. 2017 Dec 18;7(12):1287.
14 Reducing the risk of false discovery enabling identification of biologically significant genome-wide methylation status using the HumanMethylation450 array. BMC Genomics. 2014 Jan 22;15:51.
15 The impact of microRNAs on protein output. Nature. 2008 Sep 4;455(7209):64-71.

If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.