Detail Information of Epigenetic Regulations
| General Information of Drug Transporter (DT) | |||||
|---|---|---|---|---|---|
| DT ID | DTD0468 Transporter Info | ||||
| Gene Name | SLC7A2 | ||||
| Transporter Name | Cationic amino acid transporter 2 | ||||
| Gene ID | |||||
| UniProt ID | |||||
| Epigenetic Regulations of This DT (EGR) | |||||
|---|---|---|---|---|---|
|
Methylation |
|||||
|
Atypical teratoid rhabdoid tumor |
4 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC7A2 in atypical teratoid rhabdoid tumor | [ 1 ] | |||
|
Location |
5'UTR (cg03340398) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.21E+00 | Statistic Test | p-value: 1.63E-08; Z-score: -1.58E+00 | ||
|
Methylation in Case |
5.84E-01 (Median) | Methylation in Control | 7.08E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC7A2 in atypical teratoid rhabdoid tumor | [ 1 ] | |||
|
Location |
5'UTR (cg09020665) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.40E+00 | Statistic Test | p-value: 1.59E-07; Z-score: -1.31E+00 | ||
|
Methylation in Case |
4.57E-01 (Median) | Methylation in Control | 6.40E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of SLC7A2 in atypical teratoid rhabdoid tumor | [ 1 ] | |||
|
Location |
5'UTR (cg11553245) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.11E+00 | Statistic Test | p-value: 3.36E-07; Z-score: -1.08E+00 | ||
|
Methylation in Case |
7.82E-01 (Median) | Methylation in Control | 8.70E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of SLC7A2 in atypical teratoid rhabdoid tumor | [ 1 ] | |||
|
Location |
5'UTR (cg23370213) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.43E+00 | Statistic Test | p-value: 7.06E-06; Z-score: -9.08E-01 | ||
|
Methylation in Case |
1.64E-01 (Median) | Methylation in Control | 2.36E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Breast cancer |
5 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC7A2 in breast cancer | [ 2 ] | |||
|
Location |
5'UTR (cg11553245) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.11E+00 | Statistic Test | p-value: 3.14E-03; Z-score: 5.68E-01 | ||
|
Methylation in Case |
2.19E-01 (Median) | Methylation in Control | 1.98E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC7A2 in breast cancer | [ 2 ] | |||
|
Location |
5'UTR (cg03340398) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.08E+00 | Statistic Test | p-value: 1.76E-02; Z-score: 2.50E-01 | ||
|
Methylation in Case |
1.42E-01 (Median) | Methylation in Control | 1.32E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of SLC7A2 in breast cancer | [ 2 ] | |||
|
Location |
TSS1500 (cg02207200) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.23E+00 | Statistic Test | p-value: 3.22E-05; Z-score: -8.87E-01 | ||
|
Methylation in Case |
1.61E-01 (Median) | Methylation in Control | 1.98E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of SLC7A2 in breast cancer | [ 2 ] | |||
|
Location |
TSS1500 (cg24168914) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.33E+00 | Statistic Test | p-value: 4.08E-05; Z-score: 9.89E-01 | ||
|
Methylation in Case |
7.31E-02 (Median) | Methylation in Control | 5.50E-02 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of SLC7A2 in breast cancer | [ 2 ] | |||
|
Location |
TSS1500 (cg26199576) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.09E+00 | Statistic Test | p-value: 6.23E-04; Z-score: 4.30E-01 | ||
|
Methylation in Case |
1.17E-01 (Median) | Methylation in Control | 1.07E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Renal cell carcinoma |
5 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC7A2 in clear cell renal cell carcinoma | [ 3 ] | |||
|
Location |
5'UTR (cg03340398) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.10E+00 | Statistic Test | p-value: 3.36E-03; Z-score: 4.31E-01 | ||
|
Methylation in Case |
1.25E-01 (Median) | Methylation in Control | 1.13E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC7A2 in clear cell renal cell carcinoma | [ 3 ] | |||
|
Location |
5'UTR (cg23370213) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.26E+00 | Statistic Test | p-value: 6.11E-03; Z-score: 5.77E-01 | ||
|
Methylation in Case |
7.08E-02 (Median) | Methylation in Control | 5.63E-02 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of SLC7A2 in clear cell renal cell carcinoma | [ 3 ] | |||
|
Location |
TSS1500 (cg26199576) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.34E+00 | Statistic Test | p-value: 2.69E-03; Z-score: 9.79E-01 | ||
|
Methylation in Case |
6.19E-02 (Median) | Methylation in Control | 4.61E-02 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of SLC7A2 in clear cell renal cell carcinoma | [ 3 ] | |||
|
Location |
TSS1500 (cg24168914) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.56E+00 | Statistic Test | p-value: 7.81E-03; Z-score: 1.32E+00 | ||
|
Methylation in Case |
3.20E-02 (Median) | Methylation in Control | 2.05E-02 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of SLC7A2 in clear cell renal cell carcinoma | [ 3 ] | |||
|
Location |
TSS1500 (cg02207200) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -3.07E+00 | Statistic Test | p-value: 2.40E-02; Z-score: -3.02E+00 | ||
|
Methylation in Case |
1.01E-01 (Median) | Methylation in Control | 3.10E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Colorectal cancer |
5 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC7A2 in colorectal cancer | [ 4 ] | |||
|
Location |
5'UTR (cg09020665) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 2.38E+00 | Statistic Test | p-value: 3.88E-08; Z-score: 5.50E+00 | ||
|
Methylation in Case |
1.28E-01 (Median) | Methylation in Control | 5.39E-02 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC7A2 in colorectal cancer | [ 4 ] | |||
|
Location |
5'UTR (cg23370213) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.39E+00 | Statistic Test | p-value: 3.26E-07; Z-score: 1.65E+00 | ||
|
Methylation in Case |
2.91E-01 (Median) | Methylation in Control | 2.09E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of SLC7A2 in colorectal cancer | [ 4 ] | |||
|
Location |
5'UTR (cg03340398) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.02E+00 | Statistic Test | p-value: 3.30E-03; Z-score: 1.16E-01 | ||
|
Methylation in Case |
1.42E-01 (Median) | Methylation in Control | 1.39E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of SLC7A2 in colorectal cancer | [ 4 ] | |||
|
Location |
TSS1500 (cg02207200) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.30E+00 | Statistic Test | p-value: 2.76E-02; Z-score: -6.36E-01 | ||
|
Methylation in Case |
1.74E-01 (Median) | Methylation in Control | 2.27E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Hepatocellular carcinoma |
11 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC7A2 in hepatocellular carcinoma | [ 5 ] | |||
|
Location |
5'UTR (cg18827501) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.39E+00 | Statistic Test | p-value: 2.15E-15; Z-score: -3.43E+00 | ||
|
Methylation in Case |
5.50E-01 (Median) | Methylation in Control | 7.63E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC7A2 in hepatocellular carcinoma | [ 5 ] | |||
|
Location |
5'UTR (cg03340398) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.14E+00 | Statistic Test | p-value: 1.52E-03; Z-score: -4.76E-01 | ||
|
Methylation in Case |
1.14E-01 (Median) | Methylation in Control | 1.30E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of SLC7A2 in hepatocellular carcinoma | [ 5 ] | |||
|
Location |
5'UTR (cg11553245) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.13E+00 | Statistic Test | p-value: 1.93E-03; Z-score: -5.03E-01 | ||
|
Methylation in Case |
1.98E-01 (Median) | Methylation in Control | 2.24E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of SLC7A2 in hepatocellular carcinoma | [ 5 ] | |||
|
Location |
5'UTR (cg23370213) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.25E+00 | Statistic Test | p-value: 1.47E-02; Z-score: -7.64E-01 | ||
|
Methylation in Case |
9.16E-02 (Median) | Methylation in Control | 1.15E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of SLC7A2 in hepatocellular carcinoma | [ 5 ] | |||
|
Location |
TSS1500 (cg26199576) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.14E+00 | Statistic Test | p-value: 8.69E-04; Z-score: -5.20E-01 | ||
|
Methylation in Case |
9.87E-02 (Median) | Methylation in Control | 1.13E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 6 |
Methylation of SLC7A2 in hepatocellular carcinoma | [ 5 ] | |||
|
Location |
TSS1500 (cg24168914) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.29E+00 | Statistic Test | p-value: 2.74E-03; Z-score: -6.45E-01 | ||
|
Methylation in Case |
6.39E-02 (Median) | Methylation in Control | 8.27E-02 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 7 |
Methylation of SLC7A2 in hepatocellular carcinoma | [ 5 ] | |||
|
Location |
Body (cg01792749) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -2.10E+00 | Statistic Test | p-value: 3.77E-24; Z-score: -4.31E+00 | ||
|
Methylation in Case |
2.61E-01 (Median) | Methylation in Control | 5.47E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 8 |
Methylation of SLC7A2 in hepatocellular carcinoma | [ 5 ] | |||
|
Location |
Body (cg14241045) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.69E+00 | Statistic Test | p-value: 6.67E-18; Z-score: -5.15E+00 | ||
|
Methylation in Case |
3.05E-01 (Median) | Methylation in Control | 5.16E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 9 |
Methylation of SLC7A2 in hepatocellular carcinoma | [ 5 ] | |||
|
Location |
Body (cg27580375) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.40E+00 | Statistic Test | p-value: 3.66E-14; Z-score: -8.46E+00 | ||
|
Methylation in Case |
6.01E-01 (Median) | Methylation in Control | 8.41E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 10 |
Methylation of SLC7A2 in hepatocellular carcinoma | [ 5 ] | |||
|
Location |
Body (cg06345767) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.34E+00 | Statistic Test | p-value: 1.05E-13; Z-score: -5.49E+00 | ||
|
Methylation in Case |
5.24E-01 (Median) | Methylation in Control | 7.02E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 11 |
Methylation of SLC7A2 in hepatocellular carcinoma | [ 5 ] | |||
|
Location |
Body (cg00042186) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.51E+00 | Statistic Test | p-value: 1.49E-11; Z-score: 2.59E+00 | ||
|
Methylation in Case |
3.85E-01 (Median) | Methylation in Control | 2.56E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
HIV infection |
6 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC7A2 in HIV infection | [ 6 ] | |||
|
Location |
5'UTR (cg09020665) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.60E+00 | Statistic Test | p-value: 8.51E-05; Z-score: 1.45E+00 | ||
|
Methylation in Case |
9.76E-02 (Median) | Methylation in Control | 6.12E-02 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC7A2 in HIV infection | [ 6 ] | |||
|
Location |
5'UTR (cg03340398) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.18E+00 | Statistic Test | p-value: 7.81E-04; Z-score: 8.47E-01 | ||
|
Methylation in Case |
1.68E-01 (Median) | Methylation in Control | 1.43E-01 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of SLC7A2 in HIV infection | [ 6 ] | |||
|
Location |
5'UTR (cg23370213) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.21E+00 | Statistic Test | p-value: 4.70E-03; Z-score: 9.51E-01 | ||
|
Methylation in Case |
1.55E-01 (Median) | Methylation in Control | 1.29E-01 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of SLC7A2 in HIV infection | [ 6 ] | |||
|
Location |
TSS1500 (cg24168914) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.75E+00 | Statistic Test | p-value: 8.17E-05; Z-score: 1.89E+00 | ||
|
Methylation in Case |
1.45E-01 (Median) | Methylation in Control | 8.30E-02 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of SLC7A2 in HIV infection | [ 6 ] | |||
|
Location |
TSS1500 (cg02207200) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.70E+00 | Statistic Test | p-value: 8.24E-05; Z-score: 2.21E+00 | ||
|
Methylation in Case |
1.63E-01 (Median) | Methylation in Control | 9.63E-02 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 6 |
Methylation of SLC7A2 in HIV infection | [ 6 ] | |||
|
Location |
TSS1500 (cg26199576) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.41E+00 | Statistic Test | p-value: 5.02E-04; Z-score: 1.69E+00 | ||
|
Methylation in Case |
1.54E-01 (Median) | Methylation in Control | 1.09E-01 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Lung adenocarcinoma |
6 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC7A2 in lung adenocarcinoma | [ 7 ] | |||
|
Location |
5'UTR (cg23370213) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.59E+00 | Statistic Test | p-value: 1.29E-03; Z-score: 3.49E+00 | ||
|
Methylation in Case |
2.51E-01 (Median) | Methylation in Control | 1.58E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC7A2 in lung adenocarcinoma | [ 7 ] | |||
|
Location |
5'UTR (cg09020665) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.48E+00 | Statistic Test | p-value: 1.40E-02; Z-score: 2.62E+00 | ||
|
Methylation in Case |
1.30E-01 (Median) | Methylation in Control | 8.77E-02 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of SLC7A2 in lung adenocarcinoma | [ 7 ] | |||
|
Location |
5'UTR (cg03340398) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.42E+00 | Statistic Test | p-value: 1.58E-02; Z-score: 1.76E+00 | ||
|
Methylation in Case |
2.45E-01 (Median) | Methylation in Control | 1.73E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of SLC7A2 in lung adenocarcinoma | [ 7 ] | |||
|
Location |
TSS1500 (cg02207200) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.37E+00 | Statistic Test | p-value: 4.55E-03; Z-score: 3.09E+00 | ||
|
Methylation in Case |
2.04E-01 (Median) | Methylation in Control | 1.48E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of SLC7A2 in lung adenocarcinoma | [ 7 ] | |||
|
Location |
TSS1500 (cg24168914) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.39E+00 | Statistic Test | p-value: 9.46E-03; Z-score: 2.13E+00 | ||
|
Methylation in Case |
1.83E-01 (Median) | Methylation in Control | 1.32E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 6 |
Methylation of SLC7A2 in lung adenocarcinoma | [ 7 ] | |||
|
Location |
TSS1500 (cg26199576) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.33E+00 | Statistic Test | p-value: 2.97E-02; Z-score: 1.85E+00 | ||
|
Methylation in Case |
1.93E-01 (Median) | Methylation in Control | 1.45E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Pancretic ductal adenocarcinoma |
5 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC7A2 in pancretic ductal adenocarcinoma | [ 8 ] | |||
|
Location |
5'UTR (cg10028227) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.24E+00 | Statistic Test | p-value: 1.18E-07; Z-score: 7.07E-01 | ||
|
Methylation in Case |
6.99E-02 (Median) | Methylation in Control | 5.63E-02 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC7A2 in pancretic ductal adenocarcinoma | [ 8 ] | |||
|
Location |
TSS200 (cg05845376) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.38E+00 | Statistic Test | p-value: 2.53E-05; Z-score: 1.09E+00 | ||
|
Methylation in Case |
7.00E-01 (Median) | Methylation in Control | 5.07E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of SLC7A2 in pancretic ductal adenocarcinoma | [ 8 ] | |||
|
Location |
Body (cg20489026) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.03E+00 | Statistic Test | p-value: 4.21E-04; Z-score: 4.16E-02 | ||
|
Methylation in Case |
4.24E-02 (Median) | Methylation in Control | 4.13E-02 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of SLC7A2 in pancretic ductal adenocarcinoma | [ 8 ] | |||
|
Location |
Body (cg11799480) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.06E+00 | Statistic Test | p-value: 5.22E-03; Z-score: 5.98E-01 | ||
|
Methylation in Case |
5.14E-01 (Median) | Methylation in Control | 4.84E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of SLC7A2 in pancretic ductal adenocarcinoma | [ 8 ] | |||
|
Location |
3'UTR (cg05867884) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.17E+00 | Statistic Test | p-value: 5.82E-08; Z-score: 1.25E+00 | ||
|
Methylation in Case |
4.45E-01 (Median) | Methylation in Control | 3.81E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Papillary thyroid cancer |
4 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC7A2 in papillary thyroid cancer | [ 9 ] | |||
|
Location |
5'UTR (cg11553245) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.21E+00 | Statistic Test | p-value: 8.69E-07; Z-score: -7.24E-01 | ||
|
Methylation in Case |
2.24E-01 (Median) | Methylation in Control | 2.71E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC7A2 in papillary thyroid cancer | [ 9 ] | |||
|
Location |
5'UTR (cg09020665) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.13E+00 | Statistic Test | p-value: 1.61E-03; Z-score: -6.67E-01 | ||
|
Methylation in Case |
8.94E-02 (Median) | Methylation in Control | 1.01E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of SLC7A2 in papillary thyroid cancer | [ 9 ] | |||
|
Location |
5'UTR (cg23370213) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.15E+00 | Statistic Test | p-value: 2.16E-02; Z-score: -4.44E-01 | ||
|
Methylation in Case |
7.96E-02 (Median) | Methylation in Control | 9.19E-02 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of SLC7A2 in papillary thyroid cancer | [ 9 ] | |||
|
Location |
TSS1500 (cg02207200) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.85E+00 | Statistic Test | p-value: 1.17E-15; Z-score: -2.55E+00 | ||
|
Methylation in Case |
1.21E-01 (Median) | Methylation in Control | 2.24E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Systemic lupus erythematosus |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC7A2 in systemic lupus erythematosus | [ 10 ] | |||
|
Location |
5'UTR (cg11553245) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.04E+00 | Statistic Test | p-value: 1.49E-02; Z-score: -1.74E-01 | ||
|
Methylation in Case |
3.87E-01 (Median) | Methylation in Control | 4.00E-01 (Median) | ||
|
Studied Phenotype |
Systemic lupus erythematosus [ ICD-11: 4A40.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Bladder cancer |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC7A2 in bladder cancer | [ 11 ] | |||
|
Location |
TSS1500 (cg02207200) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.88E+00 | Statistic Test | p-value: 1.19E-06; Z-score: -5.87E+00 | ||
|
Methylation in Case |
6.91E-02 (Median) | Methylation in Control | 1.30E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Colon cancer |
5 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC7A2 in colon adenocarcinoma | [ 12 ] | |||
|
Location |
TSS200 (cg22907415) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.13E+00 | Statistic Test | p-value: 4.32E-04; Z-score: -3.49E+00 | ||
|
Methylation in Case |
5.47E-01 (Median) | Methylation in Control | 6.21E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC7A2 in colon adenocarcinoma | [ 12 ] | |||
|
Location |
TSS200 (cg04642741) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.26E+00 | Statistic Test | p-value: 5.47E-04; Z-score: 1.76E+00 | ||
|
Methylation in Case |
5.65E-01 (Median) | Methylation in Control | 4.50E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of SLC7A2 in colon adenocarcinoma | [ 12 ] | |||
|
Location |
TSS200 (cg16164276) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.48E+00 | Statistic Test | p-value: 1.19E-03; Z-score: 1.31E+00 | ||
|
Methylation in Case |
3.28E-01 (Median) | Methylation in Control | 2.22E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of SLC7A2 in colon adenocarcinoma | [ 12 ] | |||
|
Location |
Body (cg21591624) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.17E+00 | Statistic Test | p-value: 9.71E-04; Z-score: 1.84E+00 | ||
|
Methylation in Case |
4.36E-01 (Median) | Methylation in Control | 3.73E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of SLC7A2 in colon adenocarcinoma | [ 12 ] | |||
|
Location |
Body (cg16520288) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 2.00E+00 | Statistic Test | p-value: 3.47E-03; Z-score: 1.60E+00 | ||
|
Methylation in Case |
1.66E-01 (Median) | Methylation in Control | 8.30E-02 (Median) | ||
|
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
microRNA |
|||||
|
Unclear Phenotype |
45 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
miR-101 directly targets SLC7A2 | [ 13 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-101 | miRNA Mature ID | miR-101-3p | ||
|
miRNA Sequence |
UACAGUACUGUGAUAACUGAA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon 2 |
miR-1206 directly targets SLC7A2 | [ 14 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-1206 | miRNA Mature ID | miR-1206 | ||
|
miRNA Sequence |
UGUUCAUGUAGAUGUUUAAGC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon 3 |
miR-1238 directly targets SLC7A2 | [ 14 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-1238 | miRNA Mature ID | miR-1238-5p | ||
|
miRNA Sequence |
GUGAGUGGGAGCCCCAGUGUGUG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon 4 |
miR-124 directly targets SLC7A2 | [ 14 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-124 | miRNA Mature ID | miR-124-5p | ||
|
miRNA Sequence |
CGUGUUCACAGCGGACCUUGAU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon 5 |
miR-144 directly targets SLC7A2 | [ 14 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-144 | miRNA Mature ID | miR-144-3p | ||
|
miRNA Sequence |
UACAGUAUAGAUGAUGUACU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon 6 |
miR-188 directly targets SLC7A2 | [ 15 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-188 | miRNA Mature ID | miR-188-5p | ||
|
miRNA Sequence |
CAUCCCUUGCAUGGUGGAGGG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 7 |
miR-192 directly targets SLC7A2 | [ 16 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | Microarray | ||
|
miRNA Stemloop ID |
miR-192 | miRNA Mature ID | miR-192-5p | ||
|
miRNA Sequence |
CUGACCUAUGAAUUGACAGCC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 8 |
miR-205 directly targets SLC7A2 | [ 15 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-205 | miRNA Mature ID | miR-205-5p | ||
|
miRNA Sequence |
UCCUUCAUUCCACCGGAGUCUG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 9 |
miR-24 directly targets SLC7A2 | [ 17 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | Microarray | ||
|
miRNA Stemloop ID |
miR-24 | miRNA Mature ID | miR-24-3p | ||
|
miRNA Sequence |
UGGCUCAGUUCAGCAGGAACAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 10 |
miR-27a directly targets SLC7A2 | [ 14 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-27a | miRNA Mature ID | miR-27a-3p | ||
|
miRNA Sequence |
UUCACAGUGGCUAAGUUCCGC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon 11 |
miR-27b directly targets SLC7A2 | [ 14 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-27b | miRNA Mature ID | miR-27b-3p | ||
|
miRNA Sequence |
UUCACAGUGGCUAAGUUCUGC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon 12 |
miR-29b-2 directly targets SLC7A2 | [ 14 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-29b-2 | miRNA Mature ID | miR-29b-2-5p | ||
|
miRNA Sequence |
CUGGUUUCACAUGGUGGCUUAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon 13 |
miR-30c-2 directly targets SLC7A2 | [ 18 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | CLASH | ||
|
miRNA Stemloop ID |
miR-30c-2 | miRNA Mature ID | miR-30c-2-3p | ||
|
miRNA Sequence |
CUGGGAGAAGGCUGUUUACUCU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon 14 |
miR-3117 directly targets SLC7A2 | [ 14 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-3117 | miRNA Mature ID | miR-3117-3p | ||
|
miRNA Sequence |
AUAGGACUCAUAUAGUGCCAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon 15 |
miR-3120 directly targets SLC7A2 | [ 14 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-3120 | miRNA Mature ID | miR-3120-3p | ||
|
miRNA Sequence |
CACAGCAAGUGUAGACAGGCA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon 16 |
miR-3124 directly targets SLC7A2 | [ 15 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-3124 | miRNA Mature ID | miR-3124-3p | ||
|
miRNA Sequence |
ACUUUCCUCACUCCCGUGAAGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 17 |
miR-3659 directly targets SLC7A2 | [ 14 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-3659 | miRNA Mature ID | miR-3659 | ||
|
miRNA Sequence |
UGAGUGUUGUCUACGAGGGCA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon 18 |
miR-3680 directly targets SLC7A2 | [ 15 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-3680 | miRNA Mature ID | miR-3680-3p | ||
|
miRNA Sequence |
UUUUGCAUGACCCUGGGAGUAGG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 19 |
miR-410 directly targets SLC7A2 | [ 14 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-410 | miRNA Mature ID | miR-410-3p | ||
|
miRNA Sequence |
AAUAUAACACAGAUGGCCUGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon 20 |
miR-423 directly targets SLC7A2 | [ 18 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | CLASH | ||
|
miRNA Stemloop ID |
miR-423 | miRNA Mature ID | miR-423-5p | ||
|
miRNA Sequence |
UGAGGGGCAGAGAGCGAGACUUU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon 21 |
miR-4255 directly targets SLC7A2 | [ 14 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4255 | miRNA Mature ID | miR-4255 | ||
|
miRNA Sequence |
CAGUGUUCAGAGAUGGA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon 22 |
miR-4446 directly targets SLC7A2 | [ 15 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-4446 | miRNA Mature ID | miR-4446-5p | ||
|
miRNA Sequence |
AUUUCCCUGCCAUUCCCUUGGC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 23 |
miR-452 directly targets SLC7A2 | [ 15 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-452 | miRNA Mature ID | miR-452-3p | ||
|
miRNA Sequence |
CUCAUCUGCAAAGAAGUAAGUG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 24 |
miR-4658 directly targets SLC7A2 | [ 14 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4658 | miRNA Mature ID | miR-4658 | ||
|
miRNA Sequence |
GUGAGUGUGGAUCCUGGAGGAAU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon 25 |
miR-4666b directly targets SLC7A2 | [ 15 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-4666b | miRNA Mature ID | miR-4666b | ||
|
miRNA Sequence |
UUGCAUGUCAGAUUGUAAUUCCC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 26 |
miR-4755 directly targets SLC7A2 | [ 15 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-4755 | miRNA Mature ID | miR-4755-5p | ||
|
miRNA Sequence |
UUUCCCUUCAGAGCCUGGCUUU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 27 |
miR-4758 directly targets SLC7A2 | [ 14 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4758 | miRNA Mature ID | miR-4758-5p | ||
|
miRNA Sequence |
GUGAGUGGGAGCCGGUGGGGCUG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon 28 |
miR-499a directly targets SLC7A2 | [ 14 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-499a | miRNA Mature ID | miR-499a-3p | ||
|
miRNA Sequence |
AACAUCACAGCAAGUCUGUGCU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon 29 |
miR-5006 directly targets SLC7A2 | [ 15 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-5006 | miRNA Mature ID | miR-5006-3p | ||
|
miRNA Sequence |
UUUCCCUUUCCAUCCUGGCAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 30 |
miR-5007 directly targets SLC7A2 | [ 14 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-5007 | miRNA Mature ID | miR-5007-3p | ||
|
miRNA Sequence |
AUCAUAUGAACCAAACUCUAAU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon 31 |
miR-5011 directly targets SLC7A2 | [ 15 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-5011 | miRNA Mature ID | miR-5011-3p | ||
|
miRNA Sequence |
GUGCAUGGCUGUAUAUAUAACA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 32 |
miR-513a directly targets SLC7A2 | [ 14 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-513a | miRNA Mature ID | miR-513a-5p | ||
|
miRNA Sequence |
UUCACAGGGAGGUGUCAU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon 33 |
miR-545 directly targets SLC7A2 | [ 14 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-545 | miRNA Mature ID | miR-545-5p | ||
|
miRNA Sequence |
UCAGUAAAUGUUUAUUAGAUGA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon 34 |
miR-574 directly targets SLC7A2 | [ 14 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-574 | miRNA Mature ID | miR-574-5p | ||
|
miRNA Sequence |
UGAGUGUGUGUGUGUGAGUGUGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon 35 |
miR-582 directly targets SLC7A2 | [ 14 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-582 | miRNA Mature ID | miR-582-5p | ||
|
miRNA Sequence |
UUACAGUUGUUCAACCAGUUACU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon 36 |
miR-598 directly targets SLC7A2 | [ 14 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-598 | miRNA Mature ID | miR-598-3p | ||
|
miRNA Sequence |
UACGUCAUCGUUGUCAUCGUCA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon 37 |
miR-615 directly targets SLC7A2 | [ 18 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | CLASH | ||
|
miRNA Stemloop ID |
miR-615 | miRNA Mature ID | miR-615-3p | ||
|
miRNA Sequence |
UCCGAGCCUGGGUCUCCCUCUU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon 38 |
miR-651 directly targets SLC7A2 | [ 14 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-651 | miRNA Mature ID | miR-651-5p | ||
|
miRNA Sequence |
UUUAGGAUAAGCUUGACUUUUG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon 39 |
miR-6790 directly targets SLC7A2 | [ 14 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6790 | miRNA Mature ID | miR-6790-5p | ||
|
miRNA Sequence |
GUGAGUGUGGAUUUGGCGGGGUU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon 40 |
miR-6790 directly targets SLC7A2 | [ 14 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6790 | miRNA Mature ID | miR-6790-3p | ||
|
miRNA Sequence |
CGACCUCGGCGACCCCUCACU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon 41 |
miR-6853 directly targets SLC7A2 | [ 14 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6853 | miRNA Mature ID | miR-6853-3p | ||
|
miRNA Sequence |
UGUUCAUUGGAACCCUGCGCAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon 42 |
miR-6866 directly targets SLC7A2 | [ 15 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-6866 | miRNA Mature ID | miR-6866-3p | ||
|
miRNA Sequence |
GAUCCCUUUAUCUGUCCUCUAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 43 |
miR-7849 directly targets SLC7A2 | [ 14 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-7849 | miRNA Mature ID | miR-7849-3p | ||
|
miRNA Sequence |
GACAAUUGUUGAUCUUGGGCCU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon 44 |
miR-8081 directly targets SLC7A2 | [ 14 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-8081 | miRNA Mature ID | miR-8081 | ||
|
miRNA Sequence |
CUUGAGUCGUGCCUUUCUGAAUG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon 45 |
miR-9 directly targets SLC7A2 | [ 19 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | Microarray | ||
|
miRNA Stemloop ID |
miR-9 | miRNA Mature ID | miR-9-5p | ||
|
miRNA Sequence |
UCUUUGGUUAUCUAGCUGUAUGA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human cervical cancer cell line (Hela) | ||||
If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.