Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID DTD0494 Transporter Info
Gene Name SLC9A9
Transporter Name Sodium/hydrogen exchanger 9
Gene ID
285195
UniProt ID
Q8IVB4
Epigenetic Regulations of This DT (EGR)

Methylation

  Pancretic ductal adenocarcinoma

          13 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC9A9 in pancretic ductal adenocarcinoma [ 1 ]

Location

 5'UTR (cg04897230)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.02E+00 Statistic Test p-value: 6.37E-08; Z-score: -8.26E-01

Methylation in Case

 8.36E-01 (Median) Methylation in Control 8.55E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC9A9 in pancretic ductal adenocarcinoma [ 1 ]

Location

 TSS1500 (cg00044871)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.23E+00 Statistic Test p-value: 4.05E-13; Z-score: 1.85E+00

Methylation in Case

 4.62E-01 (Median) Methylation in Control 3.76E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC9A9 in pancretic ductal adenocarcinoma [ 1 ]

Location

 TSS1500 (cg00605982)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.68E+00 Statistic Test p-value: 5.22E-12; Z-score: 2.01E+00

Methylation in Case

 3.51E-01 (Median) Methylation in Control 2.09E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC9A9 in pancretic ductal adenocarcinoma [ 1 ]

Location

 TSS1500 (cg03506489)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.79E+00 Statistic Test p-value: 2.79E-07; Z-score: 1.51E+00

Methylation in Case

 3.80E-01 (Median) Methylation in Control 2.12E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC9A9 in pancretic ductal adenocarcinoma [ 1 ]

Location

 TSS200 (cg07493760)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.12E+00 Statistic Test p-value: 3.67E-15; Z-score: -2.49E+00

Methylation in Case

 6.07E-01 (Median) Methylation in Control 6.78E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLC9A9 in pancretic ductal adenocarcinoma [ 1 ]

Location

 TSS200 (cg07033372)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 5.27E+00 Statistic Test p-value: 8.27E-14; Z-score: 2.92E+00

Methylation in Case

 4.00E-01 (Median) Methylation in Control 7.60E-02 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 7

 Methylation of SLC9A9 in pancretic ductal adenocarcinoma [ 1 ]

Location

 1stExon (cg06987672)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.43E+00 Statistic Test p-value: 1.14E-10; Z-score: 1.50E+00

Methylation in Case

 2.56E-01 (Median) Methylation in Control 1.79E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 8

 Methylation of SLC9A9 in pancretic ductal adenocarcinoma [ 1 ]

Location

 Body (cg13661968)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.53E+00 Statistic Test p-value: 3.23E-13; Z-score: 2.69E+00

Methylation in Case

 3.00E-01 (Median) Methylation in Control 1.97E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 9

 Methylation of SLC9A9 in pancretic ductal adenocarcinoma [ 1 ]

Location

 Body (cg22398359)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.07E+00 Statistic Test p-value: 3.00E-08; Z-score: 1.43E+00

Methylation in Case

 8.66E-01 (Median) Methylation in Control 8.07E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 10

 Methylation of SLC9A9 in pancretic ductal adenocarcinoma [ 1 ]

Location

 Body (cg16535035)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.04E+00 Statistic Test p-value: 7.47E-05; Z-score: 1.20E+00

Methylation in Case

 8.11E-01 (Median) Methylation in Control 7.77E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 11

 Methylation of SLC9A9 in pancretic ductal adenocarcinoma [ 1 ]

Location

 Body (cg02079348)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.06E+00 Statistic Test p-value: 2.31E-02; Z-score: -7.60E-01

Methylation in Case

 6.91E-01 (Median) Methylation in Control 7.34E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 12

 Methylation of SLC9A9 in pancretic ductal adenocarcinoma [ 1 ]

Location

 3'UTR (cg15841533)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.05E+00 Statistic Test p-value: 1.41E-03; Z-score: 6.14E-01

Methylation in Case

 7.94E-01 (Median) Methylation in Control 7.60E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 13

 Methylation of SLC9A9 in pancretic ductal adenocarcinoma [ 1 ]

Location

 3'UTR (cg12562245)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.00E+00 Statistic Test p-value: 2.63E-02; Z-score: 3.55E-02

Methylation in Case

 7.76E-01 (Median) Methylation in Control 7.75E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Bladder cancer

          17 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC9A9 in bladder cancer [ 2 ]

Location

 TSS200 (cg15360181)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.66E+00 Statistic Test p-value: 1.74E-02; Z-score: -1.78E+00

Methylation in Case

 8.28E-02 (Median) Methylation in Control 1.38E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC9A9 in bladder cancer [ 2 ]

Location

 Body (cg18151422)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -2.78E+00 Statistic Test p-value: 6.94E-12; Z-score: -1.10E+01

Methylation in Case

 2.54E-01 (Median) Methylation in Control 7.08E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC9A9 in bladder cancer [ 2 ]

Location

 Body (cg04860674)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -2.58E+00 Statistic Test p-value: 2.68E-11; Z-score: -1.96E+01

Methylation in Case

 3.18E-01 (Median) Methylation in Control 8.20E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC9A9 in bladder cancer [ 2 ]

Location

 Body (cg02501410)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.55E+00 Statistic Test p-value: 1.52E-10; Z-score: 8.73E+00

Methylation in Case

 7.16E-01 (Median) Methylation in Control 4.63E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC9A9 in bladder cancer [ 2 ]

Location

 Body (cg04558907)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -2.07E+00 Statistic Test p-value: 5.46E-08; Z-score: -1.23E+01

Methylation in Case

 4.25E-01 (Median) Methylation in Control 8.80E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLC9A9 in bladder cancer [ 2 ]

Location

 Body (cg26226555)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -7.18E+00 Statistic Test p-value: 2.10E-05; Z-score: -6.53E+00

Methylation in Case

 4.20E-02 (Median) Methylation in Control 3.01E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 7

 Methylation of SLC9A9 in bladder cancer [ 2 ]

Location

 Body (cg04070804)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.09E+00 Statistic Test p-value: 1.82E-04; Z-score: -5.03E+00

Methylation in Case

 8.14E-01 (Median) Methylation in Control 8.89E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 8

 Methylation of SLC9A9 in bladder cancer [ 2 ]

Location

 Body (cg25945642)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -2.18E+00 Statistic Test p-value: 3.19E-04; Z-score: -3.50E+00

Methylation in Case

 1.68E-01 (Median) Methylation in Control 3.68E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 9

 Methylation of SLC9A9 in bladder cancer [ 2 ]

Location

 Body (cg25453063)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.04E+00 Statistic Test p-value: 6.85E-04; Z-score: -7.33E+00

Methylation in Case

 8.33E-01 (Median) Methylation in Control 8.62E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 10

 Methylation of SLC9A9 in bladder cancer [ 2 ]

Location

 Body (cg21520462)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.04E+00 Statistic Test p-value: 1.47E-03; Z-score: -4.98E+00

Methylation in Case

 8.78E-01 (Median) Methylation in Control 9.16E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 11

 Methylation of SLC9A9 in bladder cancer [ 2 ]

Location

 Body (cg13408795)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.17E+00 Statistic Test p-value: 1.82E-03; Z-score: 2.86E+00

Methylation in Case

 7.62E-01 (Median) Methylation in Control 6.54E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 12

 Methylation of SLC9A9 in bladder cancer [ 2 ]

Location

 Body (cg15266604)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.07E+00 Statistic Test p-value: 2.11E-03; Z-score: -4.81E+00

Methylation in Case

 7.94E-01 (Median) Methylation in Control 8.48E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 13

 Methylation of SLC9A9 in bladder cancer [ 2 ]

Location

 Body (cg03804400)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.37E+00 Statistic Test p-value: 2.96E-03; Z-score: -5.16E+00

Methylation in Case

 3.72E-01 (Median) Methylation in Control 5.09E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 14

 Methylation of SLC9A9 in bladder cancer [ 2 ]

Location

 Body (cg14574489)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.34E+00 Statistic Test p-value: 1.84E-02; Z-score: -2.74E+00

Methylation in Case

 3.36E-01 (Median) Methylation in Control 4.51E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 15

 Methylation of SLC9A9 in bladder cancer [ 2 ]

Location

 Body (cg20925925)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.03E+00 Statistic Test p-value: 1.85E-02; Z-score: -2.08E+00

Methylation in Case

 8.42E-01 (Median) Methylation in Control 8.65E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 16

 Methylation of SLC9A9 in bladder cancer [ 2 ]

Location

 Body (cg19974216)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.01E+00 Statistic Test p-value: 1.90E-02; Z-score: -8.67E-01

Methylation in Case

 7.98E-01 (Median) Methylation in Control 8.09E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 17

 Methylation of SLC9A9 in bladder cancer [ 2 ]

Location

 Body (cg06145736)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.20E+00 Statistic Test p-value: 2.12E-02; Z-score: 2.13E+00

Methylation in Case

 7.20E-01 (Median) Methylation in Control 5.98E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Colorectal cancer

          15 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC9A9 in colorectal cancer [ 3 ]

Location

 TSS200 (cg15360181)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.70E+00 Statistic Test p-value: 1.80E-06; Z-score: -1.59E+00

Methylation in Case

 3.49E-01 (Median) Methylation in Control 5.94E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC9A9 in colorectal cancer [ 3 ]

Location

 Body (cg14574489)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.30E+00 Statistic Test p-value: 6.31E-15; Z-score: -3.46E+00

Methylation in Case

 6.37E-01 (Median) Methylation in Control 8.27E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC9A9 in colorectal cancer [ 3 ]

Location

 Body (cg21520462)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.09E+00 Statistic Test p-value: 7.22E-10; Z-score: -5.52E+00

Methylation in Case

 8.59E-01 (Median) Methylation in Control 9.35E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC9A9 in colorectal cancer [ 3 ]

Location

 Body (cg04860674)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.13E+00 Statistic Test p-value: 1.07E-08; Z-score: -2.26E+00

Methylation in Case

 8.23E-01 (Median) Methylation in Control 9.30E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC9A9 in colorectal cancer [ 3 ]

Location

 Body (cg13408795)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.11E+00 Statistic Test p-value: 6.73E-08; Z-score: -1.93E+00

Methylation in Case

 7.62E-01 (Median) Methylation in Control 8.46E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLC9A9 in colorectal cancer [ 3 ]

Location

 Body (cg25453063)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.04E+00 Statistic Test p-value: 8.24E-08; Z-score: -4.40E+00

Methylation in Case

 8.97E-01 (Median) Methylation in Control 9.33E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 7

 Methylation of SLC9A9 in colorectal cancer [ 3 ]

Location

 Body (cg04558907)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.05E+00 Statistic Test p-value: 8.94E-08; Z-score: -2.41E+00

Methylation in Case

 8.82E-01 (Median) Methylation in Control 9.28E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 8

 Methylation of SLC9A9 in colorectal cancer [ 3 ]

Location

 Body (cg06145736)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.14E+00 Statistic Test p-value: 5.38E-07; Z-score: -1.85E+00

Methylation in Case

 7.12E-01 (Median) Methylation in Control 8.10E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 9

 Methylation of SLC9A9 in colorectal cancer [ 3 ]

Location

 Body (cg25945642)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.19E+00 Statistic Test p-value: 2.18E-06; Z-score: -1.61E+00

Methylation in Case

 7.20E-01 (Median) Methylation in Control 8.56E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 10

 Methylation of SLC9A9 in colorectal cancer [ 3 ]

Location

 Body (cg15266604)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.02E+00 Statistic Test p-value: 2.94E-06; Z-score: -1.73E+00

Methylation in Case

 9.08E-01 (Median) Methylation in Control 9.25E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 11

 Methylation of SLC9A9 in colorectal cancer [ 3 ]

Location

 Body (cg08988364)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 2.41E+00 Statistic Test p-value: 5.91E-06; Z-score: 2.19E+00

Methylation in Case

 2.35E-01 (Median) Methylation in Control 9.76E-02 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 12

 Methylation of SLC9A9 in colorectal cancer [ 3 ]

Location

 Body (cg20925925)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.02E+00 Statistic Test p-value: 2.60E-05; Z-score: -2.97E+00

Methylation in Case

 9.20E-01 (Median) Methylation in Control 9.41E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 13

 Methylation of SLC9A9 in colorectal cancer [ 3 ]

Location

 Body (cg19974216)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.02E+00 Statistic Test p-value: 6.66E-05; Z-score: -1.69E+00

Methylation in Case

 8.94E-01 (Median) Methylation in Control 9.14E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 14

 Methylation of SLC9A9 in colorectal cancer [ 3 ]

Location

 Body (cg22288315)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.01E+00 Statistic Test p-value: 2.36E-03; Z-score: -5.66E-01

Methylation in Case

 9.13E-01 (Median) Methylation in Control 9.22E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 15

 Methylation of SLC9A9 in colorectal cancer [ 3 ]

Location

 Body (cg04070804)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.01E+00 Statistic Test p-value: 4.14E-02; Z-score: -3.01E-01

Methylation in Case

 9.37E-01 (Median) Methylation in Control 9.43E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Lung adenocarcinoma

            4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC9A9 in lung adenocarcinoma [ 4 ]

Location

 TSS200 (cg15360181)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.70E+00 Statistic Test p-value: 1.90E-05; Z-score: -3.32E+00

Methylation in Case

 2.39E-01 (Median) Methylation in Control 4.06E-01 (Median)

Studied Phenotype

 Lung adenocarcinoma [ ICD-11: 2C25.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC9A9 in lung adenocarcinoma [ 4 ]

Location

 Body (cg25945642)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.15E+00 Statistic Test p-value: 1.32E-03; Z-score: 1.64E+00

Methylation in Case

 5.40E-01 (Median) Methylation in Control 4.70E-01 (Median)

Studied Phenotype

 Lung adenocarcinoma [ ICD-11: 2C25.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC9A9 in lung adenocarcinoma [ 4 ]

Location

 Body (cg14574489)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.44E+00 Statistic Test p-value: 1.67E-03; Z-score: 2.52E+00

Methylation in Case

 4.54E-01 (Median) Methylation in Control 3.15E-01 (Median)

Studied Phenotype

 Lung adenocarcinoma [ ICD-11: 2C25.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC9A9 in lung adenocarcinoma [ 4 ]

Location

 Body (cg06145736)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.11E+00 Statistic Test p-value: 1.58E-02; Z-score: -1.16E+00

Methylation in Case

 6.60E-01 (Median) Methylation in Control 7.31E-01 (Median)

Studied Phenotype

 Lung adenocarcinoma [ ICD-11: 2C25.0]

Experimental Material

 Patient tissue samples

  Papillary thyroid cancer

          11 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC9A9 in papillary thyroid cancer [ 5 ]

Location

 TSS200 (cg15360181)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.24E+00 Statistic Test p-value: 4.71E-06; Z-score: -1.19E+00

Methylation in Case

 4.66E-01 (Median) Methylation in Control 5.79E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC9A9 in papillary thyroid cancer [ 5 ]

Location

 Body (cg18151422)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.17E+00 Statistic Test p-value: 1.47E-16; Z-score: -2.41E+00

Methylation in Case

 7.51E-01 (Median) Methylation in Control 8.81E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC9A9 in papillary thyroid cancer [ 5 ]

Location

 Body (cg26226555)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -3.24E+00 Statistic Test p-value: 1.82E-14; Z-score: -1.55E+00

Methylation in Case

 9.40E-02 (Median) Methylation in Control 3.04E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC9A9 in papillary thyroid cancer [ 5 ]

Location

 Body (cg02501410)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.27E+00 Statistic Test p-value: 1.43E-12; Z-score: -3.07E+00

Methylation in Case

 6.27E-01 (Median) Methylation in Control 7.98E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC9A9 in papillary thyroid cancer [ 5 ]

Location

 Body (cg21520462)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.01E+00 Statistic Test p-value: 9.88E-09; Z-score: -1.51E+00

Methylation in Case

 9.46E-01 (Median) Methylation in Control 9.60E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLC9A9 in papillary thyroid cancer [ 5 ]

Location

 Body (cg14574489)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.88E+00 Statistic Test p-value: 1.78E-07; Z-score: -1.93E+00

Methylation in Case

 1.58E-01 (Median) Methylation in Control 2.97E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 7

 Methylation of SLC9A9 in papillary thyroid cancer [ 5 ]

Location

 Body (cg06145736)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.30E+00 Statistic Test p-value: 3.86E-05; Z-score: 1.35E+00

Methylation in Case

 5.33E-01 (Median) Methylation in Control 4.09E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 8

 Methylation of SLC9A9 in papillary thyroid cancer [ 5 ]

Location

 Body (cg04558907)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.11E+00 Statistic Test p-value: 1.03E-03; Z-score: 2.03E+00

Methylation in Case

 8.96E-01 (Median) Methylation in Control 8.04E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 9

 Methylation of SLC9A9 in papillary thyroid cancer [ 5 ]

Location

 Body (cg19974216)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.01E+00 Statistic Test p-value: 1.14E-03; Z-score: -6.43E-01

Methylation in Case

 8.72E-01 (Median) Methylation in Control 8.82E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 10

 Methylation of SLC9A9 in papillary thyroid cancer [ 5 ]

Location

 Body (cg03804400)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.08E+00 Statistic Test p-value: 8.63E-03; Z-score: 7.65E-01

Methylation in Case

 6.34E-01 (Median) Methylation in Control 5.84E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 11

 Methylation of SLC9A9 in papillary thyroid cancer [ 5 ]

Location

 3'UTR (cg27402999)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.01E+00 Statistic Test p-value: 2.24E-03; Z-score: -6.18E-01

Methylation in Case

 9.20E-01 (Median) Methylation in Control 9.30E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Prostate cancer

            9 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC9A9 in prostate cancer [ 6 ]

Location

 TSS200 (cg17364114)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.87E+00 Statistic Test p-value: 3.22E-02; Z-score: -1.55E+00

Methylation in Case

 3.79E-02 (Median) Methylation in Control 7.07E-02 (Median)

Studied Phenotype

 Prostate cancer [ ICD-11: 2C82]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC9A9 in prostate cancer [ 6 ]

Location

 TSS200 (cg00289429)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 2.30E+00 Statistic Test p-value: 3.94E-02; Z-score: 5.84E+00

Methylation in Case

 2.15E-01 (Median) Methylation in Control 9.38E-02 (Median)

Studied Phenotype

 Prostate cancer [ ICD-11: 2C82]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC9A9 in prostate cancer [ 6 ]

Location

 Body (cg13512394)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.49E+00 Statistic Test p-value: 2.61E-02; Z-score: -1.80E+01

Methylation in Case

 5.07E-01 (Median) Methylation in Control 7.55E-01 (Median)

Studied Phenotype

 Prostate cancer [ ICD-11: 2C82]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC9A9 in prostate cancer [ 6 ]

Location

 Body (cg23691006)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.13E+00 Statistic Test p-value: 3.23E-02; Z-score: 1.32E+00

Methylation in Case

 8.37E-01 (Median) Methylation in Control 7.42E-01 (Median)

Studied Phenotype

 Prostate cancer [ ICD-11: 2C82]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC9A9 in prostate cancer [ 6 ]

Location

 Body (cg02555727)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.04E+00 Statistic Test p-value: 3.81E-02; Z-score: 1.69E+00

Methylation in Case

 9.10E-01 (Median) Methylation in Control 8.77E-01 (Median)

Studied Phenotype

 Prostate cancer [ ICD-11: 2C82]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLC9A9 in prostate cancer [ 6 ]

Location

 Body (cg16398133)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.24E+00 Statistic Test p-value: 4.09E-02; Z-score: 1.59E+00

Methylation in Case

 7.43E-01 (Median) Methylation in Control 6.00E-01 (Median)

Studied Phenotype

 Prostate cancer [ ICD-11: 2C82]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 7

 Methylation of SLC9A9 in prostate cancer [ 6 ]

Location

 Body (cg14918008)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.09E+00 Statistic Test p-value: 4.18E-02; Z-score: 1.60E+00

Methylation in Case

 8.62E-01 (Median) Methylation in Control 7.89E-01 (Median)

Studied Phenotype

 Prostate cancer [ ICD-11: 2C82]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 8

 Methylation of SLC9A9 in prostate cancer [ 6 ]

Location

 Body (cg05554939)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.07E+00 Statistic Test p-value: 4.33E-02; Z-score: 1.24E+00

Methylation in Case

 9.12E-01 (Median) Methylation in Control 8.55E-01 (Median)

Studied Phenotype

 Prostate cancer [ ICD-11: 2C82]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 9

 Methylation of SLC9A9 in prostate cancer [ 6 ]

Location

 3'UTR (cg05851505)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.07E+00 Statistic Test p-value: 2.10E-02; Z-score: 2.08E+00

Methylation in Case

 9.68E-01 (Median) Methylation in Control 9.04E-01 (Median)

Studied Phenotype

 Prostate cancer [ ICD-11: 2C82]

Experimental Material

 Patient tissue samples

  Breast cancer

          21 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC9A9 in breast cancer [ 7 ]

Location

 1stExon (cg23538718)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.41E+00 Statistic Test p-value: 2.33E-06; Z-score: 9.57E-01

Methylation in Case

 1.26E-01 (Median) Methylation in Control 8.99E-02 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC9A9 in breast cancer [ 7 ]

Location

 Body (cg04558907)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.11E+00 Statistic Test p-value: 4.47E-11; Z-score: -2.99E+00

Methylation in Case

 7.64E-01 (Median) Methylation in Control 8.47E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC9A9 in breast cancer [ 7 ]

Location

 Body (cg25453063)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.08E+00 Statistic Test p-value: 2.97E-10; Z-score: -3.24E+00

Methylation in Case

 7.98E-01 (Median) Methylation in Control 8.59E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC9A9 in breast cancer [ 7 ]

Location

 Body (cg21520462)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.06E+00 Statistic Test p-value: 1.97E-09; Z-score: -2.42E+00

Methylation in Case

 8.55E-01 (Median) Methylation in Control 9.04E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC9A9 in breast cancer [ 7 ]

Location

 Body (cg15266604)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.10E+00 Statistic Test p-value: 2.01E-09; Z-score: -1.95E+00

Methylation in Case

 7.47E-01 (Median) Methylation in Control 8.21E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLC9A9 in breast cancer [ 7 ]

Location

 Body (cg18151422)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.11E+00 Statistic Test p-value: 6.63E-09; Z-score: -1.43E+00

Methylation in Case

 7.20E-01 (Median) Methylation in Control 7.97E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 7

 Methylation of SLC9A9 in breast cancer [ 7 ]

Location

 Body (cg02501410)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.45E+00 Statistic Test p-value: 8.51E-09; Z-score: 2.30E+00

Methylation in Case

 6.23E-01 (Median) Methylation in Control 4.30E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 8

 Methylation of SLC9A9 in breast cancer [ 7 ]

Location

 Body (cg19974216)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.05E+00 Statistic Test p-value: 1.23E-08; Z-score: -1.81E+00

Methylation in Case

 7.67E-01 (Median) Methylation in Control 8.07E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 9

 Methylation of SLC9A9 in breast cancer [ 7 ]

Location

 Body (cg04860674)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.10E+00 Statistic Test p-value: 1.47E-08; Z-score: -1.54E+00

Methylation in Case

 7.93E-01 (Median) Methylation in Control 8.73E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 10

 Methylation of SLC9A9 in breast cancer [ 7 ]

Location

 Body (cg02317746)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.06E+00 Statistic Test p-value: 2.13E-08; Z-score: -1.15E+00

Methylation in Case

 8.48E-01 (Median) Methylation in Control 8.99E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 11

 Methylation of SLC9A9 in breast cancer [ 7 ]

Location

 Body (cg20925925)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.11E+00 Statistic Test p-value: 5.99E-07; Z-score: -1.65E+00

Methylation in Case

 7.96E-01 (Median) Methylation in Control 8.80E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 12

 Methylation of SLC9A9 in breast cancer [ 7 ]

Location

 Body (cg14574489)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.36E+00 Statistic Test p-value: 1.03E-06; Z-score: 1.43E+00

Methylation in Case

 3.83E-01 (Median) Methylation in Control 2.82E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 13

 Methylation of SLC9A9 in breast cancer [ 7 ]

Location

 Body (cg04070804)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.08E+00 Statistic Test p-value: 1.45E-06; Z-score: -1.29E+00

Methylation in Case

 8.15E-01 (Median) Methylation in Control 8.83E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 14

 Methylation of SLC9A9 in breast cancer [ 7 ]

Location

 Body (cg14497255)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.03E+00 Statistic Test p-value: 1.46E-06; Z-score: -8.25E-01

Methylation in Case

 8.74E-01 (Median) Methylation in Control 8.98E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 15

 Methylation of SLC9A9 in breast cancer [ 7 ]

Location

 Body (cg22288315)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.07E+00 Statistic Test p-value: 2.46E-05; Z-score: -8.51E-01

Methylation in Case

 8.06E-01 (Median) Methylation in Control 8.60E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 16

 Methylation of SLC9A9 in breast cancer [ 7 ]

Location

 Body (cg26226555)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -2.22E+00 Statistic Test p-value: 3.33E-05; Z-score: -1.09E+00

Methylation in Case

 7.41E-02 (Median) Methylation in Control 1.64E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 17

 Methylation of SLC9A9 in breast cancer [ 7 ]

Location

 Body (cg08988364)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.54E+00 Statistic Test p-value: 6.33E-05; Z-score: 8.18E-01

Methylation in Case

 2.26E-02 (Median) Methylation in Control 1.47E-02 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 18

 Methylation of SLC9A9 in breast cancer [ 7 ]

Location

 Body (cg08488058)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.05E+00 Statistic Test p-value: 1.13E-03; Z-score: -3.14E-01

Methylation in Case

 8.96E-01 (Median) Methylation in Control 9.43E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 19

 Methylation of SLC9A9 in breast cancer [ 7 ]

Location

 Body (cg25945642)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.26E+00 Statistic Test p-value: 7.46E-03; Z-score: 1.61E+00

Methylation in Case

 4.62E-01 (Median) Methylation in Control 3.67E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 20

 Methylation of SLC9A9 in breast cancer [ 7 ]

Location

 Body (cg03804400)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.12E+00 Statistic Test p-value: 4.72E-02; Z-score: 1.09E+00

Methylation in Case

 6.75E-01 (Median) Methylation in Control 6.04E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 21

 Methylation of SLC9A9 in breast cancer [ 7 ]

Location

 3'UTR (cg27402999)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.03E+00 Statistic Test p-value: 4.12E-06; Z-score: -6.56E-01

Methylation in Case

 8.51E-01 (Median) Methylation in Control 8.77E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Hepatocellular carcinoma

          10 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC9A9 in hepatocellular carcinoma [ 8 ]

Location

 1stExon (cg26513304)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -2.05E+00 Statistic Test p-value: 7.07E-24; Z-score: -5.27E+00

Methylation in Case

 3.10E-01 (Median) Methylation in Control 6.36E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC9A9 in hepatocellular carcinoma [ 8 ]

Location

 1stExon (cg23538718)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -2.11E+00 Statistic Test p-value: 5.21E-09; Z-score: -1.67E+00

Methylation in Case

 1.53E-01 (Median) Methylation in Control 3.23E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC9A9 in hepatocellular carcinoma [ 8 ]

Location

 Body (cg22032364)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.73E+00 Statistic Test p-value: 2.62E-22; Z-score: -3.82E+00

Methylation in Case

 3.27E-01 (Median) Methylation in Control 5.67E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC9A9 in hepatocellular carcinoma [ 8 ]

Location

 Body (cg22054793)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.33E+00 Statistic Test p-value: 1.06E-13; Z-score: -2.43E+00

Methylation in Case

 5.85E-01 (Median) Methylation in Control 7.77E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC9A9 in hepatocellular carcinoma [ 8 ]

Location

 Body (cg20925925)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.11E+00 Statistic Test p-value: 4.32E-09; Z-score: -3.20E+00

Methylation in Case

 7.79E-01 (Median) Methylation in Control 8.66E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLC9A9 in hepatocellular carcinoma [ 8 ]

Location

 Body (cg14497255)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.07E+00 Statistic Test p-value: 1.63E-07; Z-score: -9.75E-01

Methylation in Case

 8.13E-01 (Median) Methylation in Control 8.69E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 7

 Methylation of SLC9A9 in hepatocellular carcinoma [ 8 ]

Location

 Body (cg14574489)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.27E+00 Statistic Test p-value: 3.41E-06; Z-score: -1.58E+00

Methylation in Case

 3.89E-01 (Median) Methylation in Control 4.94E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 8

 Methylation of SLC9A9 in hepatocellular carcinoma [ 8 ]

Location

 Body (cg13408795)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.08E+00 Statistic Test p-value: 3.74E-04; Z-score: -1.06E+00

Methylation in Case

 5.67E-01 (Median) Methylation in Control 6.11E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 9

 Methylation of SLC9A9 in hepatocellular carcinoma [ 8 ]

Location

 Body (cg18151422)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.07E+00 Statistic Test p-value: 4.67E-03; Z-score: -6.00E-01

Methylation in Case

 5.47E-01 (Median) Methylation in Control 5.84E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 10

 Methylation of SLC9A9 in hepatocellular carcinoma [ 8 ]

Location

 3'UTR (cg27402999)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.06E+00 Statistic Test p-value: 8.66E-06; Z-score: -4.35E-01

Methylation in Case

 8.12E-01 (Median) Methylation in Control 8.63E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Panic disorder

            5 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC9A9 in panic disorder [ 9 ]

Location

 Body (cg25945642)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -3.56E-01 Statistic Test p-value: 1.93E-04; Z-score: -9.31E-01

Methylation in Case

 -8.85E-01 (Median) Methylation in Control -3.15E-01 (Median)

Studied Phenotype

 Panic disorder [ ICD-11: 6B01]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC9A9 in panic disorder [ 9 ]

Location

 Body (cg04558907)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.04E+00 Statistic Test p-value: 7.40E-03; Z-score: 5.23E-01

Methylation in Case

 3.44E+00 (Median) Methylation in Control 3.30E+00 (Median)

Studied Phenotype

 Panic disorder [ ICD-11: 6B01]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC9A9 in panic disorder [ 9 ]

Location

 Body (cg13408795)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -6.89E-01 Statistic Test p-value: 8.78E-03; Z-score: -4.65E-01

Methylation in Case

 -7.94E-01 (Median) Methylation in Control -5.47E-01 (Median)

Studied Phenotype

 Panic disorder [ ICD-11: 6B01]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC9A9 in panic disorder [ 9 ]

Location

 Body (cg04860674)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.13E+00 Statistic Test p-value: 1.41E-02; Z-score: 4.36E-01

Methylation in Case

 1.46E+00 (Median) Methylation in Control 1.29E+00 (Median)

Studied Phenotype

 Panic disorder [ ICD-11: 6B01]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC9A9 in panic disorder [ 9 ]

Location

 Body (cg21520462)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.06E+00 Statistic Test p-value: 3.79E-02; Z-score: 6.11E-01

Methylation in Case

 2.86E+00 (Median) Methylation in Control 2.70E+00 (Median)

Studied Phenotype

 Panic disorder [ ICD-11: 6B01]

Experimental Material

 Patient tissue samples

microRNA

  Unclear Phenotype

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 miR-124 directly targets SLC9A9 [ 10 ]

Epigenetic Type

 microRNA Experiment Method Microarray

miRNA Stemloop ID

 miR-124 miRNA Mature ID miR-124-3p

miRNA Sequence

 UAAGGCACGCGGUGAAUGCCAA

miRNA Target Type

 Direct

Experimental Material

 Human cervical cancer cell line (Hela)
References
1 Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
2 DNA Methylation Dynamics in Urological Tumors.
3 Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
4 DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
5 Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
6 Reducing the risk of false discovery enabling identification of biologically significant genome-wide methylation status using the HumanMethylation450 array. BMC Genomics. 2014 Jan 22;15:51.
7 Genome-wide Scan for Methylation Profiles in Breast Cancer
8 Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
9 DNA Methylation signatures in panic disorder. Transl Psychiatry. 2017 Dec 18;7(12):1287.
10 The impact of microRNAs on protein output. Nature. 2008 Sep 4;455(7209):64-71.

If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.