Detail Information of Epigenetic Regulations
| General Information of Drug Transporter (DT) | |||||
|---|---|---|---|---|---|
| DT ID | DTD0458 Transporter Info | ||||
| Gene Name | SLC6A6 | ||||
| Transporter Name | Sodium- and chloride-dependent taurine transporter | ||||
| Gene ID | |||||
| UniProt ID | |||||
| Epigenetic Regulations of This DT (EGR) | |||||
|---|---|---|---|---|---|
|
microRNA |
|||||
|
Multiple system atrophy |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Higher expression of miR-124 in multiple system atrophy | [ 1 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | Luciferase reporter assay | ||
|
Related Molecular Changes |
Down regulation of SLC6A6 | Experiment Method | Immunohistochemical staining | ||
|
miRNA Stemloop ID |
miR-96 | miRNA Mature ID | Unclear | ||
|
miRNA Target Type |
Direct | ||||
|
Studied Phenotype |
Multiple system atrophy [ ICD-11: 8D87.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Additional Notes |
miR-96 downregulates SLC6A6 in multiple system atrophy, and its dysregulation may play a role in MSA. | ||||
|
Unclear Phenotype |
27 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
miR-105 directly targets SLC6A6 | [ 2 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-105 | miRNA Mature ID | miR-105-5p | ||
|
miRNA Sequence |
UCAAAUGCUCAGACUCCUGUGGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 2 |
miR-134 directly targets SLC6A6 | [ 2 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-134 | miRNA Mature ID | miR-134-5p | ||
|
miRNA Sequence |
UGUGACUGGUUGACCAGAGGGG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 3 |
miR-151a directly targets SLC6A6 | [ 2 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-151a | miRNA Mature ID | miR-151a-3p | ||
|
miRNA Sequence |
CUAGACUGAAGCUCCUUGAGG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 4 |
miR-186 directly targets SLC6A6 | [ 3 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | CLASH | ||
|
miRNA Stemloop ID |
miR-186 | miRNA Mature ID | miR-186-5p | ||
|
miRNA Sequence |
CAAAGAAUUCUCCUUUUGGGCU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon 5 |
miR-23a directly targets SLC6A6 | [ 3 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | CLASH | ||
|
miRNA Stemloop ID |
miR-23a | miRNA Mature ID | miR-23a-3p | ||
|
miRNA Sequence |
AUCACAUUGCCAGGGAUUUCC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon 6 |
miR-27b directly targets SLC6A6 | [ 2 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-27b | miRNA Mature ID | miR-27b-5p | ||
|
miRNA Sequence |
AGAGCUUAGCUGAUUGGUGAAC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 7 |
miR-3118 directly targets SLC6A6 | [ 2 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-3118 | miRNA Mature ID | miR-3118 | ||
|
miRNA Sequence |
UGUGACUGCAUUAUGAAAAUUCU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 8 |
miR-329 directly targets SLC6A6 | [ 4 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-329 | miRNA Mature ID | miR-329-3p | ||
|
miRNA Sequence |
AACACACCUGGUUAACCUCUUU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Left ventricular cardiac tissues of human | ||||
|
Epigenetic Phenomenon 9 |
miR-335 directly targets SLC6A6 | [ 5 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | Microarray | ||
|
miRNA Stemloop ID |
miR-335 | miRNA Mature ID | miR-335-5p | ||
|
miRNA Sequence |
UCAAGAGCAAUAACGAAAAAUGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 10 |
miR-362 directly targets SLC6A6 | [ 4 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-362 | miRNA Mature ID | miR-362-3p | ||
|
miRNA Sequence |
AACACACCUAUUCAAGGAUUCA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Left ventricular cardiac tissues of human | ||||
|
Epigenetic Phenomenon 11 |
miR-3671 directly targets SLC6A6 | [ 2 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-3671 | miRNA Mature ID | miR-3671 | ||
|
miRNA Sequence |
AUCAAAUAAGGACUAGUCUGCA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 12 |
miR-3941 directly targets SLC6A6 | [ 2 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-3941 | miRNA Mature ID | miR-3941 | ||
|
miRNA Sequence |
UUACACACAACUGAGGAUCAUA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 13 |
miR-423 directly targets SLC6A6 | [ 3 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | CLASH | ||
|
miRNA Stemloop ID |
miR-423 | miRNA Mature ID | miR-423-5p | ||
|
miRNA Sequence |
UGAGGGGCAGAGAGCGAGACUUU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon 14 |
miR-4453 directly targets SLC6A6 | [ 2 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-4453 | miRNA Mature ID | miR-4453 | ||
|
miRNA Sequence |
GAGCUUGGUCUGUAGCGGUU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 15 |
miR-4499 directly targets SLC6A6 | [ 2 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-4499 | miRNA Mature ID | miR-4499 | ||
|
miRNA Sequence |
AAGACUGAGAGGAGGGA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 16 |
miR-4538 directly targets SLC6A6 | [ 2 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-4538 | miRNA Mature ID | miR-4538 | ||
|
miRNA Sequence |
GAGCUUGGAUGAGCUGGGCUGA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 17 |
miR-4789 directly targets SLC6A6 | [ 4 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-4789 | miRNA Mature ID | miR-4789-3p | ||
|
miRNA Sequence |
CACACAUAGCAGGUGUAUAUA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Left ventricular cardiac tissues of human | ||||
|
Epigenetic Phenomenon 18 |
miR-5197 directly targets SLC6A6 | [ 2 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-5197 | miRNA Mature ID | miR-5197-5p | ||
|
miRNA Sequence |
CAAUGGCACAAACUCAUUCUUGA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 19 |
miR-548as directly targets SLC6A6 | [ 6 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-548as | miRNA Mature ID | miR-548as-3p | ||
|
miRNA Sequence |
UAAAACCCACAAUUAUGUUUGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon 20 |
miR-603 directly targets SLC6A6 | [ 2 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-603 | miRNA Mature ID | miR-603 | ||
|
miRNA Sequence |
CACACACUGCAAUUACUUUUGC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 21 |
miR-607 directly targets SLC6A6 | [ 2 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-607 | miRNA Mature ID | miR-607 | ||
|
miRNA Sequence |
GUUCAAAUCCAGAUCUAUAAC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 22 |
miR-6079 directly targets SLC6A6 | [ 2 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-6079 | miRNA Mature ID | miR-6079 | ||
|
miRNA Sequence |
UUGGAAGCUUGGACCAACUAGCUG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 23 |
miR-6857 directly targets SLC6A6 | [ 2 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-6857 | miRNA Mature ID | miR-6857-3p | ||
|
miRNA Sequence |
UGACUGAGCUUCUCCCCACAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 24 |
miR-7853 directly targets SLC6A6 | [ 2 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-7853 | miRNA Mature ID | miR-7853-5p | ||
|
miRNA Sequence |
UCAAAUGCAGAUCCUGACUUC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 25 |
miR-8485 directly targets SLC6A6 | [ 4 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-8485 | miRNA Mature ID | miR-8485 | ||
|
miRNA Sequence |
CACACACACACACACACGUAU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Left ventricular cardiac tissues of human | ||||
|
Epigenetic Phenomenon 26 |
miR-943 directly targets SLC6A6 | [ 2 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-943 | miRNA Mature ID | miR-943 | ||
|
miRNA Sequence |
CUGACUGUUGCCGUCCUCCAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 27 |
miR-96 directly targets SLC6A6 | [ 1 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | Immunohistochemistry//Luciferase reporter assay//qRT-PCR | ||
|
miRNA Stemloop ID |
miR-96 | miRNA Mature ID | miR-96-5p | ||
|
miRNA Sequence |
UUUGGCACUAGCACAUUUUUGCU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Methylation |
|||||
|
Atypical teratoid rhabdoid tumour |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Significant hypermethylation of SLC6A6 in atypical teratoid rhabdoid tumour than that in healthy individual | ||||
Studied Phenotype |
Atypical teratoid rhabdoid tumour [ICD-11:2A00.1Y] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value: 4.68E-13; Fold-change: 0.404310858; Z-score: 1.839153423 | ||||
|
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
|
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
|
||||
If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples