General Information of Drug Transporter (DT)
DT ID DTD0385 Transporter Info
Gene Name SLC4A4
Transporter Name Electrogenic sodium bicarbonate cotransporter 1
Gene ID
8671
UniProt ID
Q9Y6R1
Epigenetic Regulations of This DT (EGR)

microRNA

  Unclear Phenotype

         17 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

miR-1343 directly targets SLC4A4 [ 1 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-1343 miRNA Mature ID miR-1343-3p

miRNA Sequence

CUCCUGGGGCCCGCACUCUCGC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon 2

miR-1976 directly targets SLC4A4 [ 1 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-1976 miRNA Mature ID miR-1976

miRNA Sequence

CCUCCUGCCCUCCUUGCUGU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon 3

miR-23a directly targets SLC4A4 [ 1 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-23a miRNA Mature ID miR-23a-5p

miRNA Sequence

GGGGUUCCUGGGGAUGGGAUUU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon 4

miR-23b directly targets SLC4A4 [ 1 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-23b miRNA Mature ID miR-23b-5p

miRNA Sequence

UGGGUUCCUGGCAUGCUGAUUU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon 5

miR-4279 directly targets SLC4A4 [ 1 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-4279 miRNA Mature ID miR-4279

miRNA Sequence

CUCUCCUCCCGGCUUC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon 6

miR-4722 directly targets SLC4A4 [ 1 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-4722 miRNA Mature ID miR-4722-3p

miRNA Sequence

ACCUGCCAGCACCUCCCUGCAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon 7

miR-5585 directly targets SLC4A4 [ 1 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-5585 miRNA Mature ID miR-5585-3p

miRNA Sequence

CUGAAUAGCUGGGACUACAGGU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon 8

miR-660 directly targets SLC4A4 [ 1 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-660 miRNA Mature ID miR-660-3p

miRNA Sequence

ACCUCCUGUGUGCAUGGAUUA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon 9

miR-6727 directly targets SLC4A4 [ 1 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-6727 miRNA Mature ID miR-6727-3p

miRNA Sequence

UCCUGCCACCUCCUCCGCAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon 10

miR-6742 directly targets SLC4A4 [ 1 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-6742 miRNA Mature ID miR-6742-3p

miRNA Sequence

ACCUGGGUUGUCCCCUCUAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon 11

miR-6747 directly targets SLC4A4 [ 1 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-6747 miRNA Mature ID miR-6747-3p

miRNA Sequence

UCCUGCCUUCCUCUGCACCAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon 12

miR-6778 directly targets SLC4A4 [ 1 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-6778 miRNA Mature ID miR-6778-3p

miRNA Sequence

UGCCUCCCUGACAUUCCACAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon 13

miR-6783 directly targets SLC4A4 [ 1 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-6783 miRNA Mature ID miR-6783-3p

miRNA Sequence

UUCCUGGGCUUCUCCUCUGUAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon 14

miR-6791 directly targets SLC4A4 [ 1 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-6791 miRNA Mature ID miR-6791-3p

miRNA Sequence

UGCCUCCUUGGUCUCCGGCAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon 15

miR-6829 directly targets SLC4A4 [ 1 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-6829 miRNA Mature ID miR-6829-3p

miRNA Sequence

UGCCUCCUCCGUGGCCUCAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon 16

miR-6852 directly targets SLC4A4 [ 1 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-6852 miRNA Mature ID miR-6852-5p

miRNA Sequence

CCCUGGGGUUCUGAGGACAUG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon 17

miR-939 directly targets SLC4A4 [ 1 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-939 miRNA Mature ID miR-939-3p

miRNA Sequence

CCCUGGGCCUCUGCUCCCCAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

Methylation

  Prostate cancer

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

Moderate hypermethylation of SLC4A4 in prostate cancer than that in healthy individual

Studied Phenotype

Prostate cancer [ICD-11:2C82]

The Methylation Level of Disease Section Compare with the Healthy Individual

p-value: 0.001373042; Fold-change: 0.231993621; Z-score: 1.108828407
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples

  Peripheral neuroectodermal tumour

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

Moderate hypomethylation of SLC4A4 in peripheral neuroectodermal tumour than that in healthy individual

Studied Phenotype

Peripheral neuroectodermal tumour [ICD-11:2B52]

The Methylation Level of Disease Section Compare with the Healthy Individual

p-value: 1.25E-05; Fold-change: -0.212592195; Z-score: -4.023232949
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples

  Pituitary adenoma

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

Moderate hypomethylation of SLC4A4 in pituitary adenoma than that in healthy individual

Studied Phenotype

Pituitary adenoma [ICD-11:2F37]

The Methylation Level of Disease Section Compare with the Healthy Individual

p-value: 4.80E-08; Fold-change: -0.235753641; Z-score: -25.73495783
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples

  Spinal ependymoma

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

Moderate hypomethylation of SLC4A4 in spinal ependymoma than that in healthy individual

Studied Phenotype

Spinal ependymoma [ICD-11:2A00.0Y]

The Methylation Level of Disease Section Compare with the Healthy Individual

p-value: 6.49E-10; Fold-change: -0.276983421; Z-score: -5.414587078
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples

  Meningioma

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

Significant hypomethylation of SLC4A4 in meningioma than that in healthy individual

Studied Phenotype

Meningioma [ICD-11:2A01.0Z]

The Methylation Level of Disease Section Compare with the Healthy Individual

p-value: 1.02E-43; Fold-change: -0.380793225; Z-score: -7.411403987
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
References
1 Remodeling of Ago2-mRNA interactions upon cellular stress reflects miRNA complementarity and correlates with altered translation rates. Genes Dev. 2013 Jul 15;27(14):1624-32.

If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.