Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID DTD0479 Transporter Info
Gene Name SLC8A3
Transporter Name Sodium/calcium exchanger 3
Gene ID
6547
UniProt ID
P57103
Epigenetic Regulations of This DT (EGR)

microRNA

  Unclear Phenotype

          13 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 miR-186 directly targets SLC8A3 [ 1 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-186 miRNA Mature ID miR-186-3p

miRNA Sequence

 GCCCAAAGGUGAAUUUUUUGGG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 2

 miR-221 directly targets SLC8A3 [ 2 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-221 miRNA Mature ID miR-221-5p

miRNA Sequence

 ACCUGGCAUACAAUGUAGAUUU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 3

 miR-298 directly targets SLC8A3 [ 1 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-298 miRNA Mature ID miR-298

miRNA Sequence

 AGCAGAAGCAGGGAGGUUCUCCCA

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 4

 miR-4257 directly targets SLC8A3 [ 1 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4257 miRNA Mature ID miR-4257

miRNA Sequence

 CCAGAGGUGGGGACUGAG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 5

 miR-5000 directly targets SLC8A3 [ 1 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-5000 miRNA Mature ID miR-5000-5p

miRNA Sequence

 CAGUUCAGAAGUGUUCCUGAGU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 6

 miR-5008 directly targets SLC8A3 [ 1 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-5008 miRNA Mature ID miR-5008-5p

miRNA Sequence

 UGAGGCCCUUGGGGCACAGUGG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 7

 miR-5699 directly targets SLC8A3 [ 1 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-5699 miRNA Mature ID miR-5699-5p

miRNA Sequence

 UGCCCCAACAAGGAAGGACAAG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 8

 miR-6769a directly targets SLC8A3 [ 1 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6769a miRNA Mature ID miR-6769a-3p

miRNA Sequence

 GAGCCCCUCUCUGCUCUCCAG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 9

 miR-6847 directly targets SLC8A3 [ 1 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6847 miRNA Mature ID miR-6847-5p

miRNA Sequence

 ACAGAGGACAGUGGAGUGUGAGC

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 10

 miR-6868 directly targets SLC8A3 [ 1 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6868 miRNA Mature ID miR-6868-5p

miRNA Sequence

 ACUGGCAGAACACUGAAGCAGC

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 11

 miR-759 directly targets SLC8A3 [ 1 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-759 miRNA Mature ID miR-759

miRNA Sequence

 GCAGAGUGCAAACAAUUUUGAC

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 12

 miR-8073 directly targets SLC8A3 [ 2 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-8073 miRNA Mature ID miR-8073

miRNA Sequence

 ACCUGGCAGCAGGGAGCGUCGU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 13

 miR-874 directly targets SLC8A3 [ 1 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-874 miRNA Mature ID miR-874-5p

miRNA Sequence

 CGGCCCCACGCACCAGGGUAAGA

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

Methylation

  Multilayered rosettes embryonal tumour

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Moderate hypomethylation of SLC8A3 in multilayered rosettes embryonal tumour than that in healthy individual

Studied Phenotype

 Multilayered rosettes embryonal tumour [ICD-11:2A00.1]

The Methylation Level of Disease Section Compare with the Healthy Individual

 p-value: 1.16E-13; Fold-change: -0.290520212; Z-score: -20.30250058
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue
Download DT methylation data in the tissue of healthy individual
References
1 Transcriptome-wide identification of RNA-binding protein and microRNA target sites by PAR-CLIP. Cell. 2010 Apr 2;141(1):129-41.
2 Genome-wide identification of microRNA targets in human ES cells reveals a role for miR-302 in modulating BMP response. Genes Dev. 2011 Oct 15;25(20):2173-86.

If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.