General Information of Drug Transporter (DT)
DT ID DTD0419 Transporter Info
Gene Name SLC5A10
Transporter Name Sodium/glucose cotransporter 5
Gene ID
125206
UniProt ID
A0PJK1
Epigenetic Regulations of This DT (EGR)

microRNA

  Unclear Phenotype

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

miR-335 directly targets SLC5A10 [ 1 ]

Epigenetic Type

microRNA Experiment Method Microarray

miRNA Stemloop ID

miR-335 miRNA Mature ID miR-335-5p

miRNA Sequence

UCAAGAGCAAUAACGAAAAAUGU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

Methylation

  Liver cancer

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

Moderate hypomethylation of SLC5A10 in liver cancer than that in healthy individual

Studied Phenotype

Liver cancer [ICD-11:2C12]

The Methylation Level of Disease Section Compare with the Healthy Individual

p-value: 3.95E-10; Fold-change: -0.216223054; Z-score: -4.307760433
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue adjacent to the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
DT methylation level in tissue other than the diseased tissue of patients
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples

  Ovarian cancer

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

Significant hypermethylation of SLC5A10 in ovarian cancer than that in healthy individual

Studied Phenotype

Ovarian cancer [ICD-11:2C73]

The Methylation Level of Disease Section Compare with the Healthy Individual

p-value: 0.017258745; Fold-change: 0.310770847; Z-score: 1.289637986
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples

  Uterine carcinosarcoma

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

Significant hypermethylation of SLC5A10 in uterine carcinosarcoma than that in healthy individual

Studied Phenotype

Uterine carcinosarcoma [ICD-11:2B5F]

The Methylation Level of Disease Section Compare with the Healthy Individual

p-value: 3.88E-05; Fold-change: 0.521404487; Z-score: 2.163726228
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
References
1 Endogenous human microRNAs that suppress breast cancer metastasis. Nature. 2008 Jan 10;451(7175):147-52.

If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.