Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID DTD0453 Transporter Info
Gene Name SLC6A20
Transporter Name Sodium/imino-acid transporter 1
Gene ID
54716
UniProt ID
Q9NP91
Epigenetic Regulations of This DT (EGR)

Methylation

  Bladder cancer

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Hypermethylation of SLC6A20 in bladder cancer [ 1 ]

Location

 Promoter

Epigenetic Type

 Methylation Experiment Method Methylation-specific PCR

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Frequency

 33 (16%) out of the 212 studied tumor sample

Experimental Material

 Chinese patient tissue samples

  Mesothelioma

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Hypermethylation of SLC6A20 in mesothelioma [ 2 ]

Epigenetic Type

 Methylation Experiment Method Bisulfite sequencing

Studied Phenotype

 Mesothelioma [ ICD-11: 2C26]

Experimental Material

 Patient tissue samples

Additional Notes

 SLC6A20 methylation-associated silencing might affect resistance of cells to chemotherapy.

microRNA

  Unclear Phenotype

            7 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 miR-1228 directly targets SLC6A20 [ 3 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-1228 miRNA Mature ID miR-1228-3p

miRNA Sequence

 UCACACCUGCCUCGCCCCCC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 2

 miR-3074 directly targets SLC6A20 [ 3 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-3074 miRNA Mature ID miR-3074-5p

miRNA Sequence

 GUUCCUGCUGAACUGAGCCAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 3

 miR-6072 directly targets SLC6A20 [ 3 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6072 miRNA Mature ID miR-6072

miRNA Sequence

 UCCUCAUCACACUGCACCUUAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 4

 miR-670 directly targets SLC6A20 [ 3 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-670 miRNA Mature ID miR-670-3p

miRNA Sequence

 UUUCCUCAUAUUCAUUCAGGA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 5

 miR-6891 directly targets SLC6A20 [ 3 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6891 miRNA Mature ID miR-6891-3p

miRNA Sequence

 CCCUCAUCUUCCCCUCCUUUC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 6

 miR-7702 directly targets SLC6A20 [ 3 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-7702 miRNA Mature ID miR-7702

miRNA Sequence

 CUUAGACUGCCAGACUCCCUGA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 7

 miR-8064 directly targets SLC6A20 [ 3 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-8064 miRNA Mature ID miR-8064

miRNA Sequence

 AGCACACUGAGCGAGCGGAC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human
References
1 Methylcap-seq reveals novel DNA methylation markers for the diagnosis and recurrence prediction of bladder cancer in a Chinese population. PLoS One. 2012;7(4):e35175.
2 DNA methylation profile of 28 potential marker loci in malignant mesothelioma. Lung Cancer. 2007 Nov;58(2):220-30.
3 Remodeling of Ago2-mRNA interactions upon cellular stress reflects miRNA complementarity and correlates with altered translation rates. Genes Dev. 2013 Jul 15;27(14):1624-32.

If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.