Detail Information of Epigenetic Regulations
| General Information of Drug Transporter (DT) | |||||
|---|---|---|---|---|---|
| DT ID | DTD0471 Transporter Info | ||||
| Gene Name | SLC7A5 | ||||
| Transporter Name | L-type amino acid transporter 1 | ||||
| Gene ID | |||||
| UniProt ID | |||||
| Epigenetic Regulations of This DT (EGR) | |||||
|---|---|---|---|---|---|
|
Methylation |
|||||
|
Lung cancer |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Hypermethylation of SLC7A5 in lung cancer | [ 1 ] | |||
|
Location |
Gene body | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Bisulfite sequencing | ||
|
Related Molecular Changes |
Up regulation of SLC7A5 | Experiment Method | Microarrays | ||
|
Studied Phenotype |
Lung cancer [ ICD-11: 2C25] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Additional Notes |
SLC7A5 had increased methylation and increased expression in lung cancer. | ||||
|
Hepatocellular carcinoma |
40 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC7A5 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
5'UTR (cg06578117) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.35E+00 | Statistic Test | p-value: 4.78E-11; Z-score: -2.31E+00 | ||
|
Methylation in Case |
5.07E-01 (Median) | Methylation in Control | 6.82E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC7A5 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
TSS1500 (cg04721098) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.59E+00 | Statistic Test | p-value: 5.69E-19; Z-score: -3.54E+00 | ||
|
Methylation in Case |
3.24E-01 (Median) | Methylation in Control | 5.16E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of SLC7A5 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
TSS1500 (cg21861233) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.41E+00 | Statistic Test | p-value: 4.71E-13; Z-score: -1.73E+00 | ||
|
Methylation in Case |
3.60E-01 (Median) | Methylation in Control | 5.08E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of SLC7A5 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
TSS1500 (cg00858400) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.26E+00 | Statistic Test | p-value: 8.50E-09; Z-score: -1.70E+00 | ||
|
Methylation in Case |
5.36E-01 (Median) | Methylation in Control | 6.73E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of SLC7A5 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
TSS1500 (cg02057598) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.16E+00 | Statistic Test | p-value: 8.67E-08; Z-score: -1.44E+00 | ||
|
Methylation in Case |
6.56E-01 (Median) | Methylation in Control | 7.60E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 6 |
Methylation of SLC7A5 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
TSS1500 (cg09357483) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.28E+00 | Statistic Test | p-value: 3.26E-06; Z-score: -9.95E-01 | ||
|
Methylation in Case |
5.47E-01 (Median) | Methylation in Control | 7.02E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 7 |
Methylation of SLC7A5 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
TSS1500 (cg12408911) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.04E+00 | Statistic Test | p-value: 1.11E-02; Z-score: 1.07E+00 | ||
|
Methylation in Case |
7.21E-01 (Median) | Methylation in Control | 6.94E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 8 |
Methylation of SLC7A5 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
TSS200 (cg13323701) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 4.82E+00 | Statistic Test | p-value: 4.60E-13; Z-score: 7.74E+00 | ||
|
Methylation in Case |
2.58E-01 (Median) | Methylation in Control | 5.34E-02 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 9 |
Methylation of SLC7A5 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
TSS200 (cg00728300) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.29E+00 | Statistic Test | p-value: 1.60E-07; Z-score: 1.72E+00 | ||
|
Methylation in Case |
3.96E-01 (Median) | Methylation in Control | 3.06E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 10 |
Methylation of SLC7A5 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
TSS200 (cg08710629) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.29E+00 | Statistic Test | p-value: 3.76E-07; Z-score: 1.72E+00 | ||
|
Methylation in Case |
5.80E-01 (Median) | Methylation in Control | 4.51E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 11 |
Methylation of SLC7A5 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
1stExon (cg25437385) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 3.07E+00 | Statistic Test | p-value: 1.27E-11; Z-score: 6.58E+00 | ||
|
Methylation in Case |
2.29E-01 (Median) | Methylation in Control | 7.45E-02 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 12 |
Methylation of SLC7A5 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg13788959) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.66E+00 | Statistic Test | p-value: 8.73E-24; Z-score: -8.84E+00 | ||
|
Methylation in Case |
4.65E-01 (Median) | Methylation in Control | 7.73E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 13 |
Methylation of SLC7A5 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg00157228) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.63E+00 | Statistic Test | p-value: 6.07E-20; Z-score: -4.65E+00 | ||
|
Methylation in Case |
4.65E-01 (Median) | Methylation in Control | 7.60E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 14 |
Methylation of SLC7A5 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg14772660) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.45E+00 | Statistic Test | p-value: 2.25E-18; Z-score: -4.48E+00 | ||
|
Methylation in Case |
5.25E-01 (Median) | Methylation in Control | 7.64E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 15 |
Methylation of SLC7A5 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg06708198) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.51E+00 | Statistic Test | p-value: 3.05E-16; Z-score: -9.01E+00 | ||
|
Methylation in Case |
5.29E-01 (Median) | Methylation in Control | 8.00E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 16 |
Methylation of SLC7A5 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg07358738) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.60E+00 | Statistic Test | p-value: 1.18E-15; Z-score: -3.92E+00 | ||
|
Methylation in Case |
4.97E-01 (Median) | Methylation in Control | 7.96E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 17 |
Methylation of SLC7A5 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg02400308) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.74E+00 | Statistic Test | p-value: 7.44E-14; Z-score: -3.96E+00 | ||
|
Methylation in Case |
3.83E-01 (Median) | Methylation in Control | 6.67E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 18 |
Methylation of SLC7A5 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg14225195) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.36E+00 | Statistic Test | p-value: 8.29E-11; Z-score: -1.35E+00 | ||
|
Methylation in Case |
4.14E-01 (Median) | Methylation in Control | 5.65E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 19 |
Methylation of SLC7A5 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg04804543) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.18E+00 | Statistic Test | p-value: 1.95E-10; Z-score: -3.00E+00 | ||
|
Methylation in Case |
6.64E-01 (Median) | Methylation in Control | 7.83E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 20 |
Methylation of SLC7A5 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg02057782) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.33E+00 | Statistic Test | p-value: 1.18E-09; Z-score: 2.41E+00 | ||
|
Methylation in Case |
5.17E-01 (Median) | Methylation in Control | 3.89E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 21 |
Methylation of SLC7A5 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg06665333) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.09E+00 | Statistic Test | p-value: 1.46E-06; Z-score: 7.81E-01 | ||
|
Methylation in Case |
8.46E-01 (Median) | Methylation in Control | 7.77E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 22 |
Methylation of SLC7A5 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg03879320) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.14E+00 | Statistic Test | p-value: 4.30E-06; Z-score: -1.42E+00 | ||
|
Methylation in Case |
6.43E-01 (Median) | Methylation in Control | 7.31E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 23 |
Methylation of SLC7A5 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg10169763) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.16E+00 | Statistic Test | p-value: 3.34E-04; Z-score: 8.73E-01 | ||
|
Methylation in Case |
8.72E-01 (Median) | Methylation in Control | 7.51E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 24 |
Methylation of SLC7A5 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg27555036) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.03E+00 | Statistic Test | p-value: 5.80E-04; Z-score: -7.65E-01 | ||
|
Methylation in Case |
8.40E-01 (Median) | Methylation in Control | 8.64E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 25 |
Methylation of SLC7A5 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg03801429) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.02E+00 | Statistic Test | p-value: 2.57E-03; Z-score: -8.04E-01 | ||
|
Methylation in Case |
7.78E-01 (Median) | Methylation in Control | 7.93E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 26 |
Methylation of SLC7A5 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg06867910) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.16E+00 | Statistic Test | p-value: 3.57E-03; Z-score: -4.10E-01 | ||
|
Methylation in Case |
7.70E-02 (Median) | Methylation in Control | 8.95E-02 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 27 |
Methylation of SLC7A5 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg08617020) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 4.69E-03; Z-score: -2.16E-01 | ||
|
Methylation in Case |
7.47E-01 (Median) | Methylation in Control | 7.55E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 28 |
Methylation of SLC7A5 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg03408354) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.08E+00 | Statistic Test | p-value: 5.18E-03; Z-score: 5.84E-01 | ||
|
Methylation in Case |
7.57E-01 (Median) | Methylation in Control | 6.99E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 29 |
Methylation of SLC7A5 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg03850117) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.14E+00 | Statistic Test | p-value: 5.69E-03; Z-score: -6.94E-01 | ||
|
Methylation in Case |
3.76E-01 (Median) | Methylation in Control | 4.27E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 30 |
Methylation of SLC7A5 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg26982544) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.29E+00 | Statistic Test | p-value: 6.16E-03; Z-score: -5.67E-01 | ||
|
Methylation in Case |
5.54E-02 (Median) | Methylation in Control | 7.13E-02 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 31 |
Methylation of SLC7A5 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg04802238) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.03E+00 | Statistic Test | p-value: 8.48E-03; Z-score: 4.65E-01 | ||
|
Methylation in Case |
8.28E-01 (Median) | Methylation in Control | 8.06E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 32 |
Methylation of SLC7A5 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg08401758) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.24E+00 | Statistic Test | p-value: 2.84E-02; Z-score: -3.23E-01 | ||
|
Methylation in Case |
9.70E-02 (Median) | Methylation in Control | 1.20E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 33 |
Methylation of SLC7A5 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg26907768) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.09E+00 | Statistic Test | p-value: 2.86E-02; Z-score: 6.19E-01 | ||
|
Methylation in Case |
2.93E-01 (Median) | Methylation in Control | 2.69E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 34 |
Methylation of SLC7A5 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg05393733) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.11E+00 | Statistic Test | p-value: 3.05E-02; Z-score: 6.03E-01 | ||
|
Methylation in Case |
8.51E-01 (Median) | Methylation in Control | 7.63E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 35 |
Methylation of SLC7A5 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg09285525) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.00E+00 | Statistic Test | p-value: 3.13E-02; Z-score: -1.16E-01 | ||
|
Methylation in Case |
9.37E-01 (Median) | Methylation in Control | 9.40E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 36 |
Methylation of SLC7A5 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg05911082) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.04E+00 | Statistic Test | p-value: 3.68E-02; Z-score: 2.01E-01 | ||
|
Methylation in Case |
7.67E-01 (Median) | Methylation in Control | 7.36E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 37 |
Methylation of SLC7A5 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg01829163) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.03E+00 | Statistic Test | p-value: 4.11E-02; Z-score: 2.70E-01 | ||
|
Methylation in Case |
8.32E-01 (Median) | Methylation in Control | 8.06E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 38 |
Methylation of SLC7A5 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
3'UTR (cg09618385) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.02E+00 | Statistic Test | p-value: 1.97E-04; Z-score: -5.40E-01 | ||
|
Methylation in Case |
6.99E-01 (Median) | Methylation in Control | 7.11E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 39 |
Methylation of SLC7A5 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
3'UTR (cg04481596) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 5.66E-03; Z-score: -3.53E-01 | ||
|
Methylation in Case |
8.90E-01 (Median) | Methylation in Control | 8.99E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 40 |
Methylation of SLC7A5 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
3'UTR (cg03486383) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 4.17E-02; Z-score: -2.71E-01 | ||
|
Methylation in Case |
8.89E-01 (Median) | Methylation in Control | 8.93E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Pancretic ductal adenocarcinoma |
31 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC7A5 in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
5'UTR (cg18440316) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.44E+00 | Statistic Test | p-value: 3.17E-04; Z-score: 8.14E-01 | ||
|
Methylation in Case |
2.01E-01 (Median) | Methylation in Control | 1.39E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC7A5 in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
5'UTR (cg19431980) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.34E+00 | Statistic Test | p-value: 1.32E-03; Z-score: -6.48E-01 | ||
|
Methylation in Case |
6.64E-02 (Median) | Methylation in Control | 8.93E-02 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of SLC7A5 in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
TSS1500 (cg10678459) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.18E+00 | Statistic Test | p-value: 4.75E-05; Z-score: -1.09E+00 | ||
|
Methylation in Case |
5.21E-01 (Median) | Methylation in Control | 6.14E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of SLC7A5 in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
TSS1500 (cg12572677) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.01E+00 | Statistic Test | p-value: 4.97E-03; Z-score: 5.42E-01 | ||
|
Methylation in Case |
8.73E-01 (Median) | Methylation in Control | 8.60E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of SLC7A5 in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
TSS1500 (cg04144226) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.31E+00 | Statistic Test | p-value: 2.04E-02; Z-score: -6.52E-01 | ||
|
Methylation in Case |
1.03E-01 (Median) | Methylation in Control | 1.34E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 6 |
Methylation of SLC7A5 in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
TSS1500 (cg07751266) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.06E+00 | Statistic Test | p-value: 4.10E-02; Z-score: -3.23E-01 | ||
|
Methylation in Case |
6.22E-02 (Median) | Methylation in Control | 6.56E-02 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 7 |
Methylation of SLC7A5 in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
TSS200 (cg15044957) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 3.16E+00 | Statistic Test | p-value: 1.20E-08; Z-score: 2.00E+00 | ||
|
Methylation in Case |
4.53E-01 (Median) | Methylation in Control | 1.43E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 8 |
Methylation of SLC7A5 in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
TSS200 (cg17714025) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 2.55E+00 | Statistic Test | p-value: 4.79E-06; Z-score: 1.53E+00 | ||
|
Methylation in Case |
4.12E-01 (Median) | Methylation in Control | 1.62E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 9 |
Methylation of SLC7A5 in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
TSS200 (cg18919642) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.30E+00 | Statistic Test | p-value: 1.29E-05; Z-score: -1.10E+00 | ||
|
Methylation in Case |
1.42E-01 (Median) | Methylation in Control | 1.85E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 10 |
Methylation of SLC7A5 in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
TSS200 (cg04294894) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.05E+00 | Statistic Test | p-value: 8.83E-04; Z-score: -7.30E-01 | ||
|
Methylation in Case |
7.45E-01 (Median) | Methylation in Control | 7.82E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 11 |
Methylation of SLC7A5 in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
TSS200 (cg16404371) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.06E+00 | Statistic Test | p-value: 3.49E-03; Z-score: 2.38E-01 | ||
|
Methylation in Case |
4.54E-01 (Median) | Methylation in Control | 4.27E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 12 |
Methylation of SLC7A5 in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
TSS200 (cg24598126) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.13E+00 | Statistic Test | p-value: 1.22E-02; Z-score: -5.10E-01 | ||
|
Methylation in Case |
1.15E-01 (Median) | Methylation in Control | 1.30E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 13 |
Methylation of SLC7A5 in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
Body (cg18031850) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.45E+00 | Statistic Test | p-value: 3.55E-17; Z-score: 2.85E+00 | ||
|
Methylation in Case |
4.13E-01 (Median) | Methylation in Control | 2.85E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 14 |
Methylation of SLC7A5 in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
Body (cg17156227) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.08E+00 | Statistic Test | p-value: 3.82E-13; Z-score: 2.04E+00 | ||
|
Methylation in Case |
7.93E-01 (Median) | Methylation in Control | 7.32E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 15 |
Methylation of SLC7A5 in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
Body (ch.3.1209178R) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.47E+00 | Statistic Test | p-value: 1.30E-12; Z-score: 2.11E+00 | ||
|
Methylation in Case |
8.48E-02 (Median) | Methylation in Control | 5.78E-02 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 16 |
Methylation of SLC7A5 in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
Body (cg08789022) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.79E+00 | Statistic Test | p-value: 2.41E-09; Z-score: 1.83E+00 | ||
|
Methylation in Case |
4.51E-01 (Median) | Methylation in Control | 2.52E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 17 |
Methylation of SLC7A5 in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
Body (cg13890552) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.02E+00 | Statistic Test | p-value: 1.33E-07; Z-score: -6.75E-01 | ||
|
Methylation in Case |
8.70E-01 (Median) | Methylation in Control | 8.84E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 18 |
Methylation of SLC7A5 in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
Body (cg18426477) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.14E+00 | Statistic Test | p-value: 2.57E-07; Z-score: -1.05E+00 | ||
|
Methylation in Case |
4.93E-01 (Median) | Methylation in Control | 5.61E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 19 |
Methylation of SLC7A5 in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
Body (cg26244838) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.26E+00 | Statistic Test | p-value: 1.82E-06; Z-score: 1.30E+00 | ||
|
Methylation in Case |
6.73E-01 (Median) | Methylation in Control | 5.36E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 20 |
Methylation of SLC7A5 in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
Body (cg00420510) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.15E+00 | Statistic Test | p-value: 1.93E-06; Z-score: 1.19E+00 | ||
|
Methylation in Case |
7.63E-01 (Median) | Methylation in Control | 6.62E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 21 |
Methylation of SLC7A5 in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
Body (cg07834249) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.14E+00 | Statistic Test | p-value: 3.69E-06; Z-score: 1.51E+00 | ||
|
Methylation in Case |
8.51E-01 (Median) | Methylation in Control | 7.47E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 22 |
Methylation of SLC7A5 in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
Body (cg20307184) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.06E+00 | Statistic Test | p-value: 1.17E-05; Z-score: -8.88E-01 | ||
|
Methylation in Case |
7.32E-01 (Median) | Methylation in Control | 7.78E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 23 |
Methylation of SLC7A5 in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
Body (cg01435766) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.71E+00 | Statistic Test | p-value: 3.27E-03; Z-score: -8.34E-01 | ||
|
Methylation in Case |
1.29E-01 (Median) | Methylation in Control | 2.21E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 24 |
Methylation of SLC7A5 in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
Body (cg24632865) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.05E+00 | Statistic Test | p-value: 5.72E-03; Z-score: 7.97E-01 | ||
|
Methylation in Case |
8.31E-01 (Median) | Methylation in Control | 7.93E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 25 |
Methylation of SLC7A5 in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
Body (cg19619756) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.10E+00 | Statistic Test | p-value: 7.47E-03; Z-score: 9.20E-01 | ||
|
Methylation in Case |
5.86E-01 (Median) | Methylation in Control | 5.32E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 26 |
Methylation of SLC7A5 in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
Body (cg00087735) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.02E+00 | Statistic Test | p-value: 3.33E-02; Z-score: 5.77E-01 | ||
|
Methylation in Case |
8.66E-01 (Median) | Methylation in Control | 8.45E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 27 |
Methylation of SLC7A5 in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
Body (cg25600103) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.03E+00 | Statistic Test | p-value: 3.73E-02; Z-score: 5.31E-01 | ||
|
Methylation in Case |
7.41E-01 (Median) | Methylation in Control | 7.22E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 28 |
Methylation of SLC7A5 in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
Body (cg08293408) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 4.23E-02; Z-score: -3.46E-01 | ||
|
Methylation in Case |
8.66E-01 (Median) | Methylation in Control | 8.71E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 29 |
Methylation of SLC7A5 in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
Body (cg11681428) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.17E+00 | Statistic Test | p-value: 4.56E-02; Z-score: 8.08E-01 | ||
|
Methylation in Case |
4.31E-01 (Median) | Methylation in Control | 3.69E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 30 |
Methylation of SLC7A5 in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
Body (cg22872508) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.00E+00 | Statistic Test | p-value: 4.88E-02; Z-score: 9.48E-02 | ||
|
Methylation in Case |
8.53E-01 (Median) | Methylation in Control | 8.50E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 31 |
Methylation of SLC7A5 in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
Body (cg18848012) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.02E+00 | Statistic Test | p-value: 4.98E-02; Z-score: 6.58E-01 | ||
|
Methylation in Case |
8.99E-01 (Median) | Methylation in Control | 8.78E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Bladder cancer |
27 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC7A5 in bladder cancer | [ 4 ] | |||
|
Location |
TSS1500 (cg00858400) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.69E+00 | Statistic Test | p-value: 8.52E-05; Z-score: -4.23E+00 | ||
|
Methylation in Case |
4.53E-01 (Median) | Methylation in Control | 7.65E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC7A5 in bladder cancer | [ 4 ] | |||
|
Location |
TSS1500 (cg02057598) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.29E+00 | Statistic Test | p-value: 1.36E-03; Z-score: -2.94E+00 | ||
|
Methylation in Case |
6.32E-01 (Median) | Methylation in Control | 8.12E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of SLC7A5 in bladder cancer | [ 4 ] | |||
|
Location |
TSS200 (cg00728300) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.35E+00 | Statistic Test | p-value: 2.76E-05; Z-score: -4.50E+00 | ||
|
Methylation in Case |
1.54E-01 (Median) | Methylation in Control | 2.09E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of SLC7A5 in bladder cancer | [ 4 ] | |||
|
Location |
TSS200 (cg08710629) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.81E+00 | Statistic Test | p-value: 3.20E-04; Z-score: -3.08E+00 | ||
|
Methylation in Case |
1.69E-01 (Median) | Methylation in Control | 3.07E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of SLC7A5 in bladder cancer | [ 4 ] | |||
|
Location |
1stExon (cg26695445) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.40E+00 | Statistic Test | p-value: 1.82E-02; Z-score: -1.33E+00 | ||
|
Methylation in Case |
7.75E-02 (Median) | Methylation in Control | 1.09E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 6 |
Methylation of SLC7A5 in bladder cancer | [ 4 ] | |||
|
Location |
Body (cg01829163) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.14E+00 | Statistic Test | p-value: 3.97E-06; Z-score: 5.92E+00 | ||
|
Methylation in Case |
9.25E-01 (Median) | Methylation in Control | 8.12E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 7 |
Methylation of SLC7A5 in bladder cancer | [ 4 ] | |||
|
Location |
Body (cg26569315) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.48E+00 | Statistic Test | p-value: 5.02E-06; Z-score: -1.04E+01 | ||
|
Methylation in Case |
3.98E-01 (Median) | Methylation in Control | 5.90E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 8 |
Methylation of SLC7A5 in bladder cancer | [ 4 ] | |||
|
Location |
Body (cg27560818) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.19E+00 | Statistic Test | p-value: 1.06E-05; Z-score: -5.10E+00 | ||
|
Methylation in Case |
7.21E-01 (Median) | Methylation in Control | 8.59E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 9 |
Methylation of SLC7A5 in bladder cancer | [ 4 ] | |||
|
Location |
Body (cg09285525) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.13E+00 | Statistic Test | p-value: 2.24E-05; Z-score: -4.04E+00 | ||
|
Methylation in Case |
7.75E-01 (Median) | Methylation in Control | 8.78E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 10 |
Methylation of SLC7A5 in bladder cancer | [ 4 ] | |||
|
Location |
Body (cg05911082) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.12E+00 | Statistic Test | p-value: 2.65E-04; Z-score: -3.62E+00 | ||
|
Methylation in Case |
6.56E-01 (Median) | Methylation in Control | 7.37E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 11 |
Methylation of SLC7A5 in bladder cancer | [ 4 ] | |||
|
Location |
Body (cg08860287) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.15E+00 | Statistic Test | p-value: 2.94E-04; Z-score: 3.55E+00 | ||
|
Methylation in Case |
7.25E-01 (Median) | Methylation in Control | 6.32E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 12 |
Methylation of SLC7A5 in bladder cancer | [ 4 ] | |||
|
Location |
Body (cg06372223) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.29E+00 | Statistic Test | p-value: 4.60E-04; Z-score: 2.84E+00 | ||
|
Methylation in Case |
7.25E-01 (Median) | Methylation in Control | 5.60E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 13 |
Methylation of SLC7A5 in bladder cancer | [ 4 ] | |||
|
Location |
Body (cg26529851) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.29E+00 | Statistic Test | p-value: 6.90E-04; Z-score: -7.23E+00 | ||
|
Methylation in Case |
3.66E-01 (Median) | Methylation in Control | 4.71E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 14 |
Methylation of SLC7A5 in bladder cancer | [ 4 ] | |||
|
Location |
Body (cg03553613) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.09E+00 | Statistic Test | p-value: 1.17E-03; Z-score: 2.57E+00 | ||
|
Methylation in Case |
8.56E-01 (Median) | Methylation in Control | 7.86E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 15 |
Methylation of SLC7A5 in bladder cancer | [ 4 ] | |||
|
Location |
Body (cg27555036) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.05E+00 | Statistic Test | p-value: 1.92E-03; Z-score: -3.39E+00 | ||
|
Methylation in Case |
7.87E-01 (Median) | Methylation in Control | 8.24E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 16 |
Methylation of SLC7A5 in bladder cancer | [ 4 ] | |||
|
Location |
Body (cg03879320) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.06E+00 | Statistic Test | p-value: 1.97E-03; Z-score: -1.81E+00 | ||
|
Methylation in Case |
7.34E-01 (Median) | Methylation in Control | 7.80E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 17 |
Methylation of SLC7A5 in bladder cancer | [ 4 ] | |||
|
Location |
Body (cg03850117) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.50E+00 | Statistic Test | p-value: 2.82E-03; Z-score: -2.24E+00 | ||
|
Methylation in Case |
1.86E-01 (Median) | Methylation in Control | 2.80E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 18 |
Methylation of SLC7A5 in bladder cancer | [ 4 ] | |||
|
Location |
Body (cg02614661) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.14E+00 | Statistic Test | p-value: 2.94E-03; Z-score: 2.57E+00 | ||
|
Methylation in Case |
8.97E-01 (Median) | Methylation in Control | 7.85E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 19 |
Methylation of SLC7A5 in bladder cancer | [ 4 ] | |||
|
Location |
Body (cg26637881) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.19E+00 | Statistic Test | p-value: 6.13E-03; Z-score: 2.43E+00 | ||
|
Methylation in Case |
8.11E-01 (Median) | Methylation in Control | 6.79E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 20 |
Methylation of SLC7A5 in bladder cancer | [ 4 ] | |||
|
Location |
Body (cg03408354) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.05E+00 | Statistic Test | p-value: 7.71E-03; Z-score: 1.64E+00 | ||
|
Methylation in Case |
7.97E-01 (Median) | Methylation in Control | 7.56E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 21 |
Methylation of SLC7A5 in bladder cancer | [ 4 ] | |||
|
Location |
Body (cg26907768) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.27E+00 | Statistic Test | p-value: 1.11E-02; Z-score: -1.77E+00 | ||
|
Methylation in Case |
1.46E-01 (Median) | Methylation in Control | 1.84E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 22 |
Methylation of SLC7A5 in bladder cancer | [ 4 ] | |||
|
Location |
Body (cg07021906) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.03E+00 | Statistic Test | p-value: 1.36E-02; Z-score: 3.69E+00 | ||
|
Methylation in Case |
9.60E-01 (Median) | Methylation in Control | 9.31E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 23 |
Methylation of SLC7A5 in bladder cancer | [ 4 ] | |||
|
Location |
Body (cg04171052) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.14E+00 | Statistic Test | p-value: 1.37E-02; Z-score: 2.37E+00 | ||
|
Methylation in Case |
7.34E-01 (Median) | Methylation in Control | 6.47E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 24 |
Methylation of SLC7A5 in bladder cancer | [ 4 ] | |||
|
Location |
Body (cg04802238) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.02E+00 | Statistic Test | p-value: 3.67E-02; Z-score: -1.30E+00 | ||
|
Methylation in Case |
8.18E-01 (Median) | Methylation in Control | 8.37E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 25 |
Methylation of SLC7A5 in bladder cancer | [ 4 ] | |||
|
Location |
3'UTR (cg03486383) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.02E+00 | Statistic Test | p-value: 9.23E-04; Z-score: -2.51E+00 | ||
|
Methylation in Case |
8.94E-01 (Median) | Methylation in Control | 9.09E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 26 |
Methylation of SLC7A5 in bladder cancer | [ 4 ] | |||
|
Location |
3'UTR (cg00653312) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.07E+00 | Statistic Test | p-value: 2.06E-03; Z-score: -2.75E+00 | ||
|
Methylation in Case |
8.25E-01 (Median) | Methylation in Control | 8.85E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 27 |
Methylation of SLC7A5 in bladder cancer | [ 4 ] | |||
|
Location |
3'UTR (cg06071246) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 2.08E-02; Z-score: -7.88E-01 | ||
|
Methylation in Case |
8.32E-01 (Median) | Methylation in Control | 8.43E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Breast cancer |
30 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC7A5 in breast cancer | [ 5 ] | |||
|
Location |
TSS1500 (cg02057598) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.17E+00 | Statistic Test | p-value: 1.04E-09; Z-score: 2.27E+00 | ||
|
Methylation in Case |
8.46E-01 (Median) | Methylation in Control | 7.24E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC7A5 in breast cancer | [ 5 ] | |||
|
Location |
TSS1500 (cg12408911) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.15E+00 | Statistic Test | p-value: 3.97E-09; Z-score: 2.41E+00 | ||
|
Methylation in Case |
6.33E-01 (Median) | Methylation in Control | 5.49E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of SLC7A5 in breast cancer | [ 5 ] | |||
|
Location |
TSS1500 (cg00858400) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.17E+00 | Statistic Test | p-value: 6.05E-05; Z-score: 1.57E+00 | ||
|
Methylation in Case |
7.47E-01 (Median) | Methylation in Control | 6.41E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of SLC7A5 in breast cancer | [ 5 ] | |||
|
Location |
TSS1500 (cg09357483) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.19E+00 | Statistic Test | p-value: 7.24E-03; Z-score: 5.47E-01 | ||
|
Methylation in Case |
7.70E-01 (Median) | Methylation in Control | 6.47E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of SLC7A5 in breast cancer | [ 5 ] | |||
|
Location |
1stExon (cg07067659) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.08E+00 | Statistic Test | p-value: 1.71E-02; Z-score: -1.03E-01 | ||
|
Methylation in Case |
1.78E-02 (Median) | Methylation in Control | 1.92E-02 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 6 |
Methylation of SLC7A5 in breast cancer | [ 5 ] | |||
|
Location |
1stExon (cg26695445) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.07E+00 | Statistic Test | p-value: 4.35E-02; Z-score: -1.92E-01 | ||
|
Methylation in Case |
6.79E-02 (Median) | Methylation in Control | 7.28E-02 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 7 |
Methylation of SLC7A5 in breast cancer | [ 5 ] | |||
|
Location |
Body (cg06372223) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.21E+00 | Statistic Test | p-value: 3.22E-11; Z-score: -2.36E+00 | ||
|
Methylation in Case |
5.37E-01 (Median) | Methylation in Control | 6.51E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 8 |
Methylation of SLC7A5 in breast cancer | [ 5 ] | |||
|
Location |
Body (cg03850117) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.47E+00 | Statistic Test | p-value: 9.39E-11; Z-score: -2.25E+00 | ||
|
Methylation in Case |
2.46E-01 (Median) | Methylation in Control | 3.62E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 9 |
Methylation of SLC7A5 in breast cancer | [ 5 ] | |||
|
Location |
Body (cg27555036) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.09E+00 | Statistic Test | p-value: 1.54E-09; Z-score: -1.94E+00 | ||
|
Methylation in Case |
8.18E-01 (Median) | Methylation in Control | 8.91E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 10 |
Methylation of SLC7A5 in breast cancer | [ 5 ] | |||
|
Location |
Body (cg26637881) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.18E+00 | Statistic Test | p-value: 1.73E-08; Z-score: 2.02E+00 | ||
|
Methylation in Case |
7.66E-01 (Median) | Methylation in Control | 6.50E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 11 |
Methylation of SLC7A5 in breast cancer | [ 5 ] | |||
|
Location |
Body (cg05834639) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.07E+00 | Statistic Test | p-value: 1.46E-06; Z-score: -9.50E-01 | ||
|
Methylation in Case |
6.27E-01 (Median) | Methylation in Control | 6.71E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 12 |
Methylation of SLC7A5 in breast cancer | [ 5 ] | |||
|
Location |
Body (cg26619943) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.03E+00 | Statistic Test | p-value: 1.92E-06; Z-score: -8.12E-01 | ||
|
Methylation in Case |
8.21E-01 (Median) | Methylation in Control | 8.44E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 13 |
Methylation of SLC7A5 in breast cancer | [ 5 ] | |||
|
Location |
Body (cg03879320) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.32E+00 | Statistic Test | p-value: 1.77E-05; Z-score: -1.90E+00 | ||
|
Methylation in Case |
6.00E-01 (Median) | Methylation in Control | 7.95E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 14 |
Methylation of SLC7A5 in breast cancer | [ 5 ] | |||
|
Location |
Body (cg02203067) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.07E+00 | Statistic Test | p-value: 4.49E-05; Z-score: -9.35E-01 | ||
|
Methylation in Case |
7.70E-01 (Median) | Methylation in Control | 8.21E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 15 |
Methylation of SLC7A5 in breast cancer | [ 5 ] | |||
|
Location |
Body (cg26907768) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.16E+00 | Statistic Test | p-value: 1.61E-04; Z-score: -1.12E+00 | ||
|
Methylation in Case |
1.50E-01 (Median) | Methylation in Control | 1.74E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 16 |
Methylation of SLC7A5 in breast cancer | [ 5 ] | |||
|
Location |
Body (cg01829163) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.09E+00 | Statistic Test | p-value: 1.63E-04; Z-score: 7.88E-01 | ||
|
Methylation in Case |
8.10E-01 (Median) | Methylation in Control | 7.45E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 17 |
Methylation of SLC7A5 in breast cancer | [ 5 ] | |||
|
Location |
Body (cg07558761) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.10E+00 | Statistic Test | p-value: 2.04E-04; Z-score: -1.22E+00 | ||
|
Methylation in Case |
7.63E-01 (Median) | Methylation in Control | 8.43E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 18 |
Methylation of SLC7A5 in breast cancer | [ 5 ] | |||
|
Location |
Body (cg06665333) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.07E+00 | Statistic Test | p-value: 2.37E-04; Z-score: 7.94E-01 | ||
|
Methylation in Case |
8.62E-01 (Median) | Methylation in Control | 8.03E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 19 |
Methylation of SLC7A5 in breast cancer | [ 5 ] | |||
|
Location |
Body (cg26529851) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.19E+00 | Statistic Test | p-value: 4.27E-04; Z-score: 1.67E+00 | ||
|
Methylation in Case |
5.63E-01 (Median) | Methylation in Control | 4.74E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 20 |
Methylation of SLC7A5 in breast cancer | [ 5 ] | |||
|
Location |
Body (cg02454636) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.09E+00 | Statistic Test | p-value: 8.55E-04; Z-score: -1.17E+00 | ||
|
Methylation in Case |
6.33E-01 (Median) | Methylation in Control | 6.89E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 21 |
Methylation of SLC7A5 in breast cancer | [ 5 ] | |||
|
Location |
Body (cg07021906) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.07E+00 | Statistic Test | p-value: 2.61E-03; Z-score: -8.38E-01 | ||
|
Methylation in Case |
8.84E-01 (Median) | Methylation in Control | 9.43E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 22 |
Methylation of SLC7A5 in breast cancer | [ 5 ] | |||
|
Location |
Body (cg01856752) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.03E+00 | Statistic Test | p-value: 1.35E-02; Z-score: -4.66E-01 | ||
|
Methylation in Case |
6.29E-01 (Median) | Methylation in Control | 6.51E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 23 |
Methylation of SLC7A5 in breast cancer | [ 5 ] | |||
|
Location |
Body (cg04171052) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.03E+00 | Statistic Test | p-value: 1.41E-02; Z-score: 7.43E-01 | ||
|
Methylation in Case |
7.48E-01 (Median) | Methylation in Control | 7.27E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 24 |
Methylation of SLC7A5 in breast cancer | [ 5 ] | |||
|
Location |
Body (cg05911082) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 1.87E-02; Z-score: -1.50E-01 | ||
|
Methylation in Case |
7.32E-01 (Median) | Methylation in Control | 7.39E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 25 |
Methylation of SLC7A5 in breast cancer | [ 5 ] | |||
|
Location |
Body (cg06727993) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 2.99E-02; Z-score: -2.49E-01 | ||
|
Methylation in Case |
8.48E-01 (Median) | Methylation in Control | 8.58E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 26 |
Methylation of SLC7A5 in breast cancer | [ 5 ] | |||
|
Location |
3'UTR (cg09618385) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.05E+00 | Statistic Test | p-value: 3.43E-07; Z-score: 1.06E+00 | ||
|
Methylation in Case |
7.07E-01 (Median) | Methylation in Control | 6.73E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 27 |
Methylation of SLC7A5 in breast cancer | [ 5 ] | |||
|
Location |
3'UTR (cg00653312) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.03E+00 | Statistic Test | p-value: 1.06E-05; Z-score: -9.66E-01 | ||
|
Methylation in Case |
8.82E-01 (Median) | Methylation in Control | 9.05E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 28 |
Methylation of SLC7A5 in breast cancer | [ 5 ] | |||
|
Location |
3'UTR (cg06770731) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.03E+00 | Statistic Test | p-value: 4.09E-04; Z-score: -7.64E-01 | ||
|
Methylation in Case |
9.43E-01 (Median) | Methylation in Control | 9.67E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 29 |
Methylation of SLC7A5 in breast cancer | [ 5 ] | |||
|
Location |
3'UTR (cg06071246) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.02E+00 | Statistic Test | p-value: 4.81E-03; Z-score: -4.94E-01 | ||
|
Methylation in Case |
8.44E-01 (Median) | Methylation in Control | 8.57E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 30 |
Methylation of SLC7A5 in breast cancer | [ 5 ] | |||
|
Location |
3'UTR (cg08094280) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.02E+00 | Statistic Test | p-value: 2.20E-02; Z-score: -5.10E-01 | ||
|
Methylation in Case |
8.05E-01 (Median) | Methylation in Control | 8.20E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Renal cell carcinoma |
2 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC7A5 in clear cell renal cell carcinoma | [ 6 ] | |||
|
Location |
TSS1500 (cg00858400) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.16E+00 | Statistic Test | p-value: 7.30E-04; Z-score: -1.77E+00 | ||
|
Methylation in Case |
5.74E-01 (Median) | Methylation in Control | 6.65E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC7A5 in clear cell renal cell carcinoma | [ 6 ] | |||
|
Location |
1stExon (cg07067659) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.04E+00 | Statistic Test | p-value: 3.83E-02; Z-score: 1.49E-01 | ||
|
Methylation in Case |
1.81E-02 (Median) | Methylation in Control | 1.74E-02 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Colorectal cancer |
25 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC7A5 in colorectal cancer | [ 7 ] | |||
|
Location |
TSS1500 (cg00858400) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.28E+00 | Statistic Test | p-value: 4.57E-11; Z-score: -2.33E+00 | ||
|
Methylation in Case |
6.63E-01 (Median) | Methylation in Control | 8.46E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC7A5 in colorectal cancer | [ 7 ] | |||
|
Location |
TSS1500 (cg02057598) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.16E+00 | Statistic Test | p-value: 3.00E-09; Z-score: -2.13E+00 | ||
|
Methylation in Case |
7.83E-01 (Median) | Methylation in Control | 9.06E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of SLC7A5 in colorectal cancer | [ 7 ] | |||
|
Location |
TSS1500 (cg12408911) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.03E+00 | Statistic Test | p-value: 2.24E-02; Z-score: -4.20E-01 | ||
|
Methylation in Case |
8.28E-01 (Median) | Methylation in Control | 8.51E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of SLC7A5 in colorectal cancer | [ 7 ] | |||
|
Location |
TSS1500 (cg09357483) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.44E+00 | Statistic Test | p-value: 4.26E-02; Z-score: -9.61E-01 | ||
|
Methylation in Case |
4.89E-01 (Median) | Methylation in Control | 7.02E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of SLC7A5 in colorectal cancer | [ 7 ] | |||
|
Location |
TSS200 (cg00728300) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.83E+00 | Statistic Test | p-value: 2.03E-08; Z-score: -1.80E+00 | ||
|
Methylation in Case |
1.93E-01 (Median) | Methylation in Control | 3.54E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 6 |
Methylation of SLC7A5 in colorectal cancer | [ 7 ] | |||
|
Location |
TSS200 (cg08710629) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -2.87E+00 | Statistic Test | p-value: 2.28E-06; Z-score: -1.64E+00 | ||
|
Methylation in Case |
9.50E-02 (Median) | Methylation in Control | 2.73E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 7 |
Methylation of SLC7A5 in colorectal cancer | [ 7 ] | |||
|
Location |
Body (cg03850117) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.62E+00 | Statistic Test | p-value: 5.25E-08; Z-score: -1.85E+00 | ||
|
Methylation in Case |
3.36E-01 (Median) | Methylation in Control | 5.43E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 8 |
Methylation of SLC7A5 in colorectal cancer | [ 7 ] | |||
|
Location |
Body (cg04171052) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.02E+00 | Statistic Test | p-value: 7.57E-07; Z-score: -1.01E+00 | ||
|
Methylation in Case |
8.99E-01 (Median) | Methylation in Control | 9.14E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 9 |
Methylation of SLC7A5 in colorectal cancer | [ 7 ] | |||
|
Location |
Body (cg05393733) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 2.34E-04; Z-score: -6.58E-01 | ||
|
Methylation in Case |
9.14E-01 (Median) | Methylation in Control | 9.27E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 10 |
Methylation of SLC7A5 in colorectal cancer | [ 7 ] | |||
|
Location |
Body (cg03879320) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 5.25E-04; Z-score: -4.84E-01 | ||
|
Methylation in Case |
9.03E-01 (Median) | Methylation in Control | 9.13E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 11 |
Methylation of SLC7A5 in colorectal cancer | [ 7 ] | |||
|
Location |
Body (cg05834639) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.03E+00 | Statistic Test | p-value: 2.00E-03; Z-score: -1.12E+00 | ||
|
Methylation in Case |
8.48E-01 (Median) | Methylation in Control | 8.77E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 12 |
Methylation of SLC7A5 in colorectal cancer | [ 7 ] | |||
|
Location |
Body (cg27560818) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.00E+00 | Statistic Test | p-value: 4.24E-03; Z-score: -3.62E-01 | ||
|
Methylation in Case |
9.50E-01 (Median) | Methylation in Control | 9.52E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 13 |
Methylation of SLC7A5 in colorectal cancer | [ 7 ] | |||
|
Location |
Body (cg05911082) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.02E+00 | Statistic Test | p-value: 5.20E-03; Z-score: -6.82E-01 | ||
|
Methylation in Case |
8.98E-01 (Median) | Methylation in Control | 9.14E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 14 |
Methylation of SLC7A5 in colorectal cancer | [ 7 ] | |||
|
Location |
Body (cg03553613) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.03E+00 | Statistic Test | p-value: 5.61E-03; Z-score: -7.29E-01 | ||
|
Methylation in Case |
9.06E-01 (Median) | Methylation in Control | 9.38E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 15 |
Methylation of SLC7A5 in colorectal cancer | [ 7 ] | |||
|
Location |
Body (cg06727993) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.00E+00 | Statistic Test | p-value: 8.84E-03; Z-score: -1.78E-01 | ||
|
Methylation in Case |
9.31E-01 (Median) | Methylation in Control | 9.34E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 16 |
Methylation of SLC7A5 in colorectal cancer | [ 7 ] | |||
|
Location |
Body (cg04802238) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.00E+00 | Statistic Test | p-value: 1.06E-02; Z-score: 1.12E-01 | ||
|
Methylation in Case |
9.40E-01 (Median) | Methylation in Control | 9.39E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 17 |
Methylation of SLC7A5 in colorectal cancer | [ 7 ] | |||
|
Location |
Body (cg08617020) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.05E+00 | Statistic Test | p-value: 1.08E-02; Z-score: -6.72E-01 | ||
|
Methylation in Case |
8.07E-01 (Median) | Methylation in Control | 8.49E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 18 |
Methylation of SLC7A5 in colorectal cancer | [ 7 ] | |||
|
Location |
Body (cg02203067) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 1.96E-02; Z-score: -3.61E-01 | ||
|
Methylation in Case |
8.97E-01 (Median) | Methylation in Control | 9.07E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 19 |
Methylation of SLC7A5 in colorectal cancer | [ 7 ] | |||
|
Location |
Body (cg02614661) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.00E+00 | Statistic Test | p-value: 2.20E-02; Z-score: -1.10E-01 | ||
|
Methylation in Case |
8.97E-01 (Median) | Methylation in Control | 9.00E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 20 |
Methylation of SLC7A5 in colorectal cancer | [ 7 ] | |||
|
Location |
Body (cg26907768) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.06E+00 | Statistic Test | p-value: 2.76E-02; Z-score: -3.72E-01 | ||
|
Methylation in Case |
2.22E-01 (Median) | Methylation in Control | 2.36E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 21 |
Methylation of SLC7A5 in colorectal cancer | [ 7 ] | |||
|
Location |
Body (cg03408354) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.00E+00 | Statistic Test | p-value: 5.00E-02; Z-score: -5.97E-02 | ||
|
Methylation in Case |
9.20E-01 (Median) | Methylation in Control | 9.21E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 22 |
Methylation of SLC7A5 in colorectal cancer | [ 7 ] | |||
|
Location |
3'UTR (cg00653312) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.05E+00 | Statistic Test | p-value: 1.22E-04; Z-score: -9.76E-01 | ||
|
Methylation in Case |
8.53E-01 (Median) | Methylation in Control | 8.92E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 23 |
Methylation of SLC7A5 in colorectal cancer | [ 7 ] | |||
|
Location |
3'UTR (cg09618385) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.00E+00 | Statistic Test | p-value: 5.22E-03; Z-score: -1.94E-01 | ||
|
Methylation in Case |
8.74E-01 (Median) | Methylation in Control | 8.77E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 24 |
Methylation of SLC7A5 in colorectal cancer | [ 7 ] | |||
|
Location |
3'UTR (cg27135163) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.01E+00 | Statistic Test | p-value: 7.91E-03; Z-score: 5.93E-01 | ||
|
Methylation in Case |
9.50E-01 (Median) | Methylation in Control | 9.38E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 25 |
Methylation of SLC7A5 in colorectal cancer | [ 7 ] | |||
|
Location |
3'UTR (cg08094280) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.00E+00 | Statistic Test | p-value: 1.57E-02; Z-score: -2.69E-01 | ||
|
Methylation in Case |
9.28E-01 (Median) | Methylation in Control | 9.30E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
HIV infection |
24 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC7A5 in HIV infection | [ 8 ] | |||
|
Location |
TSS1500 (cg02057598) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.18E+00 | Statistic Test | p-value: 1.40E-19; Z-score: 2.73E+00 | ||
|
Methylation in Case |
8.74E-01 (Median) | Methylation in Control | 7.43E-01 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC7A5 in HIV infection | [ 8 ] | |||
|
Location |
TSS1500 (cg00858400) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.47E+00 | Statistic Test | p-value: 1.82E-12; Z-score: 3.99E+00 | ||
|
Methylation in Case |
7.51E-01 (Median) | Methylation in Control | 5.11E-01 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of SLC7A5 in HIV infection | [ 8 ] | |||
|
Location |
TSS1500 (cg09357483) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.17E+00 | Statistic Test | p-value: 2.20E-06; Z-score: 6.78E-01 | ||
|
Methylation in Case |
9.57E-01 (Median) | Methylation in Control | 8.16E-01 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of SLC7A5 in HIV infection | [ 8 ] | |||
|
Location |
TSS1500 (cg12408911) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.07E+00 | Statistic Test | p-value: 1.32E-04; Z-score: 1.13E+00 | ||
|
Methylation in Case |
7.11E-01 (Median) | Methylation in Control | 6.66E-01 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of SLC7A5 in HIV infection | [ 8 ] | |||
|
Location |
Body (cg07021906) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.24E+00 | Statistic Test | p-value: 1.20E-18; Z-score: 3.23E+00 | ||
|
Methylation in Case |
8.52E-01 (Median) | Methylation in Control | 6.86E-01 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 6 |
Methylation of SLC7A5 in HIV infection | [ 8 ] | |||
|
Location |
Body (cg02203067) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.25E+00 | Statistic Test | p-value: 6.66E-14; Z-score: 2.68E+00 | ||
|
Methylation in Case |
7.14E-01 (Median) | Methylation in Control | 5.71E-01 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 7 |
Methylation of SLC7A5 in HIV infection | [ 8 ] | |||
|
Location |
Body (cg26569315) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.02E+00 | Statistic Test | p-value: 1.58E-13; Z-score: 1.33E+00 | ||
|
Methylation in Case |
9.89E-01 (Median) | Methylation in Control | 9.70E-01 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 8 |
Methylation of SLC7A5 in HIV infection | [ 8 ] | |||
|
Location |
Body (cg26529851) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.02E+00 | Statistic Test | p-value: 7.38E-12; Z-score: 1.06E+00 | ||
|
Methylation in Case |
8.89E-01 (Median) | Methylation in Control | 8.68E-01 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 9 |
Methylation of SLC7A5 in HIV infection | [ 8 ] | |||
|
Location |
Body (cg07558761) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.11E+00 | Statistic Test | p-value: 8.41E-11; Z-score: 1.73E+00 | ||
|
Methylation in Case |
8.03E-01 (Median) | Methylation in Control | 7.26E-01 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 10 |
Methylation of SLC7A5 in HIV infection | [ 8 ] | |||
|
Location |
Body (cg05911082) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.04E+00 | Statistic Test | p-value: 3.48E-10; Z-score: 1.29E+00 | ||
|
Methylation in Case |
8.85E-01 (Median) | Methylation in Control | 8.49E-01 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 11 |
Methylation of SLC7A5 in HIV infection | [ 8 ] | |||
|
Location |
Body (cg01829163) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.05E+00 | Statistic Test | p-value: 6.24E-06; Z-score: 9.73E-01 | ||
|
Methylation in Case |
9.15E-01 (Median) | Methylation in Control | 8.73E-01 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 12 |
Methylation of SLC7A5 in HIV infection | [ 8 ] | |||
|
Location |
Body (cg08860287) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.05E+00 | Statistic Test | p-value: 2.16E-05; Z-score: 1.16E+00 | ||
|
Methylation in Case |
7.43E-01 (Median) | Methylation in Control | 7.06E-01 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 13 |
Methylation of SLC7A5 in HIV infection | [ 8 ] | |||
|
Location |
Body (cg26637881) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.02E+00 | Statistic Test | p-value: 7.55E-05; Z-score: 1.02E+00 | ||
|
Methylation in Case |
9.20E-01 (Median) | Methylation in Control | 9.04E-01 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 14 |
Methylation of SLC7A5 in HIV infection | [ 8 ] | |||
|
Location |
Body (cg03408354) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.02E+00 | Statistic Test | p-value: 2.50E-04; Z-score: 4.00E-01 | ||
|
Methylation in Case |
8.78E-01 (Median) | Methylation in Control | 8.65E-01 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 15 |
Methylation of SLC7A5 in HIV infection | [ 8 ] | |||
|
Location |
Body (cg03850117) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.19E+00 | Statistic Test | p-value: 1.17E-03; Z-score: 1.31E+00 | ||
|
Methylation in Case |
1.80E-01 (Median) | Methylation in Control | 1.52E-01 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 16 |
Methylation of SLC7A5 in HIV infection | [ 8 ] | |||
|
Location |
Body (cg27555036) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.03E+00 | Statistic Test | p-value: 2.07E-03; Z-score: -8.35E-01 | ||
|
Methylation in Case |
8.89E-01 (Median) | Methylation in Control | 9.16E-01 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 17 |
Methylation of SLC7A5 in HIV infection | [ 8 ] | |||
|
Location |
Body (cg08401758) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.41E+00 | Statistic Test | p-value: 2.02E-02; Z-score: 7.62E-01 | ||
|
Methylation in Case |
1.71E-01 (Median) | Methylation in Control | 1.21E-01 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 18 |
Methylation of SLC7A5 in HIV infection | [ 8 ] | |||
|
Location |
Body (cg04802238) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.00E+00 | Statistic Test | p-value: 2.22E-02; Z-score: 1.51E-01 | ||
|
Methylation in Case |
8.52E-01 (Median) | Methylation in Control | 8.50E-01 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 19 |
Methylation of SLC7A5 in HIV infection | [ 8 ] | |||
|
Location |
Body (cg06727993) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.01E+00 | Statistic Test | p-value: 3.01E-02; Z-score: 5.40E-01 | ||
|
Methylation in Case |
8.59E-01 (Median) | Methylation in Control | 8.48E-01 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 20 |
Methylation of SLC7A5 in HIV infection | [ 8 ] | |||
|
Location |
Body (cg26982544) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.45E+00 | Statistic Test | p-value: 3.53E-02; Z-score: 8.21E-01 | ||
|
Methylation in Case |
1.40E-01 (Median) | Methylation in Control | 9.64E-02 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 21 |
Methylation of SLC7A5 in HIV infection | [ 8 ] | |||
|
Location |
Body (cg04171052) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.01E+00 | Statistic Test | p-value: 4.24E-02; Z-score: 4.81E-01 | ||
|
Methylation in Case |
8.48E-01 (Median) | Methylation in Control | 8.36E-01 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 22 |
Methylation of SLC7A5 in HIV infection | [ 8 ] | |||
|
Location |
3'UTR (cg00653312) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 1.83E-02; Z-score: -7.63E-01 | ||
|
Methylation in Case |
9.20E-01 (Median) | Methylation in Control | 9.34E-01 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 23 |
Methylation of SLC7A5 in HIV infection | [ 8 ] | |||
|
Location |
3'UTR (cg08094280) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.02E+00 | Statistic Test | p-value: 3.61E-02; Z-score: 6.14E-01 | ||
|
Methylation in Case |
8.47E-01 (Median) | Methylation in Control | 8.33E-01 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 24 |
Methylation of SLC7A5 in HIV infection | [ 8 ] | |||
|
Location |
3'UTR (cg06770731) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 4.25E-02; Z-score: -5.72E-01 | ||
|
Methylation in Case |
9.65E-01 (Median) | Methylation in Control | 9.73E-01 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Panic disorder |
4 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC7A5 in panic disorder | [ 9 ] | |||
|
Location |
TSS1500 (cg00858400) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -5.56E-01 | Statistic Test | p-value: 3.09E-02; Z-score: -4.22E-01 | ||
|
Methylation in Case |
-4.15E-01 (Median) | Methylation in Control | -2.31E-01 (Median) | ||
|
Studied Phenotype |
Panic disorder [ ICD-11: 6B01] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC7A5 in panic disorder | [ 9 ] | |||
|
Location |
Body (cg07021906) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.21E+00 | Statistic Test | p-value: 2.53E-03; Z-score: -4.45E-01 | ||
|
Methylation in Case |
7.24E-01 (Median) | Methylation in Control | 8.78E-01 (Median) | ||
|
Studied Phenotype |
Panic disorder [ ICD-11: 6B01] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of SLC7A5 in panic disorder | [ 9 ] | |||
|
Location |
Body (cg03879320) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.09E+00 | Statistic Test | p-value: 9.00E-03; Z-score: 5.16E-01 | ||
|
Methylation in Case |
2.02E+00 (Median) | Methylation in Control | 1.84E+00 (Median) | ||
|
Studied Phenotype |
Panic disorder [ ICD-11: 6B01] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of SLC7A5 in panic disorder | [ 9 ] | |||
|
Location |
Body (cg00069417) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.08E+00 | Statistic Test | p-value: 1.96E-02; Z-score: 4.78E-01 | ||
|
Methylation in Case |
3.05E+00 (Median) | Methylation in Control | 2.81E+00 (Median) | ||
|
Studied Phenotype |
Panic disorder [ ICD-11: 6B01] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Papillary thyroid cancer |
26 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC7A5 in papillary thyroid cancer | [ 10 ] | |||
|
Location |
TSS1500 (cg00858400) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.05E+00 | Statistic Test | p-value: 1.46E-12; Z-score: -2.26E+00 | ||
|
Methylation in Case |
8.85E-01 (Median) | Methylation in Control | 9.26E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC7A5 in papillary thyroid cancer | [ 10 ] | |||
|
Location |
TSS200 (cg08710629) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.36E+00 | Statistic Test | p-value: 2.51E-07; Z-score: 1.71E+00 | ||
|
Methylation in Case |
2.76E-01 (Median) | Methylation in Control | 2.03E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of SLC7A5 in papillary thyroid cancer | [ 10 ] | |||
|
Location |
Body (cg03850117) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.85E+00 | Statistic Test | p-value: 1.03E-21; Z-score: -3.31E+00 | ||
|
Methylation in Case |
1.75E-01 (Median) | Methylation in Control | 3.25E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of SLC7A5 in papillary thyroid cancer | [ 10 ] | |||
|
Location |
Body (cg08617020) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.14E+00 | Statistic Test | p-value: 7.70E-13; Z-score: -2.46E+00 | ||
|
Methylation in Case |
6.63E-01 (Median) | Methylation in Control | 7.57E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of SLC7A5 in papillary thyroid cancer | [ 10 ] | |||
|
Location |
Body (cg06665333) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.05E+00 | Statistic Test | p-value: 3.83E-11; Z-score: 1.41E+00 | ||
|
Methylation in Case |
8.30E-01 (Median) | Methylation in Control | 7.87E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 6 |
Methylation of SLC7A5 in papillary thyroid cancer | [ 10 ] | |||
|
Location |
Body (cg10099957) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.02E+00 | Statistic Test | p-value: 7.21E-08; Z-score: 1.11E+00 | ||
|
Methylation in Case |
9.41E-01 (Median) | Methylation in Control | 9.19E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 7 |
Methylation of SLC7A5 in papillary thyroid cancer | [ 10 ] | |||
|
Location |
Body (cg07558761) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.04E+00 | Statistic Test | p-value: 1.03E-07; Z-score: -1.32E+00 | ||
|
Methylation in Case |
8.77E-01 (Median) | Methylation in Control | 9.11E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 8 |
Methylation of SLC7A5 in papillary thyroid cancer | [ 10 ] | |||
|
Location |
Body (cg05911082) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.15E+00 | Statistic Test | p-value: 6.32E-07; Z-score: 1.35E+00 | ||
|
Methylation in Case |
6.66E-01 (Median) | Methylation in Control | 5.79E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 9 |
Methylation of SLC7A5 in papillary thyroid cancer | [ 10 ] | |||
|
Location |
Body (cg08401758) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.34E+00 | Statistic Test | p-value: 6.93E-07; Z-score: -7.40E-01 | ||
|
Methylation in Case |
7.79E-02 (Median) | Methylation in Control | 1.05E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 10 |
Methylation of SLC7A5 in papillary thyroid cancer | [ 10 ] | |||
|
Location |
Body (cg26569315) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.11E+00 | Statistic Test | p-value: 3.50E-06; Z-score: -1.39E+00 | ||
|
Methylation in Case |
5.94E-01 (Median) | Methylation in Control | 6.59E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 11 |
Methylation of SLC7A5 in papillary thyroid cancer | [ 10 ] | |||
|
Location |
Body (cg02203067) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.02E+00 | Statistic Test | p-value: 4.22E-05; Z-score: -7.72E-01 | ||
|
Methylation in Case |
9.01E-01 (Median) | Methylation in Control | 9.21E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 12 |
Methylation of SLC7A5 in papillary thyroid cancer | [ 10 ] | |||
|
Location |
Body (cg03801429) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.02E+00 | Statistic Test | p-value: 6.87E-05; Z-score: -7.39E-01 | ||
|
Methylation in Case |
8.31E-01 (Median) | Methylation in Control | 8.51E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 13 |
Methylation of SLC7A5 in papillary thyroid cancer | [ 10 ] | |||
|
Location |
Body (cg27560818) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 7.89E-05; Z-score: -7.80E-01 | ||
|
Methylation in Case |
9.47E-01 (Median) | Methylation in Control | 9.55E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 14 |
Methylation of SLC7A5 in papillary thyroid cancer | [ 10 ] | |||
|
Location |
Body (cg01829163) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.05E+00 | Statistic Test | p-value: 9.56E-05; Z-score: 1.14E+00 | ||
|
Methylation in Case |
8.15E-01 (Median) | Methylation in Control | 7.75E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 15 |
Methylation of SLC7A5 in papillary thyroid cancer | [ 10 ] | |||
|
Location |
Body (cg07021906) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.03E+00 | Statistic Test | p-value: 2.13E-04; Z-score: -8.86E-01 | ||
|
Methylation in Case |
9.20E-01 (Median) | Methylation in Control | 9.44E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 16 |
Methylation of SLC7A5 in papillary thyroid cancer | [ 10 ] | |||
|
Location |
Body (cg26619943) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 1.21E-03; Z-score: -8.41E-01 | ||
|
Methylation in Case |
9.19E-01 (Median) | Methylation in Control | 9.31E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 17 |
Methylation of SLC7A5 in papillary thyroid cancer | [ 10 ] | |||
|
Location |
Body (cg26982544) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.42E+00 | Statistic Test | p-value: 6.00E-03; Z-score: -6.47E-01 | ||
|
Methylation in Case |
4.53E-02 (Median) | Methylation in Control | 6.43E-02 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 18 |
Methylation of SLC7A5 in papillary thyroid cancer | [ 10 ] | |||
|
Location |
Body (cg06727993) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.02E+00 | Statistic Test | p-value: 1.54E-02; Z-score: -6.40E-01 | ||
|
Methylation in Case |
9.09E-01 (Median) | Methylation in Control | 9.24E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 19 |
Methylation of SLC7A5 in papillary thyroid cancer | [ 10 ] | |||
|
Location |
Body (cg05834639) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.05E+00 | Statistic Test | p-value: 1.61E-02; Z-score: 5.45E-01 | ||
|
Methylation in Case |
7.21E-01 (Median) | Methylation in Control | 6.85E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 20 |
Methylation of SLC7A5 in papillary thyroid cancer | [ 10 ] | |||
|
Location |
Body (cg04171052) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.02E+00 | Statistic Test | p-value: 2.00E-02; Z-score: -6.30E-01 | ||
|
Methylation in Case |
7.90E-01 (Median) | Methylation in Control | 8.08E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 21 |
Methylation of SLC7A5 in papillary thyroid cancer | [ 10 ] | |||
|
Location |
Body (cg03408354) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.03E+00 | Statistic Test | p-value: 2.29E-02; Z-score: 6.06E-01 | ||
|
Methylation in Case |
7.85E-01 (Median) | Methylation in Control | 7.64E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 22 |
Methylation of SLC7A5 in papillary thyroid cancer | [ 10 ] | |||
|
Location |
Body (cg03879320) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 3.31E-02; Z-score: -4.32E-01 | ||
|
Methylation in Case |
8.45E-01 (Median) | Methylation in Control | 8.57E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 23 |
Methylation of SLC7A5 in papillary thyroid cancer | [ 10 ] | |||
|
Location |
Body (cg04802238) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 3.35E-02; Z-score: -5.80E-01 | ||
|
Methylation in Case |
8.93E-01 (Median) | Methylation in Control | 9.03E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 24 |
Methylation of SLC7A5 in papillary thyroid cancer | [ 10 ] | |||
|
Location |
3'UTR (cg06770731) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.12E+00 | Statistic Test | p-value: 9.46E-04; Z-score: 1.00E+00 | ||
|
Methylation in Case |
8.42E-01 (Median) | Methylation in Control | 7.54E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 25 |
Methylation of SLC7A5 in papillary thyroid cancer | [ 10 ] | |||
|
Location |
3'UTR (cg06071246) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.16E+00 | Statistic Test | p-value: 2.38E-03; Z-score: 8.82E-01 | ||
|
Methylation in Case |
7.04E-01 (Median) | Methylation in Control | 6.05E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 26 |
Methylation of SLC7A5 in papillary thyroid cancer | [ 10 ] | |||
|
Location |
3'UTR (cg00653312) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.08E+00 | Statistic Test | p-value: 2.76E-02; Z-score: 6.51E-01 | ||
|
Methylation in Case |
6.59E-01 (Median) | Methylation in Control | 6.12E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Prostate cancer |
7 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC7A5 in prostate cancer | [ 11 ] | |||
|
Location |
TSS1500 (cg11123744) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.44E+00 | Statistic Test | p-value: 4.26E-02; Z-score: -1.57E+00 | ||
|
Methylation in Case |
2.79E-01 (Median) | Methylation in Control | 4.02E-01 (Median) | ||
|
Studied Phenotype |
Prostate cancer [ ICD-11: 2C82] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC7A5 in prostate cancer | [ 11 ] | |||
|
Location |
TSS200 (cg13438631) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.54E+00 | Statistic Test | p-value: 2.27E-02; Z-score: -1.85E+00 | ||
|
Methylation in Case |
2.01E-02 (Median) | Methylation in Control | 3.10E-02 (Median) | ||
|
Studied Phenotype |
Prostate cancer [ ICD-11: 2C82] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of SLC7A5 in prostate cancer | [ 11 ] | |||
|
Location |
Body (cg06888094) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.91E+00 | Statistic Test | p-value: 3.15E-04; Z-score: 6.54E+00 | ||
|
Methylation in Case |
4.98E-01 (Median) | Methylation in Control | 2.61E-01 (Median) | ||
|
Studied Phenotype |
Prostate cancer [ ICD-11: 2C82] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of SLC7A5 in prostate cancer | [ 11 ] | |||
|
Location |
Body (cg02606369) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.20E+00 | Statistic Test | p-value: 2.98E-02; Z-score: 6.59E+00 | ||
|
Methylation in Case |
6.05E-01 (Median) | Methylation in Control | 5.04E-01 (Median) | ||
|
Studied Phenotype |
Prostate cancer [ ICD-11: 2C82] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of SLC7A5 in prostate cancer | [ 11 ] | |||
|
Location |
Body (cg22689016) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.58E+00 | Statistic Test | p-value: 3.11E-02; Z-score: -4.61E+00 | ||
|
Methylation in Case |
3.45E-01 (Median) | Methylation in Control | 5.44E-01 (Median) | ||
|
Studied Phenotype |
Prostate cancer [ ICD-11: 2C82] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 6 |
Methylation of SLC7A5 in prostate cancer | [ 11 ] | |||
|
Location |
Body (cg14224786) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.22E+00 | Statistic Test | p-value: 3.63E-02; Z-score: 5.06E+00 | ||
|
Methylation in Case |
7.01E-01 (Median) | Methylation in Control | 5.77E-01 (Median) | ||
|
Studied Phenotype |
Prostate cancer [ ICD-11: 2C82] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 7 |
Methylation of SLC7A5 in prostate cancer | [ 11 ] | |||
|
Location |
3'UTR (cg19991086) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.05E+00 | Statistic Test | p-value: 2.02E-02; Z-score: 1.59E+00 | ||
|
Methylation in Case |
8.96E-01 (Median) | Methylation in Control | 8.52E-01 (Median) | ||
|
Studied Phenotype |
Prostate cancer [ ICD-11: 2C82] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Atypical teratoid rhabdoid tumor |
42 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC7A5 in atypical teratoid rhabdoid tumor | [ 12 ] | |||
|
Location |
1stExon (cg07067659) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.57E+00 | Statistic Test | p-value: 2.23E-21; Z-score: 3.12E+00 | ||
|
Methylation in Case |
7.62E-01 (Median) | Methylation in Control | 4.85E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC7A5 in atypical teratoid rhabdoid tumor | [ 12 ] | |||
|
Location |
1stExon (cg26695445) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.11E+00 | Statistic Test | p-value: 5.93E-16; Z-score: -3.34E+00 | ||
|
Methylation in Case |
8.24E-01 (Median) | Methylation in Control | 9.15E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of SLC7A5 in atypical teratoid rhabdoid tumor | [ 12 ] | |||
|
Location |
Body (cg00069417) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.10E+00 | Statistic Test | p-value: 1.61E-05; Z-score: -1.04E+00 | ||
|
Methylation in Case |
7.21E-01 (Median) | Methylation in Control | 7.91E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of SLC7A5 in atypical teratoid rhabdoid tumor | [ 12 ] | |||
|
Location |
Body (cg01829163) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.22E+00 | Statistic Test | p-value: 8.94E-05; Z-score: 9.16E-01 | ||
|
Methylation in Case |
7.57E-01 (Median) | Methylation in Control | 6.20E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of SLC7A5 in atypical teratoid rhabdoid tumor | [ 12 ] | |||
|
Location |
Body (cg01856752) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.06E+00 | Statistic Test | p-value: 9.06E-05; Z-score: -8.04E-01 | ||
|
Methylation in Case |
7.71E-01 (Median) | Methylation in Control | 8.19E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 6 |
Methylation of SLC7A5 in atypical teratoid rhabdoid tumor | [ 12 ] | |||
|
Location |
Body (cg02203067) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.14E+00 | Statistic Test | p-value: 1.22E-04; Z-score: 1.09E+00 | ||
|
Methylation in Case |
8.36E-01 (Median) | Methylation in Control | 7.33E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 7 |
Methylation of SLC7A5 in atypical teratoid rhabdoid tumor | [ 12 ] | |||
|
Location |
Body (cg02454636) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.05E+00 | Statistic Test | p-value: 1.63E-04; Z-score: 8.92E-01 | ||
|
Methylation in Case |
9.14E-01 (Median) | Methylation in Control | 8.68E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 8 |
Methylation of SLC7A5 in atypical teratoid rhabdoid tumor | [ 12 ] | |||
|
Location |
Body (cg02614661) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.02E+00 | Statistic Test | p-value: 1.86E-04; Z-score: -5.38E-01 | ||
|
Methylation in Case |
8.74E-01 (Median) | Methylation in Control | 8.92E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 9 |
Methylation of SLC7A5 in atypical teratoid rhabdoid tumor | [ 12 ] | |||
|
Location |
Body (cg03408354) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.09E+00 | Statistic Test | p-value: 3.26E-04; Z-score: 1.18E+00 | ||
|
Methylation in Case |
8.40E-01 (Median) | Methylation in Control | 7.69E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 10 |
Methylation of SLC7A5 in atypical teratoid rhabdoid tumor | [ 12 ] | |||
|
Location |
Body (cg03553613) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.17E+00 | Statistic Test | p-value: 3.67E-04; Z-score: 1.07E+00 | ||
|
Methylation in Case |
7.41E-01 (Median) | Methylation in Control | 6.35E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 11 |
Methylation of SLC7A5 in atypical teratoid rhabdoid tumor | [ 12 ] | |||
|
Location |
Body (cg03801429) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.06E+00 | Statistic Test | p-value: 4.33E-04; Z-score: -6.40E-01 | ||
|
Methylation in Case |
7.81E-01 (Median) | Methylation in Control | 8.32E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 12 |
Methylation of SLC7A5 in atypical teratoid rhabdoid tumor | [ 12 ] | |||
|
Location |
Body (cg03850117) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.14E+00 | Statistic Test | p-value: 4.41E-04; Z-score: -9.18E-01 | ||
|
Methylation in Case |
6.80E-01 (Median) | Methylation in Control | 7.73E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 13 |
Methylation of SLC7A5 in atypical teratoid rhabdoid tumor | [ 12 ] | |||
|
Location |
Body (cg03879320) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.14E+00 | Statistic Test | p-value: 4.52E-04; Z-score: 8.35E-01 | ||
|
Methylation in Case |
6.37E-01 (Median) | Methylation in Control | 5.58E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 14 |
Methylation of SLC7A5 in atypical teratoid rhabdoid tumor | [ 12 ] | |||
|
Location |
Body (cg04171052) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.17E+00 | Statistic Test | p-value: 5.92E-04; Z-score: 1.13E+00 | ||
|
Methylation in Case |
6.88E-01 (Median) | Methylation in Control | 5.88E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 15 |
Methylation of SLC7A5 in atypical teratoid rhabdoid tumor | [ 12 ] | |||
|
Location |
Body (cg04264781) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.33E+00 | Statistic Test | p-value: 6.57E-04; Z-score: 6.25E-01 | ||
|
Methylation in Case |
3.03E-01 (Median) | Methylation in Control | 2.27E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 16 |
Methylation of SLC7A5 in atypical teratoid rhabdoid tumor | [ 12 ] | |||
|
Location |
Body (cg04802238) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -2.29E+00 | Statistic Test | p-value: 9.54E-04; Z-score: -5.36E-01 | ||
|
Methylation in Case |
5.63E-02 (Median) | Methylation in Control | 1.29E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 17 |
Methylation of SLC7A5 in atypical teratoid rhabdoid tumor | [ 12 ] | |||
|
Location |
Body (cg04963199) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.68E+00 | Statistic Test | p-value: 1.03E-03; Z-score: -8.06E-01 | ||
|
Methylation in Case |
1.82E-01 (Median) | Methylation in Control | 3.05E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 18 |
Methylation of SLC7A5 in atypical teratoid rhabdoid tumor | [ 12 ] | |||
|
Location |
Body (cg05393733) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.08E+00 | Statistic Test | p-value: 1.42E-03; Z-score: 5.20E-01 | ||
|
Methylation in Case |
8.80E-01 (Median) | Methylation in Control | 8.13E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 19 |
Methylation of SLC7A5 in atypical teratoid rhabdoid tumor | [ 12 ] | |||
|
Location |
Body (cg05834639) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.12E+00 | Statistic Test | p-value: 1.69E-03; Z-score: -8.13E-01 | ||
|
Methylation in Case |
6.27E-01 (Median) | Methylation in Control | 7.01E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 20 |
Methylation of SLC7A5 in atypical teratoid rhabdoid tumor | [ 12 ] | |||
|
Location |
Body (cg05911082) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.02E+00 | Statistic Test | p-value: 1.81E-03; Z-score: -6.89E-01 | ||
|
Methylation in Case |
9.03E-01 (Median) | Methylation in Control | 9.19E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 21 |
Methylation of SLC7A5 in atypical teratoid rhabdoid tumor | [ 12 ] | |||
|
Location |
Body (cg06372223) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.05E+00 | Statistic Test | p-value: 2.44E-03; Z-score: 8.14E-01 | ||
|
Methylation in Case |
8.81E-01 (Median) | Methylation in Control | 8.37E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 22 |
Methylation of SLC7A5 in atypical teratoid rhabdoid tumor | [ 12 ] | |||
|
Location |
Body (cg06492111) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.05E+00 | Statistic Test | p-value: 2.48E-03; Z-score: -5.39E-01 | ||
|
Methylation in Case |
7.73E-01 (Median) | Methylation in Control | 8.08E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 23 |
Methylation of SLC7A5 in atypical teratoid rhabdoid tumor | [ 12 ] | |||
|
Location |
Body (cg06665333) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.29E+00 | Statistic Test | p-value: 2.79E-03; Z-score: 5.64E-01 | ||
|
Methylation in Case |
2.78E-01 (Median) | Methylation in Control | 2.15E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 24 |
Methylation of SLC7A5 in atypical teratoid rhabdoid tumor | [ 12 ] | |||
|
Location |
Body (cg06727993) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.11E+00 | Statistic Test | p-value: 2.91E-03; Z-score: 4.48E-01 | ||
|
Methylation in Case |
1.08E-01 (Median) | Methylation in Control | 9.73E-02 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 25 |
Methylation of SLC7A5 in atypical teratoid rhabdoid tumor | [ 12 ] | |||
|
Location |
Body (cg06867910) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.11E+00 | Statistic Test | p-value: 2.99E-03; Z-score: -7.92E-01 | ||
|
Methylation in Case |
6.17E-01 (Median) | Methylation in Control | 6.82E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 26 |
Methylation of SLC7A5 in atypical teratoid rhabdoid tumor | [ 12 ] | |||
|
Location |
Body (cg07021906) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.05E+00 | Statistic Test | p-value: 3.24E-03; Z-score: -3.61E-01 | ||
|
Methylation in Case |
6.80E-01 (Median) | Methylation in Control | 7.15E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 27 |
Methylation of SLC7A5 in atypical teratoid rhabdoid tumor | [ 12 ] | |||
|
Location |
Body (cg07558761) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.04E+00 | Statistic Test | p-value: 4.29E-03; Z-score: -5.41E-01 | ||
|
Methylation in Case |
8.13E-01 (Median) | Methylation in Control | 8.44E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 28 |
Methylation of SLC7A5 in atypical teratoid rhabdoid tumor | [ 12 ] | |||
|
Location |
Body (cg08401758) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.18E+00 | Statistic Test | p-value: 6.12E-03; Z-score: -6.96E-01 | ||
|
Methylation in Case |
1.03E-01 (Median) | Methylation in Control | 1.21E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 29 |
Methylation of SLC7A5 in atypical teratoid rhabdoid tumor | [ 12 ] | |||
|
Location |
Body (cg08617020) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -3.26E+00 | Statistic Test | p-value: 7.64E-03; Z-score: -5.74E-01 | ||
|
Methylation in Case |
3.42E-02 (Median) | Methylation in Control | 1.12E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 30 |
Methylation of SLC7A5 in atypical teratoid rhabdoid tumor | [ 12 ] | |||
|
Location |
Body (cg08860287) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.05E+00 | Statistic Test | p-value: 8.54E-03; Z-score: 6.60E-01 | ||
|
Methylation in Case |
8.81E-01 (Median) | Methylation in Control | 8.39E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 31 |
Methylation of SLC7A5 in atypical teratoid rhabdoid tumor | [ 12 ] | |||
|
Location |
Body (cg09285525) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.03E+00 | Statistic Test | p-value: 9.77E-03; Z-score: -3.02E-01 | ||
|
Methylation in Case |
6.70E-01 (Median) | Methylation in Control | 6.92E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 32 |
Methylation of SLC7A5 in atypical teratoid rhabdoid tumor | [ 12 ] | |||
|
Location |
Body (cg10099957) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.08E+00 | Statistic Test | p-value: 1.36E-02; Z-score: -3.01E-01 | ||
|
Methylation in Case |
4.99E-01 (Median) | Methylation in Control | 5.37E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 33 |
Methylation of SLC7A5 in atypical teratoid rhabdoid tumor | [ 12 ] | |||
|
Location |
Body (cg10169763) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 1.40E-02; Z-score: -2.60E-01 | ||
|
Methylation in Case |
8.52E-01 (Median) | Methylation in Control | 8.63E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 34 |
Methylation of SLC7A5 in atypical teratoid rhabdoid tumor | [ 12 ] | |||
|
Location |
3'UTR (cg00653312) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.11E+00 | Statistic Test | p-value: 1.19E-15; Z-score: -3.65E+00 | ||
|
Methylation in Case |
8.42E-01 (Median) | Methylation in Control | 9.34E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 35 |
Methylation of SLC7A5 in atypical teratoid rhabdoid tumor | [ 12 ] | |||
|
Location |
3'UTR (cg03486383) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.78E+00 | Statistic Test | p-value: 1.18E-14; Z-score: -2.59E+00 | ||
|
Methylation in Case |
2.13E-01 (Median) | Methylation in Control | 3.78E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 36 |
Methylation of SLC7A5 in atypical teratoid rhabdoid tumor | [ 12 ] | |||
|
Location |
3'UTR (cg04481596) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.13E+00 | Statistic Test | p-value: 2.86E-14; Z-score: -3.09E+00 | ||
|
Methylation in Case |
8.23E-01 (Median) | Methylation in Control | 9.34E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 37 |
Methylation of SLC7A5 in atypical teratoid rhabdoid tumor | [ 12 ] | |||
|
Location |
3'UTR (cg06071246) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.41E+00 | Statistic Test | p-value: 6.17E-14; Z-score: 2.20E+00 | ||
|
Methylation in Case |
7.37E-01 (Median) | Methylation in Control | 5.21E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 38 |
Methylation of SLC7A5 in atypical teratoid rhabdoid tumor | [ 12 ] | |||
|
Location |
3'UTR (cg06770731) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.82E+00 | Statistic Test | p-value: 1.73E-13; Z-score: -2.34E+00 | ||
|
Methylation in Case |
3.38E-01 (Median) | Methylation in Control | 6.14E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 39 |
Methylation of SLC7A5 in atypical teratoid rhabdoid tumor | [ 12 ] | |||
|
Location |
3'UTR (cg08094280) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.93E+00 | Statistic Test | p-value: 3.78E-13; Z-score: -1.95E+00 | ||
|
Methylation in Case |
3.00E-01 (Median) | Methylation in Control | 5.78E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 40 |
Methylation of SLC7A5 in atypical teratoid rhabdoid tumor | [ 12 ] | |||
|
Location |
3'UTR (cg09618385) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.62E+00 | Statistic Test | p-value: 1.41E-12; Z-score: -1.95E+00 | ||
|
Methylation in Case |
3.59E-01 (Median) | Methylation in Control | 5.83E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 41 |
Methylation of SLC7A5 in atypical teratoid rhabdoid tumor | [ 12 ] | |||
|
Location |
3'UTR (cg10034481) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.33E+00 | Statistic Test | p-value: 2.06E-12; Z-score: -2.00E+00 | ||
|
Methylation in Case |
6.02E-01 (Median) | Methylation in Control | 7.98E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 42 |
Methylation of SLC7A5 in atypical teratoid rhabdoid tumor | [ 12 ] | |||
|
Location |
3'UTR (cg27135163) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.13E+00 | Statistic Test | p-value: 3.32E-09; Z-score: -1.59E+00 | ||
|
Methylation in Case |
7.50E-01 (Median) | Methylation in Control | 8.49E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Celiac disease |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC7A5 in celiac disease | [ 13 ] | |||
|
Location |
Body (cg05834639) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.06E+00 | Statistic Test | p-value: 4.43E-02; Z-score: -3.71E-01 | ||
|
Methylation in Case |
7.20E-01 (Median) | Methylation in Control | 7.64E-01 (Median) | ||
|
Studied Phenotype |
Celiac disease [ ICD-11: DA95] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Colon cancer |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC7A5 in colon adenocarcinoma | [ 14 ] | |||
|
Location |
Body (cg16925177) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.21E+00 | Statistic Test | p-value: 1.51E-04; Z-score: -3.72E+00 | ||
|
Methylation in Case |
6.90E-01 (Median) | Methylation in Control | 8.32E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Depression |
2 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC7A5 in depression | [ 15 ] | |||
|
Location |
Body (cg10169763) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.01E+00 | Statistic Test | p-value: 2.33E-02; Z-score: 3.88E-01 | ||
|
Methylation in Case |
8.67E-01 (Median) | Methylation in Control | 8.58E-01 (Median) | ||
|
Studied Phenotype |
Depression [ ICD-11: 6A8Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC7A5 in depression | [ 15 ] | |||
|
Location |
Body (cg05393733) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 3.66E-02; Z-score: -5.58E-01 | ||
|
Methylation in Case |
8.98E-01 (Median) | Methylation in Control | 9.07E-01 (Median) | ||
|
Studied Phenotype |
Depression [ ICD-11: 6A8Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Lung adenocarcinoma |
21 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC7A5 in lung adenocarcinoma | [ 16 ] | |||
|
Location |
Body (cg01829163) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.13E+00 | Statistic Test | p-value: 2.52E-04; Z-score: 2.43E+00 | ||
|
Methylation in Case |
9.06E-01 (Median) | Methylation in Control | 8.01E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC7A5 in lung adenocarcinoma | [ 16 ] | |||
|
Location |
Body (cg05911082) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.11E+00 | Statistic Test | p-value: 4.52E-04; Z-score: 2.00E+00 | ||
|
Methylation in Case |
8.27E-01 (Median) | Methylation in Control | 7.47E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of SLC7A5 in lung adenocarcinoma | [ 16 ] | |||
|
Location |
Body (cg06665333) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.13E+00 | Statistic Test | p-value: 6.60E-04; Z-score: 2.21E+00 | ||
|
Methylation in Case |
9.14E-01 (Median) | Methylation in Control | 8.10E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of SLC7A5 in lung adenocarcinoma | [ 16 ] | |||
|
Location |
Body (cg06372223) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.13E+00 | Statistic Test | p-value: 7.37E-04; Z-score: -3.56E+00 | ||
|
Methylation in Case |
6.87E-01 (Median) | Methylation in Control | 7.76E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of SLC7A5 in lung adenocarcinoma | [ 16 ] | |||
|
Location |
Body (cg03553613) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.09E+00 | Statistic Test | p-value: 1.02E-03; Z-score: 1.55E+00 | ||
|
Methylation in Case |
8.44E-01 (Median) | Methylation in Control | 7.78E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 6 |
Methylation of SLC7A5 in lung adenocarcinoma | [ 16 ] | |||
|
Location |
Body (cg10099957) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.05E+00 | Statistic Test | p-value: 1.10E-03; Z-score: 2.88E+00 | ||
|
Methylation in Case |
9.34E-01 (Median) | Methylation in Control | 8.92E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 7 |
Methylation of SLC7A5 in lung adenocarcinoma | [ 16 ] | |||
|
Location |
Body (cg00069417) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.05E+00 | Statistic Test | p-value: 1.35E-03; Z-score: 1.75E+00 | ||
|
Methylation in Case |
8.84E-01 (Median) | Methylation in Control | 8.43E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 8 |
Methylation of SLC7A5 in lung adenocarcinoma | [ 16 ] | |||
|
Location |
Body (cg08860287) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.10E+00 | Statistic Test | p-value: 2.44E-03; Z-score: 1.78E+00 | ||
|
Methylation in Case |
7.42E-01 (Median) | Methylation in Control | 6.75E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 9 |
Methylation of SLC7A5 in lung adenocarcinoma | [ 16 ] | |||
|
Location |
Body (cg26907768) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.16E+00 | Statistic Test | p-value: 3.05E-03; Z-score: -1.95E+00 | ||
|
Methylation in Case |
1.79E-01 (Median) | Methylation in Control | 2.07E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 10 |
Methylation of SLC7A5 in lung adenocarcinoma | [ 16 ] | |||
|
Location |
Body (cg03850117) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.32E+00 | Statistic Test | p-value: 3.90E-03; Z-score: -5.21E+00 | ||
|
Methylation in Case |
3.40E-01 (Median) | Methylation in Control | 4.50E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 11 |
Methylation of SLC7A5 in lung adenocarcinoma | [ 16 ] | |||
|
Location |
Body (cg04171052) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.05E+00 | Statistic Test | p-value: 7.26E-03; Z-score: 8.44E-01 | ||
|
Methylation in Case |
8.06E-01 (Median) | Methylation in Control | 7.71E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 12 |
Methylation of SLC7A5 in lung adenocarcinoma | [ 16 ] | |||
|
Location |
Body (cg02454636) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.05E+00 | Statistic Test | p-value: 8.67E-03; Z-score: 1.16E+00 | ||
|
Methylation in Case |
7.35E-01 (Median) | Methylation in Control | 7.02E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 13 |
Methylation of SLC7A5 in lung adenocarcinoma | [ 16 ] | |||
|
Location |
Body (cg26529851) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.22E+00 | Statistic Test | p-value: 1.54E-02; Z-score: 4.05E+00 | ||
|
Methylation in Case |
7.11E-01 (Median) | Methylation in Control | 5.81E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 14 |
Methylation of SLC7A5 in lung adenocarcinoma | [ 16 ] | |||
|
Location |
Body (cg26982544) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.45E+00 | Statistic Test | p-value: 1.96E-02; Z-score: 2.84E+00 | ||
|
Methylation in Case |
1.50E-01 (Median) | Methylation in Control | 1.04E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 15 |
Methylation of SLC7A5 in lung adenocarcinoma | [ 16 ] | |||
|
Location |
Body (cg05393733) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.01E+00 | Statistic Test | p-value: 1.97E-02; Z-score: 8.46E-01 | ||
|
Methylation in Case |
9.10E-01 (Median) | Methylation in Control | 9.02E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 16 |
Methylation of SLC7A5 in lung adenocarcinoma | [ 16 ] | |||
|
Location |
Body (cg08401758) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.36E+00 | Statistic Test | p-value: 3.96E-02; Z-score: 1.95E+00 | ||
|
Methylation in Case |
1.87E-01 (Median) | Methylation in Control | 1.37E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 17 |
Methylation of SLC7A5 in lung adenocarcinoma | [ 16 ] | |||
|
Location |
Body (cg01856752) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.05E+00 | Statistic Test | p-value: 4.85E-02; Z-score: 1.07E+00 | ||
|
Methylation in Case |
8.12E-01 (Median) | Methylation in Control | 7.71E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 18 |
Methylation of SLC7A5 in lung adenocarcinoma | [ 16 ] | |||
|
Location |
3'UTR (cg09618385) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.11E+00 | Statistic Test | p-value: 8.68E-04; Z-score: 1.85E+00 | ||
|
Methylation in Case |
7.44E-01 (Median) | Methylation in Control | 6.72E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 19 |
Methylation of SLC7A5 in lung adenocarcinoma | [ 16 ] | |||
|
Location |
3'UTR (cg04481596) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.02E+00 | Statistic Test | p-value: 2.89E-02; Z-score: 7.18E-01 | ||
|
Methylation in Case |
9.02E-01 (Median) | Methylation in Control | 8.82E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 20 |
Methylation of SLC7A5 in lung adenocarcinoma | [ 16 ] | |||
|
Location |
3'UTR (cg08094280) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.02E+00 | Statistic Test | p-value: 3.36E-02; Z-score: 7.30E-01 | ||
|
Methylation in Case |
8.58E-01 (Median) | Methylation in Control | 8.44E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 21 |
Methylation of SLC7A5 in lung adenocarcinoma | [ 16 ] | |||
|
Location |
3'UTR (cg06770731) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.02E+00 | Statistic Test | p-value: 3.67E-02; Z-score: -2.69E+00 | ||
|
Methylation in Case |
9.37E-01 (Median) | Methylation in Control | 9.59E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Systemic lupus erythematosus |
9 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC7A5 in systemic lupus erythematosus | [ 17 ] | |||
|
Location |
Body (cg26907768) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.05E+00 | Statistic Test | p-value: 3.96E-04; Z-score: -2.74E-01 | ||
|
Methylation in Case |
1.90E-01 (Median) | Methylation in Control | 1.99E-01 (Median) | ||
|
Studied Phenotype |
Systemic lupus erythematosus [ ICD-11: 4A40.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC7A5 in systemic lupus erythematosus | [ 17 ] | |||
|
Location |
Body (cg09285525) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.00E+00 | Statistic Test | p-value: 2.07E-03; Z-score: -2.35E-01 | ||
|
Methylation in Case |
9.18E-01 (Median) | Methylation in Control | 9.22E-01 (Median) | ||
|
Studied Phenotype |
Systemic lupus erythematosus [ ICD-11: 4A40.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of SLC7A5 in systemic lupus erythematosus | [ 17 ] | |||
|
Location |
Body (cg06867910) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.10E+00 | Statistic Test | p-value: 2.74E-03; Z-score: 2.33E-01 | ||
|
Methylation in Case |
1.62E-01 (Median) | Methylation in Control | 1.47E-01 (Median) | ||
|
Studied Phenotype |
Systemic lupus erythematosus [ ICD-11: 4A40.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of SLC7A5 in systemic lupus erythematosus | [ 17 ] | |||
|
Location |
Body (cg06372223) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.03E+00 | Statistic Test | p-value: 3.04E-03; Z-score: -2.32E-01 | ||
|
Methylation in Case |
6.74E-01 (Median) | Methylation in Control | 6.97E-01 (Median) | ||
|
Studied Phenotype |
Systemic lupus erythematosus [ ICD-11: 4A40.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of SLC7A5 in systemic lupus erythematosus | [ 17 ] | |||
|
Location |
Body (cg08401758) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.13E+00 | Statistic Test | p-value: 1.09E-02; Z-score: 2.64E-01 | ||
|
Methylation in Case |
2.35E-01 (Median) | Methylation in Control | 2.09E-01 (Median) | ||
|
Studied Phenotype |
Systemic lupus erythematosus [ ICD-11: 4A40.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 6 |
Methylation of SLC7A5 in systemic lupus erythematosus | [ 17 ] | |||
|
Location |
Body (cg27560818) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.00E+00 | Statistic Test | p-value: 2.54E-02; Z-score: -9.08E-02 | ||
|
Methylation in Case |
9.37E-01 (Median) | Methylation in Control | 9.39E-01 (Median) | ||
|
Studied Phenotype |
Systemic lupus erythematosus [ ICD-11: 4A40.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 7 |
Methylation of SLC7A5 in systemic lupus erythematosus | [ 17 ] | |||
|
Location |
Body (cg08617020) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.02E+00 | Statistic Test | p-value: 3.00E-02; Z-score: -2.78E-01 | ||
|
Methylation in Case |
7.96E-01 (Median) | Methylation in Control | 8.10E-01 (Median) | ||
|
Studied Phenotype |
Systemic lupus erythematosus [ ICD-11: 4A40.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 8 |
Methylation of SLC7A5 in systemic lupus erythematosus | [ 17 ] | |||
|
Location |
Body (cg03553613) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.00E+00 | Statistic Test | p-value: 4.91E-02; Z-score: -1.63E-01 | ||
|
Methylation in Case |
9.01E-01 (Median) | Methylation in Control | 9.04E-01 (Median) | ||
|
Studied Phenotype |
Systemic lupus erythematosus [ ICD-11: 4A40.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 9 |
Methylation of SLC7A5 in systemic lupus erythematosus | [ 17 ] | |||
|
Location |
3'UTR (cg27135163) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.00E+00 | Statistic Test | p-value: 4.26E-04; Z-score: 9.39E-03 | ||
|
Methylation in Case |
9.21E-01 (Median) | Methylation in Control | 9.20E-01 (Median) | ||
|
Studied Phenotype |
Systemic lupus erythematosus [ ICD-11: 4A40.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
microRNA |
|||||
|
Small cell lung cancer |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Lower expression of miR-126 in small cell lung cancer | [ 18 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | Luciferase reporter assay | ||
|
Related Molecular Changes |
Down regulation of SLC7A5 | Experiment Method | Western Blot | ||
|
miRNA Stemloop ID |
miR-126 | miRNA Mature ID | miR-126-3p | ||
|
miRNA Sequence |
UCGUACCGUGAGUAAUAAUGCG | ||||
|
miRNA Target Type |
Direct | ||||
|
Studied Phenotype |
Small cell lung cancer [ ICD-11: 2C25.1] | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Additional Notes |
Overexpression of miR-126 suppresses SLC7A5 expression at both the RNA and the protein level. | ||||
|
Gastric cancer |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Lower expression of miR-126 in small gastric cancer | [ 19 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | Luciferase reporter assay | ||
|
Related Molecular Changes |
Down regulation of SLC7A5 | Experiment Method | RT-qPCR | ||
|
miRNA Stemloop ID |
miR-126 | miRNA Mature ID | miR-126-3p | ||
|
miRNA Sequence |
UCGUACCGUGAGUAAUAAUGCG | ||||
|
miRNA Target Type |
Direct | ||||
|
Studied Phenotype |
Gastric cancer [ ICD-11: 2B72] | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Additional Notes |
miR-126 was down-regulated in gastric cancer and regulated SLC7A5 expression via binding to the SLC7A5 mRNA. | ||||
|
Thyroid cancer |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
miR-193a-3p regulates SLC7A5 in thyroid carcinoma | [ 20 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | Dual-luciferase reporter assay | ||
|
Related Molecular Changes |
Down regulation of SLC7A5 | Experiment Method | RT-qPCR | ||
|
miRNA Stemloop ID |
miR-193a | miRNA Mature ID | miR-193a-3p | ||
|
miRNA Sequence |
AACUGGCCUACAAAGUCCCAGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Studied Phenotype |
Thyroid cancer [ ICD-11: 2D10] | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Additional Notes |
miR-193a-3p regulates SLC7A5 expression via binding to the SLC7A5 mRNA. | ||||
|
Unclear Phenotype |
256 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
miR-122 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-122 | miRNA Mature ID | miR-122-5p | ||
|
miRNA Sequence |
UGGAGUGUGACAAUGGUGUUUG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 2 |
miR-1224 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-1224 | miRNA Mature ID | miR-1224-3p | ||
|
miRNA Sequence |
CCCCACCUCCUCUCUCCUCAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 3 |
miR-1226 directly targets SLC7A5 | [ 22 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-1226 | miRNA Mature ID | miR-1226-5p | ||
|
miRNA Sequence |
GUGAGGGCAUGCAGGCCUGGAUGGGG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon 4 |
miR-1227 directly targets SLC7A5 | [ 23 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-1227 | miRNA Mature ID | miR-1227-5p | ||
|
miRNA Sequence |
GUGGGGCCAGGCGGUGG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 5 |
miR-1237 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-1237 | miRNA Mature ID | miR-1237-5p | ||
|
miRNA Sequence |
CGGGGGCGGGGCCGAAGCGCG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 6 |
miR-1249 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-1249 | miRNA Mature ID | miR-1249-5p | ||
|
miRNA Sequence |
AGGAGGGAGGAGAUGGGCCAAGUU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 7 |
miR-1255a directly targets SLC7A5 | [ 22 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-1255a | miRNA Mature ID | miR-1255a | ||
|
miRNA Sequence |
AGGAUGAGCAAAGAAAGUAGAUU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon 8 |
miR-1255b directly targets SLC7A5 | [ 22 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-1255b | miRNA Mature ID | miR-1255b-5p | ||
|
miRNA Sequence |
CGGAUGAGCAAAGAAAGUGGUU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon 9 |
miR-1260a directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-1260a | miRNA Mature ID | miR-1260a | ||
|
miRNA Sequence |
AUCCCACCUCUGCCACCA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 10 |
miR-1260b directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-1260b | miRNA Mature ID | miR-1260b | ||
|
miRNA Sequence |
AUCCCACCACUGCCACCAU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 11 |
miR-1264 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-1264 | miRNA Mature ID | miR-1264 | ||
|
miRNA Sequence |
CAAGUCUUAUUUGAGCACCUGUU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 12 |
miR-1273h directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-1273h | miRNA Mature ID | miR-1273h-5p | ||
|
miRNA Sequence |
CUGGGAGGUCAAGGCUGCAGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 13 |
miR-1285 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-1285 | miRNA Mature ID | miR-1285-3p | ||
|
miRNA Sequence |
UCUGGGCAACAAAGUGAGACCU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 14 |
miR-1292 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-1292 | miRNA Mature ID | miR-1292-5p | ||
|
miRNA Sequence |
UGGGAACGGGUUCCGGCAGACGCUG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 15 |
miR-1295a directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-1295a | miRNA Mature ID | miR-1295a | ||
|
miRNA Sequence |
UUAGGCCGCAGAUCUGGGUGA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 16 |
miR-132 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-132 | miRNA Mature ID | miR-132-5p | ||
|
miRNA Sequence |
ACCGUGGCUUUCGAUUGUUACU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 17 |
miR-140 directly targets SLC7A5 | [ 24 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-140 | miRNA Mature ID | miR-140-3p | ||
|
miRNA Sequence |
UACCACAGGGUAGAACCACGG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 18 |
miR-149 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-149 | miRNA Mature ID | miR-149-3p | ||
|
miRNA Sequence |
AGGGAGGGACGGGGGCUGUGC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 19 |
miR-1539 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-1539 | miRNA Mature ID | miR-1539 | ||
|
miRNA Sequence |
UCCUGCGCGUCCCAGAUGCCC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 20 |
miR-15a directly targets SLC7A5 | [ 25 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-15a | miRNA Mature ID | miR-15a-5p | ||
|
miRNA Sequence |
UAGCAGCACAUAAUGGUUUGUG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 21 |
miR-15b directly targets SLC7A5 | [ 25 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-15b | miRNA Mature ID | miR-15b-5p | ||
|
miRNA Sequence |
UAGCAGCACAUCAUGGUUUACA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 22 |
miR-16 directly targets SLC7A5 | [ 25 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-16 | miRNA Mature ID | miR-16-5p | ||
|
miRNA Sequence |
UAGCAGCACGUAAAUAUUGGCG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 23 |
miR-184 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-184 | miRNA Mature ID | miR-184 | ||
|
miRNA Sequence |
UGGACGGAGAACUGAUAAGGGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 24 |
miR-185 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-185 | miRNA Mature ID | miR-185-3p | ||
|
miRNA Sequence |
AGGGGCUGGCUUUCCUCUGGUC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 25 |
miR-186 directly targets SLC7A5 | [ 26 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-186 | miRNA Mature ID | miR-186-5p | ||
|
miRNA Sequence |
CAAAGAAUUCUCCUUUUGGGCU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon 26 |
miR-1908 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-1908 | miRNA Mature ID | miR-1908-5p | ||
|
miRNA Sequence |
CGGCGGGGACGGCGAUUGGUC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 27 |
miR-193a directly targets SLC7A5 | [ 20 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | Immunoflourescence//Luciferase reporter assay//qRT-PCR//Western blot | ||
|
miRNA Stemloop ID |
miR-193a | miRNA Mature ID | miR-193a-3p | ||
|
miRNA Sequence |
AACUGGCCUACAAAGUCCCAGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 28 |
miR-193b directly targets SLC7A5 | [ 27 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | Microarray | ||
|
miRNA Stemloop ID |
miR-193b | miRNA Mature ID | miR-193b-3p | ||
|
miRNA Sequence |
AACUGGCCCUCAAAGUCCCGCU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 29 |
miR-194 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-194 | miRNA Mature ID | miR-194-3p | ||
|
miRNA Sequence |
CCAGUGGGGCUGCUGUUAUCUG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 30 |
miR-195 directly targets SLC7A5 | [ 25 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-195 | miRNA Mature ID | miR-195-5p | ||
|
miRNA Sequence |
UAGCAGCACAGAAAUAUUGGC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 31 |
miR-205 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-205 | miRNA Mature ID | miR-205-3p | ||
|
miRNA Sequence |
GAUUUCAGUGGAGUGAAGUUC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 32 |
miR-214 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-214 | miRNA Mature ID | miR-214-3p | ||
|
miRNA Sequence |
ACAGCAGGCACAGACAGGCAGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 33 |
miR-219b directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-219b | miRNA Mature ID | miR-219b-5p | ||
|
miRNA Sequence |
AGAUGUCCAGCCACAAUUCUCG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 34 |
miR-22 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-22 | miRNA Mature ID | miR-22-3p | ||
|
miRNA Sequence |
AAGCUGCCAGUUGAAGAACUGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 35 |
miR-223 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-223 | miRNA Mature ID | miR-223-3p | ||
|
miRNA Sequence |
UGUCAGUUUGUCAAAUACCCCA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 36 |
miR-24-1 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-24-1 | miRNA Mature ID | miR-24-1-5p | ||
|
miRNA Sequence |
UGCCUACUGAGCUGAUAUCAGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 37 |
miR-24-2 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-24-2 | miRNA Mature ID | miR-24-2-5p | ||
|
miRNA Sequence |
UGCCUACUGAGCUGAAACACAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 38 |
miR-28 directly targets SLC7A5 | [ 23 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-28 | miRNA Mature ID | miR-28-5p | ||
|
miRNA Sequence |
AAGGAGCUCACAGUCUAUUGAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 39 |
miR-296 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-296 | miRNA Mature ID | miR-296-5p | ||
|
miRNA Sequence |
AGGGCCCCCCCUCAAUCCUGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 40 |
miR-296 directly targets SLC7A5 | [ 24 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-296 | miRNA Mature ID | miR-296-3p | ||
|
miRNA Sequence |
GAGGGUUGGGUGGAGGCUCUCC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 41 |
miR-3065 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-3065 | miRNA Mature ID | miR-3065-3p | ||
|
miRNA Sequence |
UCAGCACCAGGAUAUUGUUGGAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 42 |
miR-30a directly targets SLC7A5 | [ 23 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-30a | miRNA Mature ID | miR-30a-5p | ||
|
miRNA Sequence |
UGUAAACAUCCUCGACUGGAAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 43 |
miR-30b directly targets SLC7A5 | [ 23 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-30b | miRNA Mature ID | miR-30b-5p | ||
|
miRNA Sequence |
UGUAAACAUCCUACACUCAGCU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 44 |
miR-30b directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-30b | miRNA Mature ID | miR-30b-3p | ||
|
miRNA Sequence |
CUGGGAGGUGGAUGUUUACUUC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 45 |
miR-30c directly targets SLC7A5 | [ 23 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-30c | miRNA Mature ID | miR-30c-5p | ||
|
miRNA Sequence |
UGUAAACAUCCUACACUCUCAGC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 46 |
miR-30d directly targets SLC7A5 | [ 23 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-30d | miRNA Mature ID | miR-30d-5p | ||
|
miRNA Sequence |
UGUAAACAUCCCCGACUGGAAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 47 |
miR-30e directly targets SLC7A5 | [ 23 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-30e | miRNA Mature ID | miR-30e-5p | ||
|
miRNA Sequence |
UGUAAACAUCCUUGACUGGAAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 48 |
miR-3126 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-3126 | miRNA Mature ID | miR-3126-5p | ||
|
miRNA Sequence |
UGAGGGACAGAUGCCAGAAGCA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 49 |
miR-3133 directly targets SLC7A5 | [ 26 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-3133 | miRNA Mature ID | miR-3133 | ||
|
miRNA Sequence |
UAAAGAACUCUUAAAACCCAAU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon 50 |
miR-3135a directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-3135a | miRNA Mature ID | miR-3135a | ||
|
miRNA Sequence |
UGCCUAGGCUGAGACUGCAGUG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 51 |
miR-3136 directly targets SLC7A5 | [ 23 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-3136 | miRNA Mature ID | miR-3136-3p | ||
|
miRNA Sequence |
UGGCCCAACCUAUUCAGUUAGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 52 |
miR-3139 directly targets SLC7A5 | [ 23 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-3139 | miRNA Mature ID | miR-3139 | ||
|
miRNA Sequence |
UAGGAGCUCAACAGAUGCCUGUU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 53 |
miR-3148 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-3148 | miRNA Mature ID | miR-3148 | ||
|
miRNA Sequence |
UGGAAAAAACUGGUGUGUGCUU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 54 |
miR-3154 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-3154 | miRNA Mature ID | miR-3154 | ||
|
miRNA Sequence |
CAGAAGGGGAGUUGGGAGCAGA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 55 |
miR-3155a directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-3155a | miRNA Mature ID | miR-3155a | ||
|
miRNA Sequence |
CCAGGCUCUGCAGUGGGAACU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 56 |
miR-3155b directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-3155b | miRNA Mature ID | miR-3155b | ||
|
miRNA Sequence |
CCAGGCUCUGCAGUGGGA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 57 |
miR-3173 directly targets SLC7A5 | [ 23 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-3173 | miRNA Mature ID | miR-3173-3p | ||
|
miRNA Sequence |
AAAGGAGGAAAUAGGCAGGCCA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 58 |
miR-3179 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-3179 | miRNA Mature ID | miR-3179 | ||
|
miRNA Sequence |
AGAAGGGGUGAAAUUUAAACGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 59 |
miR-3180 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-3180 | miRNA Mature ID | miR-3180 | ||
|
miRNA Sequence |
UGGGGCGGAGCUUCCGGAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 60 |
miR-3180 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-3180 | miRNA Mature ID | miR-3180-3p | ||
|
miRNA Sequence |
UGGGGCGGAGCUUCCGGAGGCC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 61 |
miR-3187 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-3187 | miRNA Mature ID | miR-3187-3p | ||
|
miRNA Sequence |
UUGGCCAUGGGGCUGCGCGG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 62 |
miR-3187 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-3187 | miRNA Mature ID | miR-3187-5p | ||
|
miRNA Sequence |
CCUGGGCAGCGUGUGGCUGAAGG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 63 |
miR-3189 directly targets SLC7A5 | [ 23 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-3189 | miRNA Mature ID | miR-3189-3p | ||
|
miRNA Sequence |
CCCUUGGGUCUGAUGGGGUAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 64 |
miR-3192 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-3192 | miRNA Mature ID | miR-3192-5p | ||
|
miRNA Sequence |
UCUGGGAGGUUGUAGCAGUGGAA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 65 |
miR-3196 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-3196 | miRNA Mature ID | miR-3196 | ||
|
miRNA Sequence |
CGGGGCGGCAGGGGCCUC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 66 |
miR-3199 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-3199 | miRNA Mature ID | miR-3199 | ||
|
miRNA Sequence |
AGGGACUGCCUUAGGAGAAAGUU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 67 |
miR-3202 directly targets SLC7A5 | [ 23 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-3202 | miRNA Mature ID | miR-3202 | ||
|
miRNA Sequence |
UGGAAGGGAGAAGAGCUUUAAU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 68 |
miR-338 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-338 | miRNA Mature ID | miR-338-3p | ||
|
miRNA Sequence |
UCCAGCAUCAGUGAUUUUGUUG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 69 |
miR-33a directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-33a | miRNA Mature ID | miR-33a-5p | ||
|
miRNA Sequence |
GUGCAUUGUAGUUGCAUUGCA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 70 |
miR-33b directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-33b | miRNA Mature ID | miR-33b-5p | ||
|
miRNA Sequence |
GUGCAUUGCUGUUGCAUUGC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 71 |
miR-3611 directly targets SLC7A5 | [ 23 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-3611 | miRNA Mature ID | miR-3611 | ||
|
miRNA Sequence |
UUGUGAAGAAAGAAAUUCUUA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 72 |
miR-3612 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-3612 | miRNA Mature ID | miR-3612 | ||
|
miRNA Sequence |
AGGAGGCAUCUUGAGAAAUGGA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 73 |
miR-3619 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-3619 | miRNA Mature ID | miR-3619-5p | ||
|
miRNA Sequence |
UCAGCAGGCAGGCUGGUGCAGC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 74 |
miR-3661 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-3661 | miRNA Mature ID | miR-3661 | ||
|
miRNA Sequence |
UGACCUGGGACUCGGACAGCUG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 75 |
miR-3664 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-3664 | miRNA Mature ID | miR-3664-3p | ||
|
miRNA Sequence |
UCUCAGGAGUAAAGACAGAGUU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 76 |
miR-3689a directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-3689a | miRNA Mature ID | miR-3689a-3p | ||
|
miRNA Sequence |
CUGGGAGGUGUGAUAUCGUGGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 77 |
miR-3689b directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-3689b | miRNA Mature ID | miR-3689b-3p | ||
|
miRNA Sequence |
CUGGGAGGUGUGAUAUUGUGGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 78 |
miR-3689c directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-3689c | miRNA Mature ID | miR-3689c | ||
|
miRNA Sequence |
CUGGGAGGUGUGAUAUUGUGGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 79 |
miR-3689d directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-3689d | miRNA Mature ID | miR-3689d | ||
|
miRNA Sequence |
GGGAGGUGUGAUCUCACACUCG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 80 |
miR-383 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-383 | miRNA Mature ID | miR-383-3p | ||
|
miRNA Sequence |
ACAGCACUGCCUGGUCAGA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 81 |
miR-3911 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-3911 | miRNA Mature ID | miR-3911 | ||
|
miRNA Sequence |
UGUGUGGAUCCUGGAGGAGGCA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 82 |
miR-3929 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-3929 | miRNA Mature ID | miR-3929 | ||
|
miRNA Sequence |
GAGGCUGAUGUGAGUAGACCACU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 83 |
miR-3934 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-3934 | miRNA Mature ID | miR-3934-3p | ||
|
miRNA Sequence |
UGCUCAGGUUGCACAGCUGGGA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 84 |
miR-3937 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-3937 | miRNA Mature ID | miR-3937 | ||
|
miRNA Sequence |
ACAGGCGGCUGUAGCAAUGGGGG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 85 |
miR-4260 directly targets SLC7A5 | [ 23 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4260 | miRNA Mature ID | miR-4260 | ||
|
miRNA Sequence |
CUUGGGGCAUGGAGUCCCA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 86 |
miR-4264 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4264 | miRNA Mature ID | miR-4264 | ||
|
miRNA Sequence |
ACUCAGUCAUGGUCAUU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 87 |
miR-4267 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4267 | miRNA Mature ID | miR-4267 | ||
|
miRNA Sequence |
UCCAGCUCGGUGGCAC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 88 |
miR-4270 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4270 | miRNA Mature ID | miR-4270 | ||
|
miRNA Sequence |
UCAGGGAGUCAGGGGAGGGC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 89 |
miR-4271 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4271 | miRNA Mature ID | miR-4271 | ||
|
miRNA Sequence |
GGGGGAAGAAAAGGUGGGG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 90 |
miR-4285 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4285 | miRNA Mature ID | miR-4285 | ||
|
miRNA Sequence |
GCGGCGAGUCCGACUCAU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 91 |
miR-4302 directly targets SLC7A5 | [ 23 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4302 | miRNA Mature ID | miR-4302 | ||
|
miRNA Sequence |
CCAGUGUGGCUCAGCGAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 92 |
miR-4434 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4434 | miRNA Mature ID | miR-4434 | ||
|
miRNA Sequence |
AGGAGAAGUAAAGUAGAA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 93 |
miR-4435 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4435 | miRNA Mature ID | miR-4435 | ||
|
miRNA Sequence |
AUGGCCAGAGCUCACACAGAGG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 94 |
miR-4436a directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4436a | miRNA Mature ID | miR-4436a | ||
|
miRNA Sequence |
GCAGGACAGGCAGAAGUGGAU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 95 |
miR-4441 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4441 | miRNA Mature ID | miR-4441 | ||
|
miRNA Sequence |
ACAGGGAGGAGAUUGUA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 96 |
miR-4443 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4443 | miRNA Mature ID | miR-4443 | ||
|
miRNA Sequence |
UUGGAGGCGUGGGUUUU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 97 |
miR-4471 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4471 | miRNA Mature ID | miR-4471 | ||
|
miRNA Sequence |
UGGGAACUUAGUAGAGGUUUAA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 98 |
miR-4475 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4475 | miRNA Mature ID | miR-4475 | ||
|
miRNA Sequence |
CAAGGGACCAAGCAUUCAUUAU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 99 |
miR-4476 directly targets SLC7A5 | [ 23 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4476 | miRNA Mature ID | miR-4476 | ||
|
miRNA Sequence |
CAGGAAGGAUUUAGGGACAGGC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 100 |
miR-4478 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4478 | miRNA Mature ID | miR-4478 | ||
|
miRNA Sequence |
GAGGCUGAGCUGAGGAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 101 |
miR-4481 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4481 | miRNA Mature ID | miR-4481 | ||
|
miRNA Sequence |
GGAGUGGGCUGGUGGUU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 102 |
miR-4488 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4488 | miRNA Mature ID | miR-4488 | ||
|
miRNA Sequence |
AGGGGGCGGGCUCCGGCG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 103 |
miR-449b directly targets SLC7A5 | [ 26 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-449b | miRNA Mature ID | miR-449b-3p | ||
|
miRNA Sequence |
CAGCCACAACUACCCUGCCACU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon 104 |
miR-4510 directly targets SLC7A5 | [ 22 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4510 | miRNA Mature ID | miR-4510 | ||
|
miRNA Sequence |
UGAGGGAGUAGGAUGUAUGGUU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon 105 |
miR-4515 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4515 | miRNA Mature ID | miR-4515 | ||
|
miRNA Sequence |
AGGACUGGACUCCCGGCAGCCC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 106 |
miR-4516 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4516 | miRNA Mature ID | miR-4516 | ||
|
miRNA Sequence |
GGGAGAAGGGUCGGGGC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 107 |
miR-4530 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4530 | miRNA Mature ID | miR-4530 | ||
|
miRNA Sequence |
CCCAGCAGGACGGGAGCG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 108 |
miR-4531 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4531 | miRNA Mature ID | miR-4531 | ||
|
miRNA Sequence |
AUGGAGAAGGCUUCUGA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 109 |
miR-4650 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4650 | miRNA Mature ID | miR-4650-5p | ||
|
miRNA Sequence |
UCAGGCCUCUUUCUACCUU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 110 |
miR-4663 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4663 | miRNA Mature ID | miR-4663 | ||
|
miRNA Sequence |
AGCUGAGCUCCAUGGACGUGCAGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 111 |
miR-4668 directly targets SLC7A5 | [ 23 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4668 | miRNA Mature ID | miR-4668-5p | ||
|
miRNA Sequence |
AGGGAAAAAAAAAAGGAUUUGUC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 112 |
miR-4690 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4690 | miRNA Mature ID | miR-4690-5p | ||
|
miRNA Sequence |
GAGCAGGCGAGGCUGGGCUGAA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 113 |
miR-4691 directly targets SLC7A5 | [ 26 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4691 | miRNA Mature ID | miR-4691-3p | ||
|
miRNA Sequence |
CCAGCCACGGACUGAGAGUGCAU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon 114 |
miR-4697 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4697 | miRNA Mature ID | miR-4697-3p | ||
|
miRNA Sequence |
UGUCAGUGACUCCUGCCCCUUGGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 115 |
miR-4697 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4697 | miRNA Mature ID | miR-4697-5p | ||
|
miRNA Sequence |
AGGGGGCGCAGUCACUGACGUG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 116 |
miR-4700 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4700 | miRNA Mature ID | miR-4700-3p | ||
|
miRNA Sequence |
CACAGGACUGACUCCUCACCCCAGUG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 117 |
miR-4701 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4701 | miRNA Mature ID | miR-4701-5p | ||
|
miRNA Sequence |
UUGGCCACCACACCUACCCCUU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 118 |
miR-4704 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4704 | miRNA Mature ID | miR-4704-3p | ||
|
miRNA Sequence |
UCAGUCACAUAUCUAGUGUCUA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 119 |
miR-4706 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4706 | miRNA Mature ID | miR-4706 | ||
|
miRNA Sequence |
AGCGGGGAGGAAGUGGGCGCUGCUU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 120 |
miR-4711 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4711 | miRNA Mature ID | miR-4711-5p | ||
|
miRNA Sequence |
UGCAUCAGGCCAGAAGACAUGAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 121 |
miR-4716 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4716 | miRNA Mature ID | miR-4716-3p | ||
|
miRNA Sequence |
AAGGGGGAAGGAAACAUGGAGA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 122 |
miR-4722 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4722 | miRNA Mature ID | miR-4722-5p | ||
|
miRNA Sequence |
GGCAGGAGGGCUGUGCCAGGUUG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 123 |
miR-4723 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4723 | miRNA Mature ID | miR-4723-5p | ||
|
miRNA Sequence |
UGGGGGAGCCAUGAGAUAAGAGCA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 124 |
miR-4725 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4725 | miRNA Mature ID | miR-4725-3p | ||
|
miRNA Sequence |
UGGGGAAGGCGUCAGUGUCGGG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 125 |
miR-4728 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4728 | miRNA Mature ID | miR-4728-5p | ||
|
miRNA Sequence |
UGGGAGGGGAGAGGCAGCAAGCA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 126 |
miR-4734 directly targets SLC7A5 | [ 23 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4734 | miRNA Mature ID | miR-4734 | ||
|
miRNA Sequence |
GCUGCGGGCUGCGGUCAGGGCG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 127 |
miR-4745 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4745 | miRNA Mature ID | miR-4745-5p | ||
|
miRNA Sequence |
UGAGUGGGGCUCCCGGGACGGCG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 128 |
miR-4747 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4747 | miRNA Mature ID | miR-4747-5p | ||
|
miRNA Sequence |
AGGGAAGGAGGCUUGGUCUUAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 129 |
miR-4749 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4749 | miRNA Mature ID | miR-4749-5p | ||
|
miRNA Sequence |
UGCGGGGACAGGCCAGGGCAUC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 130 |
miR-4755 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4755 | miRNA Mature ID | miR-4755-3p | ||
|
miRNA Sequence |
AGCCAGGCUCUGAAGGGAAAGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 131 |
miR-4779 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4779 | miRNA Mature ID | miR-4779 | ||
|
miRNA Sequence |
UAGGAGGGAAUAGUAAAAGCAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 132 |
miR-4781 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4781 | miRNA Mature ID | miR-4781-5p | ||
|
miRNA Sequence |
UAGCGGGGAUUCCAAUAUUGG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 133 |
miR-4796 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4796 | miRNA Mature ID | miR-4796-3p | ||
|
miRNA Sequence |
UAAAGUGGCAGAGUAUAGACAC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 134 |
miR-4797 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4797 | miRNA Mature ID | miR-4797-5p | ||
|
miRNA Sequence |
GACAGAGUGCCACUUACUGAA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 135 |
miR-484 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-484 | miRNA Mature ID | miR-484 | ||
|
miRNA Sequence |
UCAGGCUCAGUCCCCUCCCGAU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 136 |
miR-485 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-485 | miRNA Mature ID | miR-485-5p | ||
|
miRNA Sequence |
AGAGGCUGGCCGUGAUGAAUUC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 137 |
miR-493 directly targets SLC7A5 | [ 26 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-493 | miRNA Mature ID | miR-493-3p | ||
|
miRNA Sequence |
UGAAGGUCUACUGUGUGCCAGG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon 138 |
miR-5000 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-5000 | miRNA Mature ID | miR-5000-3p | ||
|
miRNA Sequence |
UCAGGACACUUCUGAACUUGGA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 139 |
miR-5008 directly targets SLC7A5 | [ 23 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-5008 | miRNA Mature ID | miR-5008-5p | ||
|
miRNA Sequence |
UGAGGCCCUUGGGGCACAGUGG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 140 |
miR-504 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-504 | miRNA Mature ID | miR-504-3p | ||
|
miRNA Sequence |
GGGAGUGCAGGGCAGGGUUUC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 141 |
miR-513b directly targets SLC7A5 | [ 24 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-513b | miRNA Mature ID | miR-513b-3p | ||
|
miRNA Sequence |
AAAUGUCACCUUUUUGAGAGGA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 142 |
miR-5186 directly targets SLC7A5 | [ 22 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-5186 | miRNA Mature ID | miR-5186 | ||
|
miRNA Sequence |
AGAGAUUGGUAGAAAUCAGGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon 143 |
miR-5187 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-5187 | miRNA Mature ID | miR-5187-5p | ||
|
miRNA Sequence |
UGGGAUGAGGGAUUGAAGUGGA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 144 |
miR-5189 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-5189 | miRNA Mature ID | miR-5189-5p | ||
|
miRNA Sequence |
UCUGGGCACAGGCGGAUGGACAGG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 145 |
miR-5195 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-5195 | miRNA Mature ID | miR-5195-5p | ||
|
miRNA Sequence |
AACCCCUAAGGCAACUGGAUGG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 146 |
miR-5196 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-5196 | miRNA Mature ID | miR-5196-5p | ||
|
miRNA Sequence |
AGGGAAGGGGACGAGGGUUGGG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 147 |
miR-5197 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-5197 | miRNA Mature ID | miR-5197-3p | ||
|
miRNA Sequence |
AAGAAGAGACUGAGUCAUCGAAU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 148 |
miR-532 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-532 | miRNA Mature ID | miR-532-3p | ||
|
miRNA Sequence |
CCUCCCACACCCAAGGCUUGCA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 149 |
miR-542 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-542 | miRNA Mature ID | miR-542-3p | ||
|
miRNA Sequence |
UGUGACAGAUUGAUAACUGAAA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 150 |
miR-548ag directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-548ag | miRNA Mature ID | miR-548ag | ||
|
miRNA Sequence |
AAAGGUAAUUGUGGUUUCUGC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 151 |
miR-548ai directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-548ai | miRNA Mature ID | miR-548ai | ||
|
miRNA Sequence |
AAAGGUAAUUGCAGUUUUUCCC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 152 |
miR-548ba directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-548ba | miRNA Mature ID | miR-548ba | ||
|
miRNA Sequence |
AAAGGUAACUGUGAUUUUUGCU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 153 |
miR-548c directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-548c | miRNA Mature ID | miR-548c-3p | ||
|
miRNA Sequence |
CAAAAAUCUCAAUUACUUUUGC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 154 |
miR-548s directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-548s | miRNA Mature ID | miR-548s | ||
|
miRNA Sequence |
AUGGCCAAAACUGCAGUUAUUUU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 155 |
miR-551b directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-551b | miRNA Mature ID | miR-551b-5p | ||
|
miRNA Sequence |
GAAAUCAAGCGUGGGUGAGACC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 156 |
miR-5584 directly targets SLC7A5 | [ 23 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-5584 | miRNA Mature ID | miR-5584-5p | ||
|
miRNA Sequence |
CAGGGAAAUGGGAAGAACUAGA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 157 |
miR-5693 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-5693 | miRNA Mature ID | miR-5693 | ||
|
miRNA Sequence |
GCAGUGGCUCUGAAAUGAACUC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 158 |
miR-5698 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-5698 | miRNA Mature ID | miR-5698 | ||
|
miRNA Sequence |
UGGGGGAGUGCAGUGAUUGUGG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 159 |
miR-570 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-570 | miRNA Mature ID | miR-570-5p | ||
|
miRNA Sequence |
AAAGGUAAUUGCAGUUUUUCCC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 160 |
miR-5700 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-5700 | miRNA Mature ID | miR-5700 | ||
|
miRNA Sequence |
UAAUGCAUUAAAUUAUUGAAGG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 161 |
miR-5703 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-5703 | miRNA Mature ID | miR-5703 | ||
|
miRNA Sequence |
AGGAGAAGUCGGGAAGGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 162 |
miR-574 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-574 | miRNA Mature ID | miR-574-5p | ||
|
miRNA Sequence |
UGAGUGUGUGUGUGUGAGUGUGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 163 |
miR-586 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-586 | miRNA Mature ID | miR-586 | ||
|
miRNA Sequence |
UAUGCAUUGUAUUUUUAGGUCC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 164 |
miR-588 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-588 | miRNA Mature ID | miR-588 | ||
|
miRNA Sequence |
UUGGCCACAAUGGGUUAGAAC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 165 |
miR-598 directly targets SLC7A5 | [ 26 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-598 | miRNA Mature ID | miR-598-3p | ||
|
miRNA Sequence |
UACGUCAUCGUUGUCAUCGUCA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon 166 |
miR-604 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-604 | miRNA Mature ID | miR-604 | ||
|
miRNA Sequence |
AGGCUGCGGAAUUCAGGAC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 167 |
miR-6085 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6085 | miRNA Mature ID | miR-6085 | ||
|
miRNA Sequence |
AAGGGGCUGGGGGAGCACA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 168 |
miR-612 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-612 | miRNA Mature ID | miR-612 | ||
|
miRNA Sequence |
GCUGGGCAGGGCUUCUGAGCUCCUU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 169 |
miR-6127 directly targets SLC7A5 | [ 22 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6127 | miRNA Mature ID | miR-6127 | ||
|
miRNA Sequence |
UGAGGGAGUGGGUGGGAGG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon 170 |
miR-6129 directly targets SLC7A5 | [ 22 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6129 | miRNA Mature ID | miR-6129 | ||
|
miRNA Sequence |
UGAGGGAGUUGGGUGUAUA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon 171 |
miR-6130 directly targets SLC7A5 | [ 22 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6130 | miRNA Mature ID | miR-6130 | ||
|
miRNA Sequence |
UGAGGGAGUGGAUUGUAUG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon 172 |
miR-6133 directly targets SLC7A5 | [ 22 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6133 | miRNA Mature ID | miR-6133 | ||
|
miRNA Sequence |
UGAGGGAGGAGGUUGGGUA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon 173 |
miR-6165 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6165 | miRNA Mature ID | miR-6165 | ||
|
miRNA Sequence |
CAGCAGGAGGUGAGGGGAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 174 |
miR-619 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-619 | miRNA Mature ID | miR-619-5p | ||
|
miRNA Sequence |
GCUGGGAUUACAGGCAUGAGCC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 175 |
miR-625 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-625 | miRNA Mature ID | miR-625-5p | ||
|
miRNA Sequence |
AGGGGGAAAGUUCUAUAGUCC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 176 |
miR-631 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-631 | miRNA Mature ID | miR-631 | ||
|
miRNA Sequence |
AGACCUGGCCCAGACCUCAGC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 177 |
miR-647 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-647 | miRNA Mature ID | miR-647 | ||
|
miRNA Sequence |
GUGGCUGCACUCACUUCCUUC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 178 |
miR-6499 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6499 | miRNA Mature ID | miR-6499-3p | ||
|
miRNA Sequence |
AGCAGUGUUUGUUUUGCCCACA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 179 |
miR-650 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-650 | miRNA Mature ID | miR-650 | ||
|
miRNA Sequence |
AGGAGGCAGCGCUCUCAGGAC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 180 |
miR-6506 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6506 | miRNA Mature ID | miR-6506-5p | ||
|
miRNA Sequence |
ACUGGGAUGUCACUGAAUAUGGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 181 |
miR-6509 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6509 | miRNA Mature ID | miR-6509-3p | ||
|
miRNA Sequence |
UUCCACUGCCACUACCUAAUUU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 182 |
miR-6512 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6512 | miRNA Mature ID | miR-6512-3p | ||
|
miRNA Sequence |
UUCCAGCCCUUCUAAUGGUAGG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 183 |
miR-6515 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6515 | miRNA Mature ID | miR-6515-5p | ||
|
miRNA Sequence |
UUGGAGGGUGUGGAAGACAUC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 184 |
miR-658 directly targets SLC7A5 | [ 23 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-658 | miRNA Mature ID | miR-658 | ||
|
miRNA Sequence |
GGCGGAGGGAAGUAGGUCCGUUGGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 185 |
miR-663a directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-663a | miRNA Mature ID | miR-663a | ||
|
miRNA Sequence |
AGGCGGGGCGCCGCGGGACCGC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 186 |
miR-665 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-665 | miRNA Mature ID | miR-665 | ||
|
miRNA Sequence |
ACCAGGAGGCUGAGGCCCCU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 187 |
miR-671 directly targets SLC7A5 | [ 28 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | CLASH | ||
|
miRNA Stemloop ID |
miR-671 | miRNA Mature ID | miR-671-5p | ||
|
miRNA Sequence |
AGGAAGCCCUGGAGGGGCUGGAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon 188 |
miR-6720 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6720 | miRNA Mature ID | miR-6720-5p | ||
|
miRNA Sequence |
UUCCAGCCCUGGUAGGCGCCGCG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 189 |
miR-6721 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6721 | miRNA Mature ID | miR-6721-5p | ||
|
miRNA Sequence |
UGGGCAGGGGCUUAUUGUAGGAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 190 |
miR-6724 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6724 | miRNA Mature ID | miR-6724-5p | ||
|
miRNA Sequence |
CUGGGCCCGCGGCGGGCGUGGGG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 191 |
miR-6728 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6728 | miRNA Mature ID | miR-6728-5p | ||
|
miRNA Sequence |
UUGGGAUGGUAGGACCAGAGGGG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 192 |
miR-6731 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6731 | miRNA Mature ID | miR-6731-5p | ||
|
miRNA Sequence |
UGGGAGAGCAGGGUAUUGUGGA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 193 |
miR-6734 directly targets SLC7A5 | [ 22 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6734 | miRNA Mature ID | miR-6734-5p | ||
|
miRNA Sequence |
UUGAGGGGAGAAUGAGGUGGAGA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon 194 |
miR-6754 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6754 | miRNA Mature ID | miR-6754-5p | ||
|
miRNA Sequence |
CCAGGGAGGCUGGUUUGGAGGA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 195 |
miR-6755 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6755 | miRNA Mature ID | miR-6755-5p | ||
|
miRNA Sequence |
UAGGGUAGACACUGACAACGUU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 196 |
miR-6757 directly targets SLC7A5 | [ 22 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6757 | miRNA Mature ID | miR-6757-5p | ||
|
miRNA Sequence |
UAGGGAUGGGAGGCCAGGAUGA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon 197 |
miR-6760 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6760 | miRNA Mature ID | miR-6760-5p | ||
|
miRNA Sequence |
CAGGGAGAAGGUGGAAGUGCAGA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 198 |
miR-6762 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6762 | miRNA Mature ID | miR-6762-3p | ||
|
miRNA Sequence |
UGGCUGCUUCCCUUGGUCUCCAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 199 |
miR-6773 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6773 | miRNA Mature ID | miR-6773-5p | ||
|
miRNA Sequence |
UUGGGCCCAGGAGUAAACAGGAU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 200 |
miR-6777 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6777 | miRNA Mature ID | miR-6777-5p | ||
|
miRNA Sequence |
ACGGGGAGUCAGGCAGUGGUGGA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 201 |
miR-6778 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6778 | miRNA Mature ID | miR-6778-3p | ||
|
miRNA Sequence |
UGCCUCCCUGACAUUCCACAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 202 |
miR-6779 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6779 | miRNA Mature ID | miR-6779-5p | ||
|
miRNA Sequence |
CUGGGAGGGGCUGGGUUUGGC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 203 |
miR-6780a directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6780a | miRNA Mature ID | miR-6780a-5p | ||
|
miRNA Sequence |
UUGGGAGGGAAGACAGCUGGAGA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 204 |
miR-6781 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6781 | miRNA Mature ID | miR-6781-5p | ||
|
miRNA Sequence |
CGGGCCGGAGGUCAAGGGCGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 205 |
miR-6785 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6785 | miRNA Mature ID | miR-6785-5p | ||
|
miRNA Sequence |
UGGGAGGGCGUGGAUGAUGGUG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 206 |
miR-6786 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6786 | miRNA Mature ID | miR-6786-3p | ||
|
miRNA Sequence |
UGACGCCCCUUCUGAUUCUGCCU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 207 |
miR-6787 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6787 | miRNA Mature ID | miR-6787-5p | ||
|
miRNA Sequence |
UGGCGGGGGUAGAGCUGGCUGC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 208 |
miR-6791 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6791 | miRNA Mature ID | miR-6791-3p | ||
|
miRNA Sequence |
UGCCUCCUUGGUCUCCGGCAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 209 |
miR-6794 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6794 | miRNA Mature ID | miR-6794-5p | ||
|
miRNA Sequence |
CAGGGGGACUGGGGGUGAGC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 210 |
miR-6797 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6797 | miRNA Mature ID | miR-6797-5p | ||
|
miRNA Sequence |
AGGAGGGAAGGGGCUGAGAACAGGA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 211 |
miR-6799 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6799 | miRNA Mature ID | miR-6799-5p | ||
|
miRNA Sequence |
GGGGAGGUGUGCAGGGCUGG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 212 |
miR-6813 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6813 | miRNA Mature ID | miR-6813-5p | ||
|
miRNA Sequence |
CAGGGGCUGGGGUUUCAGGUUCU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 213 |
miR-6816 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6816 | miRNA Mature ID | miR-6816-5p | ||
|
miRNA Sequence |
UGGGGCGGGGCAGGUCCCUGC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 214 |
miR-6820 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6820 | miRNA Mature ID | miR-6820-5p | ||
|
miRNA Sequence |
UGCGGCAGAGCUGGGGUCA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 215 |
miR-6821 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6821 | miRNA Mature ID | miR-6821-5p | ||
|
miRNA Sequence |
GUGCGUGGUGGCUCGAGGCGGGG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 216 |
miR-6823 directly targets SLC7A5 | [ 24 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-6823 | miRNA Mature ID | miR-6823-5p | ||
|
miRNA Sequence |
UCAGGGUUGGUAGGGGUUGCU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 217 |
miR-6825 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6825 | miRNA Mature ID | miR-6825-5p | ||
|
miRNA Sequence |
UGGGGAGGUGUGGAGUCAGCAU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 218 |
miR-6828 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6828 | miRNA Mature ID | miR-6828-5p | ||
|
miRNA Sequence |
AGGAAGCAAGAGAACCCUGUGG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 219 |
miR-6829 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6829 | miRNA Mature ID | miR-6829-3p | ||
|
miRNA Sequence |
UGCCUCCUCCGUGGCCUCAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 220 |
miR-6829 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6829 | miRNA Mature ID | miR-6829-5p | ||
|
miRNA Sequence |
UGGGCUGCUGAGAAGGGGCA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 221 |
miR-6834 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6834 | miRNA Mature ID | miR-6834-5p | ||
|
miRNA Sequence |
GUGAGGGACUGGGAUUUGUGG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 222 |
miR-6836 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6836 | miRNA Mature ID | miR-6836-3p | ||
|
miRNA Sequence |
AUGCCUCCCCCGGCCCCGCAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 223 |
miR-6846 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6846 | miRNA Mature ID | miR-6846-3p | ||
|
miRNA Sequence |
UGACCCCUUCUGUCUCCCUAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 224 |
miR-6851 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6851 | miRNA Mature ID | miR-6851-5p | ||
|
miRNA Sequence |
AGGAGGUGGUACUAGGGGCCAGC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 225 |
miR-6853 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6853 | miRNA Mature ID | miR-6853-5p | ||
|
miRNA Sequence |
AGCGUGGGAUGUCCAUGAAGUCAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 226 |
miR-6854 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6854 | miRNA Mature ID | miR-6854-5p | ||
|
miRNA Sequence |
AAGCUCAGGUUUGAGAACUGCUGA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 227 |
miR-6860 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6860 | miRNA Mature ID | miR-6860 | ||
|
miRNA Sequence |
ACUGGGCAGGGCUGUGGUGAGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 228 |
miR-6870 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6870 | miRNA Mature ID | miR-6870-5p | ||
|
miRNA Sequence |
UGGGGGAGAUGGGGGUUGA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 229 |
miR-6875 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6875 | miRNA Mature ID | miR-6875-5p | ||
|
miRNA Sequence |
UGAGGGACCCAGGACAGGAGA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 230 |
miR-6876 directly targets SLC7A5 | [ 23 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6876 | miRNA Mature ID | miR-6876-5p | ||
|
miRNA Sequence |
CAGGAAGGAGACAGGCAGUUCA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 231 |
miR-6877 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6877 | miRNA Mature ID | miR-6877-5p | ||
|
miRNA Sequence |
AGGGCCGAAGGGUGGAAGCUGC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 232 |
miR-6882 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6882 | miRNA Mature ID | miR-6882-3p | ||
|
miRNA Sequence |
UGCUGCCUCUCCUCUUGCCUGCAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 233 |
miR-6883 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6883 | miRNA Mature ID | miR-6883-5p | ||
|
miRNA Sequence |
AGGGAGGGUGUGGUAUGGAUGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 234 |
miR-6884 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6884 | miRNA Mature ID | miR-6884-5p | ||
|
miRNA Sequence |
AGAGGCUGAGAAGGUGAUGUUG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 235 |
miR-6889 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6889 | miRNA Mature ID | miR-6889-5p | ||
|
miRNA Sequence |
UCGGGGAGUCUGGGGUCCGGAAU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 236 |
miR-6890 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6890 | miRNA Mature ID | miR-6890-3p | ||
|
miRNA Sequence |
CCACUGCCUAUGCCCCACAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 237 |
miR-6891 directly targets SLC7A5 | [ 23 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6891 | miRNA Mature ID | miR-6891-5p | ||
|
miRNA Sequence |
UAAGGAGGGGGAUGAGGGG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 238 |
miR-708 directly targets SLC7A5 | [ 23 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-708 | miRNA Mature ID | miR-708-5p | ||
|
miRNA Sequence |
AAGGAGCUUACAAUCUAGCUGGG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 239 |
miR-7106 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-7106 | miRNA Mature ID | miR-7106-5p | ||
|
miRNA Sequence |
UGGGAGGAGGGGAUCUUGGG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 240 |
miR-7111 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-7111 | miRNA Mature ID | miR-7111-5p | ||
|
miRNA Sequence |
UGGGGGAGGAAGGACAGGCCAU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 241 |
miR-7155 directly targets SLC7A5 | [ 23 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-7155 | miRNA Mature ID | miR-7155-3p | ||
|
miRNA Sequence |
UGGCCCAAGACCUCAGACC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 242 |
miR-7160 directly targets SLC7A5 | [ 23 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-7160 | miRNA Mature ID | miR-7160-3p | ||
|
miRNA Sequence |
CAGGGCCCUGGCUUUAGCAGA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 243 |
miR-7160 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-7160 | miRNA Mature ID | miR-7160-5p | ||
|
miRNA Sequence |
UGCUGAGGUCCGGGCUGUGCC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 244 |
miR-7515 directly targets SLC7A5 | [ 23 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-7515 | miRNA Mature ID | miR-7515 | ||
|
miRNA Sequence |
AGAAGGGAAGAUGGUGAC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 245 |
miR-761 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-761 | miRNA Mature ID | miR-761 | ||
|
miRNA Sequence |
GCAGCAGGGUGAAACUGACACA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 246 |
miR-765 directly targets SLC7A5 | [ 23 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-765 | miRNA Mature ID | miR-765 | ||
|
miRNA Sequence |
UGGAGGAGAAGGAAGGUGAUG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 247 |
miR-769 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-769 | miRNA Mature ID | miR-769-5p | ||
|
miRNA Sequence |
UGAGACCUCUGGGUUCUGAGCU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 248 |
miR-7847 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-7847 | miRNA Mature ID | miR-7847-3p | ||
|
miRNA Sequence |
CGUGGAGGACGAGGAGGAGGC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 249 |
miR-7851 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-7851 | miRNA Mature ID | miR-7851-3p | ||
|
miRNA Sequence |
UACCUGGGAGACUGAGGUUGGA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 250 |
miR-7977 directly targets SLC7A5 | [ 26 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-7977 | miRNA Mature ID | miR-7977 | ||
|
miRNA Sequence |
UUCCCAGCCAACGCACCA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon 251 |
miR-8052 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-8052 | miRNA Mature ID | miR-8052 | ||
|
miRNA Sequence |
CGGGACUGUAGAGGGCAUGAGC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 252 |
miR-8059 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-8059 | miRNA Mature ID | miR-8059 | ||
|
miRNA Sequence |
GGGGAACUGUAGAUGAAAAGGC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 253 |
miR-8085 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-8085 | miRNA Mature ID | miR-8085 | ||
|
miRNA Sequence |
UGGGAGAGAGGACUGUGAGGC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 254 |
miR-873 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-873 | miRNA Mature ID | miR-873-5p | ||
|
miRNA Sequence |
GCAGGAACUUGUGAGUCUCCU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 255 |
miR-92b directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-92b | miRNA Mature ID | miR-92b-5p | ||
|
miRNA Sequence |
AGGGACGGGACGCGGUGCAGUG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 256 |
miR-9500 directly targets SLC7A5 | [ 23 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-9500 | miRNA Mature ID | miR-9500 | ||
|
miRNA Sequence |
AAGGGAAGAUGGUGACCAC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.