Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID DTD0489 Transporter Info
Gene Name SLC9A5
Transporter Name Sodium/hydrogen exchanger 5
Gene ID
6553
UniProt ID
Q14940
Epigenetic Regulations of This DT (EGR)

Methylation

  Colon cancer

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC9A5 in colon adenocarcinoma [ 1 ]

Location

 TSS1500 (cg14439761)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.98E+00 Statistic Test p-value: 8.43E-08; Z-score: 2.66E+00

Methylation in Case

 5.36E-01 (Median) Methylation in Control 2.71E-01 (Median)

Studied Phenotype

 Colon cancer [ ICD-11: 2B90]

Experimental Material

 Patient tissue samples

  Pancretic ductal adenocarcinoma

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC9A5 in pancretic ductal adenocarcinoma [ 2 ]

Location

 TSS200 (cg01233487)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.19E+00 Statistic Test p-value: 7.49E-06; Z-score: -1.20E+00

Methylation in Case

 4.92E-01 (Median) Methylation in Control 5.85E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC9A5 in pancretic ductal adenocarcinoma [ 2 ]

Location

 Body (cg26877715)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 3.78E+00 Statistic Test p-value: 5.49E-45; Z-score: 1.54E+01

Methylation in Case

 3.32E-01 (Median) Methylation in Control 8.78E-02 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Breast cancer

            3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC9A5 in breast cancer [ 3 ]

Location

 1stExon (cg23357854)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.17E+00 Statistic Test p-value: 3.17E-04; Z-score: 9.44E-01

Methylation in Case

 1.09E-01 (Median) Methylation in Control 9.37E-02 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC9A5 in breast cancer [ 3 ]

Location

 Body (cg08638180)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.42E+00 Statistic Test p-value: 6.29E-17; Z-score: 3.98E+00

Methylation in Case

 5.10E-01 (Median) Methylation in Control 3.59E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC9A5 in breast cancer [ 3 ]

Location

 Body (cg10503473)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.02E+00 Statistic Test p-value: 6.15E-08; Z-score: -1.86E+00

Methylation in Case

 9.45E-01 (Median) Methylation in Control 9.68E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Colorectal cancer

            6 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC9A5 in colorectal cancer [ 4 ]

Location

 1stExon (cg23357854)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.19E+00 Statistic Test p-value: 5.90E-05; Z-score: 1.12E+00

Methylation in Case

 1.49E-01 (Median) Methylation in Control 1.26E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC9A5 in colorectal cancer [ 4 ]

Location

 Body (cg05256656)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.01E+00 Statistic Test p-value: 2.73E-06; Z-score: -1.02E+00

Methylation in Case

 9.12E-01 (Median) Methylation in Control 9.22E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC9A5 in colorectal cancer [ 4 ]

Location

 Body (cg09407223)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.24E+00 Statistic Test p-value: 1.17E-05; Z-score: -1.35E+00

Methylation in Case

 5.30E-01 (Median) Methylation in Control 6.59E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC9A5 in colorectal cancer [ 4 ]

Location

 Body (cg08638180)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.11E+00 Statistic Test p-value: 2.05E-05; Z-score: 1.04E+00

Methylation in Case

 6.95E-01 (Median) Methylation in Control 6.24E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC9A5 in colorectal cancer [ 4 ]

Location

 Body (cg10503473)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.00E+00 Statistic Test p-value: 6.36E-03; Z-score: -1.95E-01

Methylation in Case

 9.64E-01 (Median) Methylation in Control 9.65E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLC9A5 in colorectal cancer [ 4 ]

Location

 3'UTR (cg06566678)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.01E+00 Statistic Test p-value: 3.38E-04; Z-score: -7.10E-01

Methylation in Case

 9.05E-01 (Median) Methylation in Control 9.12E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Hepatocellular carcinoma

            9 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC9A5 in hepatocellular carcinoma [ 5 ]

Location

 1stExon (cg23357854)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.39E+00 Statistic Test p-value: 5.50E-06; Z-score: 1.62E+00

Methylation in Case

 1.75E-01 (Median) Methylation in Control 1.26E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC9A5 in hepatocellular carcinoma [ 5 ]

Location

 1stExon (cg08025511)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.14E+00 Statistic Test p-value: 1.40E-04; Z-score: 8.85E-01

Methylation in Case

 8.16E-02 (Median) Methylation in Control 7.14E-02 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC9A5 in hepatocellular carcinoma [ 5 ]

Location

 Body (cg04218022)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.59E+00 Statistic Test p-value: 2.26E-18; Z-score: -4.74E+00

Methylation in Case

 4.55E-01 (Median) Methylation in Control 7.24E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC9A5 in hepatocellular carcinoma [ 5 ]

Location

 Body (cg05256656)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.12E+00 Statistic Test p-value: 2.05E-09; Z-score: -2.20E+00

Methylation in Case

 7.03E-01 (Median) Methylation in Control 7.87E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC9A5 in hepatocellular carcinoma [ 5 ]

Location

 Body (cg08878263)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.43E+00 Statistic Test p-value: 2.93E-09; Z-score: -2.06E+00

Methylation in Case

 4.22E-01 (Median) Methylation in Control 6.02E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLC9A5 in hepatocellular carcinoma [ 5 ]

Location

 Body (cg09407223)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.19E+00 Statistic Test p-value: 2.79E-08; Z-score: -1.78E+00

Methylation in Case

 5.70E-01 (Median) Methylation in Control 6.79E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 7

 Methylation of SLC9A5 in hepatocellular carcinoma [ 5 ]

Location

 Body (cg07983330)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.04E+00 Statistic Test p-value: 3.32E-06; Z-score: -6.32E-01

Methylation in Case

 8.01E-01 (Median) Methylation in Control 8.36E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 8

 Methylation of SLC9A5 in hepatocellular carcinoma [ 5 ]

Location

 Body (cg08638180)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.10E+00 Statistic Test p-value: 9.16E-03; Z-score: 8.53E-01

Methylation in Case

 4.53E-01 (Median) Methylation in Control 4.13E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 9

 Methylation of SLC9A5 in hepatocellular carcinoma [ 5 ]

Location

 3'UTR (cg06566678)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.07E+00 Statistic Test p-value: 6.03E-08; Z-score: -1.72E+00

Methylation in Case

 8.03E-01 (Median) Methylation in Control 8.58E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Papillary thyroid cancer

            5 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC9A5 in papillary thyroid cancer [ 6 ]

Location

 1stExon (cg23357854)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.12E+00 Statistic Test p-value: 6.58E-04; Z-score: -7.99E-01

Methylation in Case

 9.08E-02 (Median) Methylation in Control 1.02E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC9A5 in papillary thyroid cancer [ 6 ]

Location

 Body (cg09407223)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.15E+00 Statistic Test p-value: 2.22E-11; Z-score: -2.36E+00

Methylation in Case

 4.59E-01 (Median) Methylation in Control 5.30E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC9A5 in papillary thyroid cancer [ 6 ]

Location

 Body (cg08638180)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.07E+00 Statistic Test p-value: 2.14E-03; Z-score: 3.98E-01

Methylation in Case

 3.48E-01 (Median) Methylation in Control 3.24E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC9A5 in papillary thyroid cancer [ 6 ]

Location

 Body (cg05256656)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.02E+00 Statistic Test p-value: 7.39E-03; Z-score: -7.77E-01

Methylation in Case

 8.48E-01 (Median) Methylation in Control 8.66E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC9A5 in papillary thyroid cancer [ 6 ]

Location

 3'UTR (cg06566678)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.03E+00 Statistic Test p-value: 3.18E-06; Z-score: 1.09E+00

Methylation in Case

 9.29E-01 (Median) Methylation in Control 9.01E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Bladder cancer

            7 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC9A5 in bladder cancer [ 7 ]

Location

 Body (cg09407223)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -2.05E+00 Statistic Test p-value: 4.03E-08; Z-score: -8.06E+00

Methylation in Case

 3.15E-01 (Median) Methylation in Control 6.46E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC9A5 in bladder cancer [ 7 ]

Location

 Body (cg08878263)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -2.00E+00 Statistic Test p-value: 1.08E-07; Z-score: -6.98E+00

Methylation in Case

 3.16E-01 (Median) Methylation in Control 6.31E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC9A5 in bladder cancer [ 7 ]

Location

 Body (cg05256656)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.23E+00 Statistic Test p-value: 2.91E-07; Z-score: -1.23E+01

Methylation in Case

 6.31E-01 (Median) Methylation in Control 7.77E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC9A5 in bladder cancer [ 7 ]

Location

 Body (cg10503473)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.11E+00 Statistic Test p-value: 2.34E-05; Z-score: -1.48E+01

Methylation in Case

 8.67E-01 (Median) Methylation in Control 9.61E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC9A5 in bladder cancer [ 7 ]

Location

 Body (cg07983330)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.10E+00 Statistic Test p-value: 9.55E-05; Z-score: -4.06E+00

Methylation in Case

 7.90E-01 (Median) Methylation in Control 8.69E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLC9A5 in bladder cancer [ 7 ]

Location

 Body (cg08638180)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.17E+00 Statistic Test p-value: 2.33E-02; Z-score: 1.89E+00

Methylation in Case

 3.72E-01 (Median) Methylation in Control 3.19E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 7

 Methylation of SLC9A5 in bladder cancer [ 7 ]

Location

 3'UTR (cg06566678)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.15E+00 Statistic Test p-value: 3.97E-05; Z-score: -1.05E+01

Methylation in Case

 6.75E-01 (Median) Methylation in Control 7.73E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Renal cell carcinoma

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC9A5 in clear cell renal cell carcinoma [ 8 ]

Location

 Body (cg08638180)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.44E+00 Statistic Test p-value: 1.78E-09; Z-score: 3.56E+00

Methylation in Case

 5.26E-01 (Median) Methylation in Control 3.65E-01 (Median)

Studied Phenotype

 Renal cell carcinoma [ ICD-11: 2C90]

Experimental Material

 Patient tissue samples

  Lung adenocarcinoma

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC9A5 in lung adenocarcinoma [ 9 ]

Location

 Body (cg08638180)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.16E+00 Statistic Test p-value: 3.91E-03; Z-score: 2.23E+00

Methylation in Case

 5.89E-01 (Median) Methylation in Control 5.07E-01 (Median)

Studied Phenotype

 Lung adenocarcinoma [ ICD-11: 2C25.0]

Experimental Material

 Patient tissue samples

  Prostate cancer

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC9A5 in prostate cancer [ 10 ]

Location

 Body (cg02996583)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.09E+00 Statistic Test p-value: 6.42E-03; Z-score: 2.77E+00

Methylation in Case

 8.86E-01 (Median) Methylation in Control 8.16E-01 (Median)

Studied Phenotype

 Prostate cancer [ ICD-11: 2C82]

Experimental Material

 Patient tissue samples

microRNA

  Unclear Phenotype

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 miR-192 directly targets SLC9A5 [ 11 ]

Epigenetic Type

 microRNA Experiment Method Microarray

miRNA Stemloop ID

 miR-192 miRNA Mature ID miR-192-5p

miRNA Sequence

 CUGACCUAUGAAUUGACAGCC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human
References
1 Genome-scale analysis of DNA methylation in colorectal cancer using Infinium HumanMethylation450 BeadChips. Epigenetics. 2013 Sep;8(9):921-34.
2 Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
3 Genome-wide Scan for Methylation Profiles in Breast Cancer
4 Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
5 Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
6 Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
7 DNA Methylation Dynamics in Urological Tumors.
8 A CpG-methylation-based assay to predict survival in clear cell renal cell carcinoma. Nat Commun. 2015 Oct 30;6:8699.
9 DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
10 Reducing the risk of false discovery enabling identification of biologically significant genome-wide methylation status using the HumanMethylation450 array. BMC Genomics. 2014 Jan 22;15:51.
11 Coordinated regulation of cell cycle transcripts by p53-Inducible microRNAs, miR-192 and miR-215. Cancer Res. 2008 Dec 15;68(24):10105-12.

If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.