Detail Information of Epigenetic Regulations
| General Information of Drug Transporter (DT) | |||||
|---|---|---|---|---|---|
| DT ID | DTD0380 Transporter Info | ||||
| Gene Name | SLC4A1 | ||||
| Transporter Name | Anion exchange protein 1 | ||||
| Gene ID | |||||
| UniProt ID | |||||
| Epigenetic Regulations of This DT (EGR) | |||||
|---|---|---|---|---|---|
|
Methylation |
|||||
|
Breast cancer |
6 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC4A1 in breast cancer | [ 1 ] | |||
|
Location |
5'UTR (cg02998129) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.04E+00 | Statistic Test | p-value: 9.72E-03; Z-score: 4.35E-01 | ||
|
Methylation in Case |
7.96E-01 (Median) | Methylation in Control | 7.63E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC4A1 in breast cancer | [ 1 ] | |||
|
Location |
TSS1500 (cg04433322) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.41E+00 | Statistic Test | p-value: 1.97E-23; Z-score: -4.18E+00 | ||
|
Methylation in Case |
4.50E-01 (Median) | Methylation in Control | 6.36E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of SLC4A1 in breast cancer | [ 1 ] | |||
|
Location |
TSS1500 (cg16464328) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.15E+00 | Statistic Test | p-value: 3.28E-11; Z-score: -1.65E+00 | ||
|
Methylation in Case |
7.17E-01 (Median) | Methylation in Control | 8.22E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of SLC4A1 in breast cancer | [ 1 ] | |||
|
Location |
TSS200 (cg24607642) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.37E+00 | Statistic Test | p-value: 4.91E-15; Z-score: -3.06E+00 | ||
|
Methylation in Case |
5.10E-01 (Median) | Methylation in Control | 7.00E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of SLC4A1 in breast cancer | [ 1 ] | |||
|
Location |
TSS200 (cg23728471) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.13E+00 | Statistic Test | p-value: 3.13E-07; Z-score: -1.51E+00 | ||
|
Methylation in Case |
6.99E-01 (Median) | Methylation in Control | 7.92E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 6 |
Methylation of SLC4A1 in breast cancer | [ 1 ] | |||
|
Location |
Body (cg14381448) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.33E+00 | Statistic Test | p-value: 3.12E-13; Z-score: -2.06E+00 | ||
|
Methylation in Case |
5.41E-01 (Median) | Methylation in Control | 7.21E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Lung adenocarcinoma |
2 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC4A1 in lung adenocarcinoma | [ 2 ] | |||
|
Location |
5'UTR (cg02998129) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.13E+00 | Statistic Test | p-value: 7.59E-06; Z-score: 4.21E+00 | ||
|
Methylation in Case |
8.43E-01 (Median) | Methylation in Control | 7.48E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC4A1 in lung adenocarcinoma | [ 2 ] | |||
|
Location |
TSS1500 (cg04433322) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.16E+00 | Statistic Test | p-value: 3.06E-02; Z-score: -1.58E+00 | ||
|
Methylation in Case |
5.97E-01 (Median) | Methylation in Control | 6.94E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Pancretic ductal adenocarcinoma |
3 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC4A1 in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
5'UTR (cg21252914) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.70E+00 | Statistic Test | p-value: 1.76E-17; Z-score: 2.51E+00 | ||
|
Methylation in Case |
1.50E-01 (Median) | Methylation in Control | 8.83E-02 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC4A1 in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
Body (cg14453449) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.03E+00 | Statistic Test | p-value: 1.99E-03; Z-score: 1.06E+00 | ||
|
Methylation in Case |
8.61E-01 (Median) | Methylation in Control | 8.36E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of SLC4A1 in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
Body (cg03612649) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 2.57E-02; Z-score: -5.79E-01 | ||
|
Methylation in Case |
8.92E-01 (Median) | Methylation in Control | 8.99E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Papillary thyroid cancer |
4 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC4A1 in papillary thyroid cancer | [ 4 ] | |||
|
Location |
5'UTR (cg02998129) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.07E+00 | Statistic Test | p-value: 1.47E-10; Z-score: 1.71E+00 | ||
|
Methylation in Case |
8.42E-01 (Median) | Methylation in Control | 7.88E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC4A1 in papillary thyroid cancer | [ 4 ] | |||
|
Location |
TSS1500 (cg04433322) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.03E+00 | Statistic Test | p-value: 8.51E-03; Z-score: -5.06E-01 | ||
|
Methylation in Case |
7.38E-01 (Median) | Methylation in Control | 7.63E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of SLC4A1 in papillary thyroid cancer | [ 4 ] | |||
|
Location |
TSS200 (cg23728471) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.02E+00 | Statistic Test | p-value: 2.62E-03; Z-score: -7.30E-01 | ||
|
Methylation in Case |
8.49E-01 (Median) | Methylation in Control | 8.65E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of SLC4A1 in papillary thyroid cancer | [ 4 ] | |||
|
Location |
TSS200 (cg24607642) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 5.00E-03; Z-score: -1.70E-01 | ||
|
Methylation in Case |
7.89E-01 (Median) | Methylation in Control | 7.96E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Bladder cancer |
6 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC4A1 in bladder cancer | [ 5 ] | |||
|
Location |
TSS1500 (cg04433322) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -2.49E+00 | Statistic Test | p-value: 1.53E-13; Z-score: -1.87E+01 | ||
|
Methylation in Case |
2.10E-01 (Median) | Methylation in Control | 5.23E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC4A1 in bladder cancer | [ 5 ] | |||
|
Location |
TSS1500 (cg16464328) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.65E+00 | Statistic Test | p-value: 3.13E-10; Z-score: -1.23E+01 | ||
|
Methylation in Case |
4.10E-01 (Median) | Methylation in Control | 6.78E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of SLC4A1 in bladder cancer | [ 5 ] | |||
|
Location |
TSS200 (cg23728471) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.67E+00 | Statistic Test | p-value: 1.08E-07; Z-score: -8.65E+00 | ||
|
Methylation in Case |
3.73E-01 (Median) | Methylation in Control | 6.23E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of SLC4A1 in bladder cancer | [ 5 ] | |||
|
Location |
TSS200 (cg24607642) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -2.05E+00 | Statistic Test | p-value: 3.20E-06; Z-score: -5.37E+00 | ||
|
Methylation in Case |
2.00E-01 (Median) | Methylation in Control | 4.11E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of SLC4A1 in bladder cancer | [ 5 ] | |||
|
Location |
Body (cg14381448) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.52E+00 | Statistic Test | p-value: 7.77E-06; Z-score: -6.94E+00 | ||
|
Methylation in Case |
3.85E-01 (Median) | Methylation in Control | 5.85E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 6 |
Methylation of SLC4A1 in bladder cancer | [ 5 ] | |||
|
Location |
3'UTR (cg02892423) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.15E+00 | Statistic Test | p-value: 2.98E-05; Z-score: -7.15E+00 | ||
|
Methylation in Case |
6.59E-01 (Median) | Methylation in Control | 7.59E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Colorectal cancer |
7 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC4A1 in colorectal cancer | [ 6 ] | |||
|
Location |
TSS1500 (cg16464328) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.07E+00 | Statistic Test | p-value: 2.49E-02; Z-score: -5.35E-01 | ||
|
Methylation in Case |
6.83E-01 (Median) | Methylation in Control | 7.30E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC4A1 in colorectal cancer | [ 6 ] | |||
|
Location |
TSS1500 (cg04433322) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.10E+00 | Statistic Test | p-value: 3.37E-02; Z-score: -5.24E-01 | ||
|
Methylation in Case |
5.18E-01 (Median) | Methylation in Control | 5.71E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of SLC4A1 in colorectal cancer | [ 6 ] | |||
|
Location |
TSS200 (cg24607642) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.21E+00 | Statistic Test | p-value: 6.68E-07; Z-score: -1.96E+00 | ||
|
Methylation in Case |
5.44E-01 (Median) | Methylation in Control | 6.57E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of SLC4A1 in colorectal cancer | [ 6 ] | |||
|
Location |
TSS200 (cg23728471) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.04E+00 | Statistic Test | p-value: 1.36E-05; Z-score: -1.20E+00 | ||
|
Methylation in Case |
8.44E-01 (Median) | Methylation in Control | 8.76E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of SLC4A1 in colorectal cancer | [ 6 ] | |||
|
Location |
Body (cg14381448) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.60E+00 | Statistic Test | p-value: 1.33E-13; Z-score: -3.37E+00 | ||
|
Methylation in Case |
4.17E-01 (Median) | Methylation in Control | 6.68E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 6 |
Methylation of SLC4A1 in colorectal cancer | [ 6 ] | |||
|
Location |
3'UTR (cg02892423) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.02E+00 | Statistic Test | p-value: 3.02E-04; Z-score: -1.05E+00 | ||
|
Methylation in Case |
8.98E-01 (Median) | Methylation in Control | 9.14E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Hepatocellular carcinoma |
5 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC4A1 in hepatocellular carcinoma | [ 7 ] | |||
|
Location |
TSS1500 (cg05862393) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.25E+00 | Statistic Test | p-value: 1.89E-11; Z-score: -1.92E+00 | ||
|
Methylation in Case |
6.28E-01 (Median) | Methylation in Control | 7.85E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC4A1 in hepatocellular carcinoma | [ 7 ] | |||
|
Location |
TSS200 (cg23728471) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.07E+00 | Statistic Test | p-value: 4.56E-07; Z-score: -2.11E+00 | ||
|
Methylation in Case |
7.53E-01 (Median) | Methylation in Control | 8.06E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of SLC4A1 in hepatocellular carcinoma | [ 7 ] | |||
|
Location |
TSS200 (cg24607642) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.05E+00 | Statistic Test | p-value: 7.00E-03; Z-score: -5.01E-01 | ||
|
Methylation in Case |
6.63E-01 (Median) | Methylation in Control | 6.93E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of SLC4A1 in hepatocellular carcinoma | [ 7 ] | |||
|
Location |
Body (cg14381448) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.19E+00 | Statistic Test | p-value: 2.04E-09; Z-score: -2.13E+00 | ||
|
Methylation in Case |
5.55E-01 (Median) | Methylation in Control | 6.62E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of SLC4A1 in hepatocellular carcinoma | [ 7 ] | |||
|
Location |
3'UTR (cg02892423) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.05E+00 | Statistic Test | p-value: 9.26E-05; Z-score: -7.89E-01 | ||
|
Methylation in Case |
7.16E-01 (Median) | Methylation in Control | 7.52E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Prostate cancer |
5 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC4A1 in prostate cancer | [ 8 ] | |||
|
Location |
TSS200 (cg00868652) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.32E+00 | Statistic Test | p-value: 2.71E-03; Z-score: 3.79E+00 | ||
|
Methylation in Case |
8.24E-01 (Median) | Methylation in Control | 6.25E-01 (Median) | ||
|
Studied Phenotype |
Prostate cancer [ ICD-11: 2C82] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC4A1 in prostate cancer | [ 8 ] | |||
|
Location |
Body (cg08351607) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.05E+00 | Statistic Test | p-value: 8.78E-03; Z-score: 2.80E+00 | ||
|
Methylation in Case |
8.97E-01 (Median) | Methylation in Control | 8.56E-01 (Median) | ||
|
Studied Phenotype |
Prostate cancer [ ICD-11: 2C82] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of SLC4A1 in prostate cancer | [ 8 ] | |||
|
Location |
Body (cg27576259) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.30E+00 | Statistic Test | p-value: 1.24E-02; Z-score: -2.86E+00 | ||
|
Methylation in Case |
4.11E-01 (Median) | Methylation in Control | 5.35E-01 (Median) | ||
|
Studied Phenotype |
Prostate cancer [ ICD-11: 2C82] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of SLC4A1 in prostate cancer | [ 8 ] | |||
|
Location |
Body (cg22566355) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.17E+00 | Statistic Test | p-value: 2.02E-02; Z-score: 1.59E+00 | ||
|
Methylation in Case |
7.17E-01 (Median) | Methylation in Control | 6.10E-01 (Median) | ||
|
Studied Phenotype |
Prostate cancer [ ICD-11: 2C82] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Panic disorder |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC4A1 in panic disorder | [ 9 ] | |||
|
Location |
Body (cg14381448) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -9.22E-01 | Statistic Test | p-value: 3.59E-02; Z-score: -3.26E-01 | ||
|
Methylation in Case |
-2.27E+00 (Median) | Methylation in Control | -2.09E+00 (Median) | ||
|
Studied Phenotype |
Panic disorder [ ICD-11: 6B01] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Lymphoma |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Moderate hypomethylation of SLC4A1 in lymphoma than that in healthy individual | ||||
Studied Phenotype |
Lymphoma [ICD-11:2B30] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value: 1.60E-07; Fold-change: -0.281820038; Z-score: -2.114948546 | ||||
|
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
|
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
|
||||
|
Multilayered rosettes embryonal tumour |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Significant hypomethylation of SLC4A1 in multilayered rosettes embryonal tumour than that in healthy individual | ||||
Studied Phenotype |
Multilayered rosettes embryonal tumour [ICD-11:2A00.1] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value: 6.74E-23; Fold-change: -0.627280216; Z-score: -5.745036708 | ||||
|
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
|
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
|
||||
|
Lung cancer |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Moderate hypomethylation of SLC4A1 in lung cancer than that in other disease section | ||||
Studied Phenotype |
Lung cancer [ICD-11:2C25] | ||||
The Methylation Level of Disease Section Compare with the Other Disease Section |
p-value: .; Fold-change: .; Z-score: . | ||||
|
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
DT methylation level in tissue other than the diseased tissue of patients
|
|||||
|
microRNA |
|||||
|
Unclear Phenotype |
59 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
miR-105 directly targets SLC4A1 | [ 10 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-105 | miRNA Mature ID | miR-105-5p | ||
|
miRNA Sequence |
UCAAAUGCUCAGACUCCUGUGGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 2 |
miR-1182 directly targets SLC4A1 | [ 11 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-1182 | miRNA Mature ID | miR-1182 | ||
|
miRNA Sequence |
GAGGGUCUUGGGAGGGAUGUGAC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Left ventricular cardiac tissues of human | ||||
|
Epigenetic Phenomenon 3 |
miR-122 directly targets SLC4A1 | [ 12 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-122 | miRNA Mature ID | miR-122-5p | ||
|
miRNA Sequence |
UGGAGUGUGACAAUGGUGUUUG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon 4 |
miR-1224 directly targets SLC4A1 | [ 10 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-1224 | miRNA Mature ID | miR-1224-3p | ||
|
miRNA Sequence |
CCCCACCUCCUCUCUCCUCAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 5 |
miR-1244 directly targets SLC4A1 | [ 13 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-1244 | miRNA Mature ID | miR-1244 | ||
|
miRNA Sequence |
AAGUAGUUGGUUUGUAUGAGAUGGUU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon 6 |
miR-1267 directly targets SLC4A1 | [ 12 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-1267 | miRNA Mature ID | miR-1267 | ||
|
miRNA Sequence |
CCUGUUGAAGUGUAAUCCCCA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon 7 |
miR-129 directly targets SLC4A1 | [ 11 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-129 | miRNA Mature ID | miR-129-5p | ||
|
miRNA Sequence |
CUUUUUGCGGUCUGGGCUUGC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Left ventricular cardiac tissues of human | ||||
|
Epigenetic Phenomenon 8 |
miR-1306 directly targets SLC4A1 | [ 10 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-1306 | miRNA Mature ID | miR-1306-5p | ||
|
miRNA Sequence |
CCACCUCCCCUGCAAACGUCCA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 9 |
miR-130b directly targets SLC4A1 | [ 10 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-130b | miRNA Mature ID | miR-130b-5p | ||
|
miRNA Sequence |
ACUCUUUCCCUGUUGCACUAC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 10 |
miR-143 directly targets SLC4A1 | [ 12 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-143 | miRNA Mature ID | miR-143-5p | ||
|
miRNA Sequence |
GGUGCAGUGCUGCAUCUCUGGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon 11 |
miR-193b directly targets SLC4A1 | [ 13 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-193b | miRNA Mature ID | miR-193b-5p | ||
|
miRNA Sequence |
CGGGGUUUUGAGGGCGAGAUGA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon 12 |
miR-197 directly targets SLC4A1 | [ 13 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-197 | miRNA Mature ID | miR-197-3p | ||
|
miRNA Sequence |
UUCACCACCUUCUCCACCCAGC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon 13 |
miR-3135b directly targets SLC4A1 | [ 12 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-3135b | miRNA Mature ID | miR-3135b | ||
|
miRNA Sequence |
GGCUGGAGCGAGUGCAGUGGUG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon 14 |
miR-3183 directly targets SLC4A1 | [ 10 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-3183 | miRNA Mature ID | miR-3183 | ||
|
miRNA Sequence |
GCCUCUCUCGGAGUCGCUCGGA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 15 |
miR-3187 directly targets SLC4A1 | [ 10 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-3187 | miRNA Mature ID | miR-3187-3p | ||
|
miRNA Sequence |
UUGGCCAUGGGGCUGCGCGG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 16 |
miR-3652 directly targets SLC4A1 | [ 12 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-3652 | miRNA Mature ID | miR-3652 | ||
|
miRNA Sequence |
CGGCUGGAGGUGUGAGGA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon 17 |
miR-3663 directly targets SLC4A1 | [ 10 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-3663 | miRNA Mature ID | miR-3663-5p | ||
|
miRNA Sequence |
GCUGGUCUGCGUGGUGCUCGG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 18 |
miR-367 directly targets SLC4A1 | [ 12 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-367 | miRNA Mature ID | miR-367-5p | ||
|
miRNA Sequence |
ACUGUUGCUAAUAUGCAACUCU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon 19 |
miR-3672 directly targets SLC4A1 | [ 11 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-3672 | miRNA Mature ID | miR-3672 | ||
|
miRNA Sequence |
AUGAGACUCAUGUAAAACAUCUU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Left ventricular cardiac tissues of human | ||||
|
Epigenetic Phenomenon 20 |
miR-371a directly targets SLC4A1 | [ 10 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-371a | miRNA Mature ID | miR-371a-5p | ||
|
miRNA Sequence |
ACUCAAACUGUGGGGGCACU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 21 |
miR-371b directly targets SLC4A1 | [ 10 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-371b | miRNA Mature ID | miR-371b-5p | ||
|
miRNA Sequence |
ACUCAAAAGAUGGCGGCACUUU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 22 |
miR-372 directly targets SLC4A1 | [ 10 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-372 | miRNA Mature ID | miR-372-5p | ||
|
miRNA Sequence |
CCUCAAAUGUGGAGCACUAUUCU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 23 |
miR-373 directly targets SLC4A1 | [ 10 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-373 | miRNA Mature ID | miR-373-5p | ||
|
miRNA Sequence |
ACUCAAAAUGGGGGCGCUUUCC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 24 |
miR-378a directly targets SLC4A1 | [ 10 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-378a | miRNA Mature ID | miR-378a-5p | ||
|
miRNA Sequence |
CUCCUGACUCCAGGUCCUGUGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 25 |
miR-4423 directly targets SLC4A1 | [ 12 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4423 | miRNA Mature ID | miR-4423-5p | ||
|
miRNA Sequence |
AGUUGCCUUUUUGUUCCCAUGC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon 26 |
miR-4430 directly targets SLC4A1 | [ 12 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4430 | miRNA Mature ID | miR-4430 | ||
|
miRNA Sequence |
AGGCUGGAGUGAGCGGAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon 27 |
miR-4435 directly targets SLC4A1 | [ 10 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-4435 | miRNA Mature ID | miR-4435 | ||
|
miRNA Sequence |
AUGGCCAGAGCUCACACAGAGG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 28 |
miR-4454 directly targets SLC4A1 | [ 10 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-4454 | miRNA Mature ID | miR-4454 | ||
|
miRNA Sequence |
GGAUCCGAGUCACGGCACCA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 29 |
miR-4524a directly targets SLC4A1 | [ 11 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-4524a | miRNA Mature ID | miR-4524a-3p | ||
|
miRNA Sequence |
UGAGACAGGCUUAUGCUGCUAU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Left ventricular cardiac tissues of human | ||||
|
Epigenetic Phenomenon 30 |
miR-4524b directly targets SLC4A1 | [ 11 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-4524b | miRNA Mature ID | miR-4524b-3p | ||
|
miRNA Sequence |
GAGACAGGUUCAUGCUGCUA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Left ventricular cardiac tissues of human | ||||
|
Epigenetic Phenomenon 31 |
miR-4691 directly targets SLC4A1 | [ 10 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-4691 | miRNA Mature ID | miR-4691-3p | ||
|
miRNA Sequence |
CCAGCCACGGACUGAGAGUGCAU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 32 |
miR-4701 directly targets SLC4A1 | [ 10 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-4701 | miRNA Mature ID | miR-4701-5p | ||
|
miRNA Sequence |
UUGGCCACCACACCUACCCCUU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 33 |
miR-4716 directly targets SLC4A1 | [ 10 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-4716 | miRNA Mature ID | miR-4716-5p | ||
|
miRNA Sequence |
UCCAUGUUUCCUUCCCCCUUCU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 34 |
miR-4723 directly targets SLC4A1 | [ 10 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-4723 | miRNA Mature ID | miR-4723-3p | ||
|
miRNA Sequence |
CCCUCUCUGGCUCCUCCCCAAA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 35 |
miR-4753 directly targets SLC4A1 | [ 10 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-4753 | miRNA Mature ID | miR-4753-3p | ||
|
miRNA Sequence |
UUCUCUUUCUUUAGCCUUGUGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 36 |
miR-4755 directly targets SLC4A1 | [ 10 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-4755 | miRNA Mature ID | miR-4755-3p | ||
|
miRNA Sequence |
AGCCAGGCUCUGAAGGGAAAGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 37 |
miR-4781 directly targets SLC4A1 | [ 10 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-4781 | miRNA Mature ID | miR-4781-3p | ||
|
miRNA Sequence |
AAUGUUGGAAUCCUCGCUAGAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 38 |
miR-504 directly targets SLC4A1 | [ 12 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-504 | miRNA Mature ID | miR-504-3p | ||
|
miRNA Sequence |
GGGAGUGCAGGGCAGGGUUUC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon 39 |
miR-5193 directly targets SLC4A1 | [ 10 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-5193 | miRNA Mature ID | miR-5193 | ||
|
miRNA Sequence |
UCCUCCUCUACCUCAUCCCAGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 40 |
miR-548s directly targets SLC4A1 | [ 10 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-548s | miRNA Mature ID | miR-548s | ||
|
miRNA Sequence |
AUGGCCAAAACUGCAGUUAUUUU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 41 |
miR-5698 directly targets SLC4A1 | [ 12 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-5698 | miRNA Mature ID | miR-5698 | ||
|
miRNA Sequence |
UGGGGGAGUGCAGUGAUUGUGG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon 42 |
miR-588 directly targets SLC4A1 | [ 10 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-588 | miRNA Mature ID | miR-588 | ||
|
miRNA Sequence |
UUGGCCACAAUGGGUUAGAAC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 43 |
miR-6131 directly targets SLC4A1 | [ 10 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-6131 | miRNA Mature ID | miR-6131 | ||
|
miRNA Sequence |
GGCUGGUCAGAUGGGAGUG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 44 |
miR-616 directly targets SLC4A1 | [ 10 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-616 | miRNA Mature ID | miR-616-5p | ||
|
miRNA Sequence |
ACUCAAAACCCUUCAGUGACUU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 45 |
miR-6499 directly targets SLC4A1 | [ 12 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6499 | miRNA Mature ID | miR-6499-3p | ||
|
miRNA Sequence |
AGCAGUGUUUGUUUUGCCCACA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon 46 |
miR-6501 directly targets SLC4A1 | [ 12 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6501 | miRNA Mature ID | miR-6501-5p | ||
|
miRNA Sequence |
AGUUGCCAGGGCUGCCUUUGGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon 47 |
miR-6727 directly targets SLC4A1 | [ 10 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-6727 | miRNA Mature ID | miR-6727-3p | ||
|
miRNA Sequence |
UCCUGCCACCUCCUCCGCAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 48 |
miR-6769b directly targets SLC4A1 | [ 10 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-6769b | miRNA Mature ID | miR-6769b-3p | ||
|
miRNA Sequence |
CCCUCUCUGUCCCACCCAUAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 49 |
miR-6790 directly targets SLC4A1 | [ 10 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-6790 | miRNA Mature ID | miR-6790-3p | ||
|
miRNA Sequence |
CGACCUCGGCGACCCCUCACU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 50 |
miR-6812 directly targets SLC4A1 | [ 11 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-6812 | miRNA Mature ID | miR-6812-3p | ||
|
miRNA Sequence |
CCGCUCUUCCCCUGACCCCAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Left ventricular cardiac tissues of human | ||||
|
Epigenetic Phenomenon 51 |
miR-6821 directly targets SLC4A1 | [ 10 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-6821 | miRNA Mature ID | miR-6821-3p | ||
|
miRNA Sequence |
UGACCUCUCCGCUCCGCACAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 52 |
miR-6843 directly targets SLC4A1 | [ 10 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-6843 | miRNA Mature ID | miR-6843-3p | ||
|
miRNA Sequence |
AUGGUCUCCUGUUCUCUGCAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 53 |
miR-6848 directly targets SLC4A1 | [ 10 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-6848 | miRNA Mature ID | miR-6848-3p | ||
|
miRNA Sequence |
GUGGUCUCUUGGCCCCCAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 54 |
miR-6864 directly targets SLC4A1 | [ 11 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-6864 | miRNA Mature ID | miR-6864-3p | ||
|
miRNA Sequence |
GUGAGACUUCUCUCCCUUCAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Left ventricular cardiac tissues of human | ||||
|
Epigenetic Phenomenon 55 |
miR-7111 directly targets SLC4A1 | [ 10 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-7111 | miRNA Mature ID | miR-7111-3p | ||
|
miRNA Sequence |
AUCCUCUCUUCCCUCCUCCCAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 56 |
miR-744 directly targets SLC4A1 | [ 12 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-744 | miRNA Mature ID | miR-744-3p | ||
|
miRNA Sequence |
CUGUUGCCACUAACCUCAACCU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon 57 |
miR-7853 directly targets SLC4A1 | [ 10 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-7853 | miRNA Mature ID | miR-7853-5p | ||
|
miRNA Sequence |
UCAAAUGCAGAUCCUGACUUC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 58 |
miR-802 directly targets SLC4A1 | [ 13 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-802 | miRNA Mature ID | miR-802 | ||
|
miRNA Sequence |
CAGUAACAAAGAUUCAUCCUUGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon 59 |
miR-8055 directly targets SLC4A1 | [ 11 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-8055 | miRNA Mature ID | miR-8055 | ||
|
miRNA Sequence |
CUUUGAGCACAUGAGCAGACGGA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Left ventricular cardiac tissues of human | ||||
If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples