Detail Information of Epigenetic Regulations
| General Information of Drug Transporter (DT) | |||||
|---|---|---|---|---|---|
| DT ID | DTD0504 Transporter Info | ||||
| Gene Name | SLCO5A1 | ||||
| Transporter Name | Organic anion transporting polypeptide 5A1 | ||||
| Gene ID | |||||
| UniProt ID | |||||
| Epigenetic Regulations of This DT (EGR) | |||||
|---|---|---|---|---|---|
|
Methylation |
|||||
|
Prostate cancer |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLCO5A1 in prostate cancer | [ 1 ] | |||
|
Location |
5'UTR (cg10842164) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.25E+00 | Statistic Test | p-value: 1.67E-02; Z-score: 2.27E+00 | ||
|
Methylation in Case |
7.51E-01 (Median) | Methylation in Control | 6.01E-01 (Median) | ||
|
Studied Phenotype |
Prostate cancer [ ICD-11: 2C82] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Bladder cancer |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLCO5A1 in bladder cancer | [ 2 ] | |||
|
Location |
TSS1500 (cg23677272) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -2.05E+00 | Statistic Test | p-value: 5.18E-16; Z-score: -3.19E+01 | ||
|
Methylation in Case |
2.60E-01 (Median) | Methylation in Control | 5.34E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Breast cancer |
5 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLCO5A1 in breast cancer | [ 3 ] | |||
|
Location |
TSS1500 (cg23677272) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.32E+00 | Statistic Test | p-value: 5.55E-12; Z-score: -2.76E+00 | ||
|
Methylation in Case |
4.28E-01 (Median) | Methylation in Control | 5.66E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLCO5A1 in breast cancer | [ 3 ] | |||
|
Location |
TSS1500 (cg22083639) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.00E+00 | Statistic Test | p-value: 1.60E-02; Z-score: 1.10E-02 | ||
|
Methylation in Case |
9.19E-02 (Median) | Methylation in Control | 9.16E-02 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of SLCO5A1 in breast cancer | [ 3 ] | |||
|
Location |
TSS200 (cg09962807) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.08E+00 | Statistic Test | p-value: 2.49E-03; Z-score: 3.13E-01 | ||
|
Methylation in Case |
5.69E-02 (Median) | Methylation in Control | 5.28E-02 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of SLCO5A1 in breast cancer | [ 3 ] | |||
|
Location |
TSS200 (cg22062659) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.07E+00 | Statistic Test | p-value: 2.12E-02; Z-score: 3.41E-01 | ||
|
Methylation in Case |
1.04E-01 (Median) | Methylation in Control | 9.68E-02 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of SLCO5A1 in breast cancer | [ 3 ] | |||
|
Location |
TSS200 (cg11996434) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.11E+00 | Statistic Test | p-value: 3.86E-02; Z-score: 2.81E-01 | ||
|
Methylation in Case |
5.34E-02 (Median) | Methylation in Control | 4.81E-02 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Renal cell carcinoma |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLCO5A1 in clear cell renal cell carcinoma | [ 4 ] | |||
|
Location |
TSS1500 (cg23677272) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.20E+00 | Statistic Test | p-value: 1.62E-06; Z-score: -3.11E+00 | ||
|
Methylation in Case |
5.91E-01 (Median) | Methylation in Control | 7.11E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Colorectal cancer |
3 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLCO5A1 in colorectal cancer | [ 5 ] | |||
|
Location |
TSS1500 (cg23677272) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.10E+00 | Statistic Test | p-value: 6.73E-07; Z-score: -1.38E+00 | ||
|
Methylation in Case |
6.85E-01 (Median) | Methylation in Control | 7.53E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLCO5A1 in colorectal cancer | [ 5 ] | |||
|
Location |
TSS1500 (cg18799048) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.09E+00 | Statistic Test | p-value: 3.65E-03; Z-score: 5.72E-01 | ||
|
Methylation in Case |
9.81E-02 (Median) | Methylation in Control | 9.00E-02 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
HIV infection |
3 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLCO5A1 in HIV infection | [ 6 ] | |||
|
Location |
TSS1500 (cg23677272) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.41E+00 | Statistic Test | p-value: 2.84E-08; Z-score: 3.34E+00 | ||
|
Methylation in Case |
5.02E-01 (Median) | Methylation in Control | 3.56E-01 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLCO5A1 in HIV infection | [ 6 ] | |||
|
Location |
TSS1500 (cg22083639) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.40E+00 | Statistic Test | p-value: 1.69E-06; Z-score: 1.76E+00 | ||
|
Methylation in Case |
9.65E-02 (Median) | Methylation in Control | 6.89E-02 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of SLCO5A1 in HIV infection | [ 6 ] | |||
|
Location |
TSS1500 (cg18799048) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.25E+00 | Statistic Test | p-value: 2.71E-03; Z-score: 8.63E-01 | ||
|
Methylation in Case |
6.32E-02 (Median) | Methylation in Control | 5.04E-02 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Panic disorder |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLCO5A1 in panic disorder | [ 7 ] | |||
|
Location |
TSS1500 (cg23677272) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -8.70E-01 | Statistic Test | p-value: 2.87E-03; Z-score: -5.43E-01 | ||
|
Methylation in Case |
-1.38E+00 (Median) | Methylation in Control | -1.20E+00 (Median) | ||
|
Studied Phenotype |
Panic disorder [ ICD-11: 6B01] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Papillary thyroid cancer |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLCO5A1 in papillary thyroid cancer | [ 8 ] | |||
|
Location |
TSS1500 (cg22083639) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.28E+00 | Statistic Test | p-value: 1.59E-02; Z-score: -7.17E-01 | ||
|
Methylation in Case |
6.47E-02 (Median) | Methylation in Control | 8.29E-02 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Hepatocellular carcinoma |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLCO5A1 in hepatocellular carcinoma | [ 9 ] | |||
|
Location |
TSS200 (cg09962807) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 7.59E-03; Z-score: -5.97E-02 | ||
|
Methylation in Case |
6.55E-02 (Median) | Methylation in Control | 6.62E-02 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Pancretic ductal adenocarcinoma |
4 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLCO5A1 in pancretic ductal adenocarcinoma | [ 10 ] | |||
|
Location |
TSS200 (cg03213352) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.06E+00 | Statistic Test | p-value: 2.87E-04; Z-score: -3.28E-01 | ||
|
Methylation in Case |
1.34E-01 (Median) | Methylation in Control | 1.43E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLCO5A1 in pancretic ductal adenocarcinoma | [ 10 ] | |||
|
Location |
TSS200 (cg25233339) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.17E+00 | Statistic Test | p-value: 4.67E-03; Z-score: -6.29E-01 | ||
|
Methylation in Case |
1.16E-01 (Median) | Methylation in Control | 1.36E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of SLCO5A1 in pancretic ductal adenocarcinoma | [ 10 ] | |||
|
Location |
TSS200 (cg02804028) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.07E+00 | Statistic Test | p-value: 1.70E-02; Z-score: -3.01E-01 | ||
|
Methylation in Case |
9.04E-02 (Median) | Methylation in Control | 9.67E-02 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of SLCO5A1 in pancretic ductal adenocarcinoma | [ 10 ] | |||
|
Location |
Body (cg21957058) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.07E+00 | Statistic Test | p-value: 6.91E-03; Z-score: 2.66E-01 | ||
|
Methylation in Case |
2.41E-01 (Median) | Methylation in Control | 2.25E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Systemic lupus erythematosus |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLCO5A1 in systemic lupus erythematosus | [ 11 ] | |||
|
Location |
TSS200 (cg09962807) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.04E+00 | Statistic Test | p-value: 2.05E-02; Z-score: -1.47E-01 | ||
|
Methylation in Case |
6.99E-02 (Median) | Methylation in Control | 7.30E-02 (Median) | ||
|
Studied Phenotype |
Systemic lupus erythematosus [ ICD-11: 4A40.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Colon cancer |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLCO5A1 in colon adenocarcinoma | [ 12 ] | |||
|
Location |
Body (cg12109968) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.48E+00 | Statistic Test | p-value: 1.97E-06; Z-score: -1.19E+00 | ||
|
Methylation in Case |
1.26E-01 (Median) | Methylation in Control | 1.86E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Brain neuroblastoma |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Moderate hypomethylation of SLCO5A1 in brain neuroblastoma than that in healthy individual | ||||
Studied Phenotype |
Brain neuroblastoma [ICD-11:2A00.11] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value: 0.000153584; Fold-change: -0.258677329; Z-score: -1.386842543 | ||||
|
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
|
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
|
||||
|
microRNA |
|||||
|
Unclear Phenotype |
36 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
miR-106a directly targets SLCO5A1 | [ 13 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-106a | miRNA Mature ID | miR-106a-5p | ||
|
miRNA Sequence |
AAAAGUGCUUACAGUGCAGGUAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 2 |
miR-106b directly targets SLCO5A1 | [ 13 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-106b | miRNA Mature ID | miR-106b-5p | ||
|
miRNA Sequence |
UAAAGUGCUGACAGUGCAGAU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 3 |
miR-1276 directly targets SLCO5A1 | [ 14 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-1276 | miRNA Mature ID | miR-1276 | ||
|
miRNA Sequence |
UAAAGAGCCCUGUGGAGACA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 4 |
miR-17 directly targets SLCO5A1 | [ 13 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-17 | miRNA Mature ID | miR-17-5p | ||
|
miRNA Sequence |
CAAAGUGCUUACAGUGCAGGUAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 5 |
miR-192 directly targets SLCO5A1 | [ 13 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-192 | miRNA Mature ID | miR-192-3p | ||
|
miRNA Sequence |
CUGCCAAUUCCAUAGGUCACAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 6 |
miR-20a directly targets SLCO5A1 | [ 13 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-20a | miRNA Mature ID | miR-20a-5p | ||
|
miRNA Sequence |
UAAAGUGCUUAUAGUGCAGGUAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 7 |
miR-20b directly targets SLCO5A1 | [ 13 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-20b | miRNA Mature ID | miR-20b-5p | ||
|
miRNA Sequence |
CAAAGUGCUCAUAGUGCAGGUAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 8 |
miR-3183 directly targets SLCO5A1 | [ 15 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-3183 | miRNA Mature ID | miR-3183 | ||
|
miRNA Sequence |
GCCUCUCUCGGAGUCGCUCGGA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 9 |
miR-3190 directly targets SLCO5A1 | [ 15 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-3190 | miRNA Mature ID | miR-3190-5p | ||
|
miRNA Sequence |
UCUGGCCAGCUACGUCCCCA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 10 |
miR-320e directly targets SLCO5A1 | [ 14 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-320e | miRNA Mature ID | miR-320e | ||
|
miRNA Sequence |
AAAGCUGGGUUGAGAAGG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 11 |
miR-3926 directly targets SLCO5A1 | [ 15 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-3926 | miRNA Mature ID | miR-3926 | ||
|
miRNA Sequence |
UGGCCAAAAAGCAGGCAGAGA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 12 |
miR-4511 directly targets SLCO5A1 | [ 15 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-4511 | miRNA Mature ID | miR-4511 | ||
|
miRNA Sequence |
GAAGAACUGUUGCAUUUGCCCU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 13 |
miR-4684 directly targets SLCO5A1 | [ 15 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-4684 | miRNA Mature ID | miR-4684-5p | ||
|
miRNA Sequence |
CUCUCUACUGACUUGCAACAUA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 14 |
miR-4723 directly targets SLCO5A1 | [ 15 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-4723 | miRNA Mature ID | miR-4723-3p | ||
|
miRNA Sequence |
CCCUCUCUGGCUCCUCCCCAAA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 15 |
miR-4731 directly targets SLCO5A1 | [ 16 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-4731 | miRNA Mature ID | miR-4731-3p | ||
|
miRNA Sequence |
CACACAAGUGGCCCCCAACACU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Left ventricular cardiac tissues of human | ||||
|
Epigenetic Phenomenon 16 |
miR-4801 directly targets SLCO5A1 | [ 16 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-4801 | miRNA Mature ID | miR-4801 | ||
|
miRNA Sequence |
UACACAAGAAAACCAAGGCUCA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Left ventricular cardiac tissues of human | ||||
|
Epigenetic Phenomenon 17 |
miR-519a directly targets SLCO5A1 | [ 14 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-519a | miRNA Mature ID | miR-519a-3p | ||
|
miRNA Sequence |
AAAGUGCAUCCUUUUAGAGUGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 18 |
miR-519b directly targets SLCO5A1 | [ 14 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-519b | miRNA Mature ID | miR-519b-3p | ||
|
miRNA Sequence |
AAAGUGCAUCCUUUUAGAGGUU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 19 |
miR-519c directly targets SLCO5A1 | [ 14 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-519c | miRNA Mature ID | miR-519c-3p | ||
|
miRNA Sequence |
AAAGUGCAUCUUUUUAGAGGAU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 20 |
miR-519d directly targets SLCO5A1 | [ 13 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-519d | miRNA Mature ID | miR-519d-3p | ||
|
miRNA Sequence |
CAAAGUGCCUCCCUUUAGAGUG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 21 |
miR-526b directly targets SLCO5A1 | [ 13 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-526b | miRNA Mature ID | miR-526b-3p | ||
|
miRNA Sequence |
GAAAGUGCUUCCUUUUAGAGGC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 22 |
miR-548az directly targets SLCO5A1 | [ 13 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-548az | miRNA Mature ID | miR-548az-5p | ||
|
miRNA Sequence |
CAAAAGUGAUUGUGGUUUUUGC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 23 |
miR-548b directly targets SLCO5A1 | [ 15 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-548b | miRNA Mature ID | miR-548b-3p | ||
|
miRNA Sequence |
CAAGAACCUCAGUUGCUUUUGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 24 |
miR-548s directly targets SLCO5A1 | [ 15 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-548s | miRNA Mature ID | miR-548s | ||
|
miRNA Sequence |
AUGGCCAAAACUGCAGUUAUUUU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 25 |
miR-548t directly targets SLCO5A1 | [ 13 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-548t | miRNA Mature ID | miR-548t-5p | ||
|
miRNA Sequence |
CAAAAGUGAUCGUGGUUUUUG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 26 |
miR-603 directly targets SLCO5A1 | [ 16 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-603 | miRNA Mature ID | miR-603 | ||
|
miRNA Sequence |
CACACACUGCAAUUACUUUUGC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Left ventricular cardiac tissues of human | ||||
|
Epigenetic Phenomenon 27 |
miR-6128 directly targets SLCO5A1 | [ 14 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6128 | miRNA Mature ID | miR-6128 | ||
|
miRNA Sequence |
ACUGGAAUUGGAGUCAAAA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 28 |
miR-6769b directly targets SLCO5A1 | [ 15 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-6769b | miRNA Mature ID | miR-6769b-3p | ||
|
miRNA Sequence |
CCCUCUCUGUCCCACCCAUAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 29 |
miR-6817 directly targets SLCO5A1 | [ 15 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-6817 | miRNA Mature ID | miR-6817-3p | ||
|
miRNA Sequence |
UCUCUCUGACUCCAUGGCA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 30 |
miR-6849 directly targets SLCO5A1 | [ 15 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-6849 | miRNA Mature ID | miR-6849-3p | ||
|
miRNA Sequence |
ACCAGCCUGUGUCCACCUCCAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 31 |
miR-6873 directly targets SLCO5A1 | [ 15 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-6873 | miRNA Mature ID | miR-6873-3p | ||
|
miRNA Sequence |
UUCUCUCUGUCUUUCUCUCUCAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 32 |
miR-6892 directly targets SLCO5A1 | [ 15 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-6892 | miRNA Mature ID | miR-6892-3p | ||
|
miRNA Sequence |
UCCCUCUCCCACCCCUUGCAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 33 |
miR-7110 directly targets SLCO5A1 | [ 15 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-7110 | miRNA Mature ID | miR-7110-3p | ||
|
miRNA Sequence |
UCUCUCUCCCACUUCCCUGCAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 34 |
miR-767 directly targets SLCO5A1 | [ 14 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-767 | miRNA Mature ID | miR-767-5p | ||
|
miRNA Sequence |
UGCACCAUGGUUGUCUGAGCAUG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 35 |
miR-8485 directly targets SLCO5A1 | [ 16 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-8485 | miRNA Mature ID | miR-8485 | ||
|
miRNA Sequence |
CACACACACACACACACGUAU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Left ventricular cardiac tissues of human | ||||
|
Epigenetic Phenomenon 36 |
miR-93 directly targets SLCO5A1 | [ 13 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-93 | miRNA Mature ID | miR-93-5p | ||
|
miRNA Sequence |
CAAAGUGCUGUUCGUGCAGGUAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples