Detail Information of Epigenetic Regulations
| General Information of Drug Transporter (DT) | |||||
|---|---|---|---|---|---|
| DT ID | DTD0444 Transporter Info | ||||
| Gene Name | SLC6A12 | ||||
| Transporter Name | Na(+)/Cl(-) betaine/GABA transporter | ||||
| Gene ID | |||||
| UniProt ID | |||||
| Epigenetic Regulations of This DT (EGR) | |||||
|---|---|---|---|---|---|
|
Methylation |
|||||
|
Ovarian cancer |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Hypomethylation of SLC6A12 in ovarian cancer | [ 1 ] | |||
|
Location |
Promoter | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Methylation-specific PCR | ||
|
Related Molecular Changes |
Up regulation of SLC6A12 | Experiment Method | RT-qPCR | ||
|
Studied Phenotype |
Ovarian cancer [ ICD-11: 2C73] | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Additional Notes |
SLC6A12 had decreased methylation and increased expression in ovarian cancer. | ||||
|
Bladder cancer |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC6A12 in bladder cancer | [ 2 ] | |||
|
Location |
TSS1500 (cg10508416) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.64E+00 | Statistic Test | p-value: 2.48E-09; Z-score: -6.72E+00 | ||
|
Methylation in Case |
4.25E-01 (Median) | Methylation in Control | 6.98E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Breast cancer |
2 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC6A12 in breast cancer | [ 3 ] | |||
|
Location |
TSS1500 (cg06823681) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.23E+00 | Statistic Test | p-value: 6.06E-15; Z-score: -2.96E+00 | ||
|
Methylation in Case |
6.04E-01 (Median) | Methylation in Control | 7.44E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC6A12 in breast cancer | [ 3 ] | |||
|
Location |
TSS1500 (cg10508416) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.05E+00 | Statistic Test | p-value: 5.30E-04; Z-score: -7.22E-01 | ||
|
Methylation in Case |
6.60E-01 (Median) | Methylation in Control | 6.91E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Colorectal cancer |
3 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC6A12 in colorectal cancer | [ 4 ] | |||
|
Location |
TSS1500 (cg10508416) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.12E+00 | Statistic Test | p-value: 7.52E-12; Z-score: -4.21E+00 | ||
|
Methylation in Case |
7.60E-01 (Median) | Methylation in Control | 8.52E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC6A12 in colorectal cancer | [ 4 ] | |||
|
Location |
TSS1500 (cg06823681) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.09E+00 | Statistic Test | p-value: 1.28E-06; Z-score: -1.71E+00 | ||
|
Methylation in Case |
7.78E-01 (Median) | Methylation in Control | 8.48E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
HIV infection |
2 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC6A12 in HIV infection | [ 5 ] | |||
|
Location |
TSS1500 (cg06823681) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.16E+00 | Statistic Test | p-value: 8.31E-06; Z-score: -3.05E+00 | ||
|
Methylation in Case |
6.93E-01 (Median) | Methylation in Control | 8.06E-01 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC6A12 in HIV infection | [ 5 ] | |||
|
Location |
TSS1500 (cg10508416) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.06E+00 | Statistic Test | p-value: 2.16E-04; Z-score: -1.46E+00 | ||
|
Methylation in Case |
7.72E-01 (Median) | Methylation in Control | 8.19E-01 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Lung adenocarcinoma |
2 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC6A12 in lung adenocarcinoma | [ 6 ] | |||
|
Location |
TSS1500 (cg06823681) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.18E+00 | Statistic Test | p-value: 8.66E-07; Z-score: -4.20E+00 | ||
|
Methylation in Case |
6.61E-01 (Median) | Methylation in Control | 7.82E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC6A12 in lung adenocarcinoma | [ 6 ] | |||
|
Location |
TSS1500 (cg10508416) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.10E+00 | Statistic Test | p-value: 2.30E-03; Z-score: -2.61E+00 | ||
|
Methylation in Case |
7.15E-01 (Median) | Methylation in Control | 7.88E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Pancretic ductal adenocarcinoma |
2 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC6A12 in pancretic ductal adenocarcinoma | [ 7 ] | |||
|
Location |
TSS1500 (cg02998017) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.02E+00 | Statistic Test | p-value: 1.77E-05; Z-score: -7.12E-01 | ||
|
Methylation in Case |
8.19E-01 (Median) | Methylation in Control | 8.38E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC6A12 in pancretic ductal adenocarcinoma | [ 7 ] | |||
|
Location |
TSS1500 (cg01178971) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.10E+00 | Statistic Test | p-value: 2.53E-02; Z-score: 5.91E-01 | ||
|
Methylation in Case |
5.08E-01 (Median) | Methylation in Control | 4.64E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Panic disorder |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC6A12 in panic disorder | [ 8 ] | |||
|
Location |
TSS1500 (cg06823681) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.11E+00 | Statistic Test | p-value: 2.49E-02; Z-score: 4.65E-01 | ||
|
Methylation in Case |
1.93E+00 (Median) | Methylation in Control | 1.74E+00 (Median) | ||
|
Studied Phenotype |
Panic disorder [ ICD-11: 6B01] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Hepatocellular carcinoma |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC6A12 in hepatocellular carcinoma | [ 9 ] | |||
|
Location |
Body (cg19521693) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.73E+00 | Statistic Test | p-value: 2.86E-20; Z-score: -2.60E+00 | ||
|
Methylation in Case |
1.75E-01 (Median) | Methylation in Control | 3.02E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Prostate cancer |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC6A12 in prostate cancer | [ 10 ] | |||
|
Location |
Body (cg09660365) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 2.25E+00 | Statistic Test | p-value: 8.84E-03; Z-score: 1.96E+01 | ||
|
Methylation in Case |
4.99E-01 (Median) | Methylation in Control | 2.22E-01 (Median) | ||
|
Studied Phenotype |
Prostate cancer [ ICD-11: 2C82] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
microRNA |
|||||
|
Unclear Phenotype |
2 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
miR-335 directly targets SLC6A12 | [ 11 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | Microarray | ||
|
miRNA Stemloop ID |
miR-335 | miRNA Mature ID | miR-335-5p | ||
|
miRNA Sequence |
UCAAGAGCAAUAACGAAAAAUGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 2 |
miR-342 directly targets SLC6A12 | [ 12 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | CLASH | ||
|
miRNA Stemloop ID |
miR-342 | miRNA Mature ID | miR-342-3p | ||
|
miRNA Sequence |
UCUCACACAGAAAUCGCACCCGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.