Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID DTD0504 Transporter Info
Gene Name SLCO5A1
Transporter Name Organic anion transporting polypeptide 5A1
Gene ID
81796
UniProt ID
Q9H2Y9
Epigenetic Regulations of This DT (EGR)

Methylation

  Prostate cancer

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLCO5A1 in prostate cancer [ 1 ]

Location

 5'UTR (cg10842164)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.25E+00 Statistic Test p-value: 1.67E-02; Z-score: 2.27E+00

Methylation in Case

 7.51E-01 (Median) Methylation in Control 6.01E-01 (Median)

Studied Phenotype

 Prostate cancer [ ICD-11: 2C82]

Experimental Material

 Patient tissue samples

  Bladder cancer

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLCO5A1 in bladder cancer [ 2 ]

Location

 TSS1500 (cg23677272)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -2.05E+00 Statistic Test p-value: 5.18E-16; Z-score: -3.19E+01

Methylation in Case

 2.60E-01 (Median) Methylation in Control 5.34E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Breast cancer

            5 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLCO5A1 in breast cancer [ 3 ]

Location

 TSS1500 (cg23677272)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.32E+00 Statistic Test p-value: 5.55E-12; Z-score: -2.76E+00

Methylation in Case

 4.28E-01 (Median) Methylation in Control 5.66E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLCO5A1 in breast cancer [ 3 ]

Location

 TSS1500 (cg22083639)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.00E+00 Statistic Test p-value: 1.60E-02; Z-score: 1.10E-02

Methylation in Case

 9.19E-02 (Median) Methylation in Control 9.16E-02 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLCO5A1 in breast cancer [ 3 ]

Location

 TSS200 (cg09962807)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.08E+00 Statistic Test p-value: 2.49E-03; Z-score: 3.13E-01

Methylation in Case

 5.69E-02 (Median) Methylation in Control 5.28E-02 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLCO5A1 in breast cancer [ 3 ]

Location

 TSS200 (cg22062659)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.07E+00 Statistic Test p-value: 2.12E-02; Z-score: 3.41E-01

Methylation in Case

 1.04E-01 (Median) Methylation in Control 9.68E-02 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLCO5A1 in breast cancer [ 3 ]

Location

 TSS200 (cg11996434)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.11E+00 Statistic Test p-value: 3.86E-02; Z-score: 2.81E-01

Methylation in Case

 5.34E-02 (Median) Methylation in Control 4.81E-02 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Renal cell carcinoma

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLCO5A1 in clear cell renal cell carcinoma [ 4 ]

Location

 TSS1500 (cg23677272)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.20E+00 Statistic Test p-value: 1.62E-06; Z-score: -3.11E+00

Methylation in Case

 5.91E-01 (Median) Methylation in Control 7.11E-01 (Median)

Studied Phenotype

 Renal cell carcinoma [ ICD-11: 2C90]

Experimental Material

 Patient tissue samples

  Colorectal cancer

            3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLCO5A1 in colorectal cancer [ 5 ]

Location

 TSS1500 (cg23677272)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.10E+00 Statistic Test p-value: 6.73E-07; Z-score: -1.38E+00

Methylation in Case

 6.85E-01 (Median) Methylation in Control 7.53E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLCO5A1 in colorectal cancer [ 5 ]

Location

 TSS1500 (cg18799048)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.09E+00 Statistic Test p-value: 3.65E-03; Z-score: 5.72E-01

Methylation in Case

 9.81E-02 (Median) Methylation in Control 9.00E-02 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  HIV infection

            3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLCO5A1 in HIV infection [ 6 ]

Location

 TSS1500 (cg23677272)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.41E+00 Statistic Test p-value: 2.84E-08; Z-score: 3.34E+00

Methylation in Case

 5.02E-01 (Median) Methylation in Control 3.56E-01 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLCO5A1 in HIV infection [ 6 ]

Location

 TSS1500 (cg22083639)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.40E+00 Statistic Test p-value: 1.69E-06; Z-score: 1.76E+00

Methylation in Case

 9.65E-02 (Median) Methylation in Control 6.89E-02 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLCO5A1 in HIV infection [ 6 ]

Location

 TSS1500 (cg18799048)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.25E+00 Statistic Test p-value: 2.71E-03; Z-score: 8.63E-01

Methylation in Case

 6.32E-02 (Median) Methylation in Control 5.04E-02 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Panic disorder

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLCO5A1 in panic disorder [ 7 ]

Location

 TSS1500 (cg23677272)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -8.70E-01 Statistic Test p-value: 2.87E-03; Z-score: -5.43E-01

Methylation in Case

 -1.38E+00 (Median) Methylation in Control -1.20E+00 (Median)

Studied Phenotype

 Panic disorder [ ICD-11: 6B01]

Experimental Material

 Patient tissue samples

  Papillary thyroid cancer

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLCO5A1 in papillary thyroid cancer [ 8 ]

Location

 TSS1500 (cg22083639)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.28E+00 Statistic Test p-value: 1.59E-02; Z-score: -7.17E-01

Methylation in Case

 6.47E-02 (Median) Methylation in Control 8.29E-02 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Hepatocellular carcinoma

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLCO5A1 in hepatocellular carcinoma [ 9 ]

Location

 TSS200 (cg09962807)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.01E+00 Statistic Test p-value: 7.59E-03; Z-score: -5.97E-02

Methylation in Case

 6.55E-02 (Median) Methylation in Control 6.62E-02 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Pancretic ductal adenocarcinoma

            4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLCO5A1 in pancretic ductal adenocarcinoma [ 10 ]

Location

 TSS200 (cg03213352)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.06E+00 Statistic Test p-value: 2.87E-04; Z-score: -3.28E-01

Methylation in Case

 1.34E-01 (Median) Methylation in Control 1.43E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLCO5A1 in pancretic ductal adenocarcinoma [ 10 ]

Location

 TSS200 (cg25233339)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.17E+00 Statistic Test p-value: 4.67E-03; Z-score: -6.29E-01

Methylation in Case

 1.16E-01 (Median) Methylation in Control 1.36E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLCO5A1 in pancretic ductal adenocarcinoma [ 10 ]

Location

 TSS200 (cg02804028)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.07E+00 Statistic Test p-value: 1.70E-02; Z-score: -3.01E-01

Methylation in Case

 9.04E-02 (Median) Methylation in Control 9.67E-02 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLCO5A1 in pancretic ductal adenocarcinoma [ 10 ]

Location

 Body (cg21957058)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.07E+00 Statistic Test p-value: 6.91E-03; Z-score: 2.66E-01

Methylation in Case

 2.41E-01 (Median) Methylation in Control 2.25E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Systemic lupus erythematosus

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLCO5A1 in systemic lupus erythematosus [ 11 ]

Location

 TSS200 (cg09962807)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.04E+00 Statistic Test p-value: 2.05E-02; Z-score: -1.47E-01

Methylation in Case

 6.99E-02 (Median) Methylation in Control 7.30E-02 (Median)

Studied Phenotype

 Systemic lupus erythematosus [ ICD-11: 4A40.0]

Experimental Material

 Patient tissue samples

  Colon cancer

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLCO5A1 in colon adenocarcinoma [ 12 ]

Location

 Body (cg12109968)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.48E+00 Statistic Test p-value: 1.97E-06; Z-score: -1.19E+00

Methylation in Case

 1.26E-01 (Median) Methylation in Control 1.86E-01 (Median)

Studied Phenotype

 Colon cancer [ ICD-11: 2B90]

Experimental Material

 Patient tissue samples

  Brain neuroblastoma

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Moderate hypomethylation of SLCO5A1 in brain neuroblastoma than that in healthy individual

Studied Phenotype

 Brain neuroblastoma [ICD-11:2A00.11]

The Methylation Level of Disease Section Compare with the Healthy Individual

 p-value: 0.000153584; Fold-change: -0.258677329; Z-score: -1.386842543
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue
Download DT methylation data in the tissue of healthy individual

microRNA

  Unclear Phenotype

          36 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 miR-106a directly targets SLCO5A1 [ 13 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-106a miRNA Mature ID miR-106a-5p

miRNA Sequence

 AAAAGUGCUUACAGUGCAGGUAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 2

 miR-106b directly targets SLCO5A1 [ 13 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-106b miRNA Mature ID miR-106b-5p

miRNA Sequence

 UAAAGUGCUGACAGUGCAGAU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 3

 miR-1276 directly targets SLCO5A1 [ 14 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-1276 miRNA Mature ID miR-1276

miRNA Sequence

 UAAAGAGCCCUGUGGAGACA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 4

 miR-17 directly targets SLCO5A1 [ 13 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-17 miRNA Mature ID miR-17-5p

miRNA Sequence

 CAAAGUGCUUACAGUGCAGGUAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 5

 miR-192 directly targets SLCO5A1 [ 13 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-192 miRNA Mature ID miR-192-3p

miRNA Sequence

 CUGCCAAUUCCAUAGGUCACAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 6

 miR-20a directly targets SLCO5A1 [ 13 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-20a miRNA Mature ID miR-20a-5p

miRNA Sequence

 UAAAGUGCUUAUAGUGCAGGUAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 7

 miR-20b directly targets SLCO5A1 [ 13 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-20b miRNA Mature ID miR-20b-5p

miRNA Sequence

 CAAAGUGCUCAUAGUGCAGGUAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 8

 miR-3183 directly targets SLCO5A1 [ 15 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-3183 miRNA Mature ID miR-3183

miRNA Sequence

 GCCUCUCUCGGAGUCGCUCGGA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 9

 miR-3190 directly targets SLCO5A1 [ 15 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-3190 miRNA Mature ID miR-3190-5p

miRNA Sequence

 UCUGGCCAGCUACGUCCCCA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 10

 miR-320e directly targets SLCO5A1 [ 14 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-320e miRNA Mature ID miR-320e

miRNA Sequence

 AAAGCUGGGUUGAGAAGG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 11

 miR-3926 directly targets SLCO5A1 [ 15 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-3926 miRNA Mature ID miR-3926

miRNA Sequence

 UGGCCAAAAAGCAGGCAGAGA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 12

 miR-4511 directly targets SLCO5A1 [ 15 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4511 miRNA Mature ID miR-4511

miRNA Sequence

 GAAGAACUGUUGCAUUUGCCCU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 13

 miR-4684 directly targets SLCO5A1 [ 15 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4684 miRNA Mature ID miR-4684-5p

miRNA Sequence

 CUCUCUACUGACUUGCAACAUA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 14

 miR-4723 directly targets SLCO5A1 [ 15 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4723 miRNA Mature ID miR-4723-3p

miRNA Sequence

 CCCUCUCUGGCUCCUCCCCAAA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 15

 miR-4731 directly targets SLCO5A1 [ 16 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4731 miRNA Mature ID miR-4731-3p

miRNA Sequence

 CACACAAGUGGCCCCCAACACU

miRNA Target Type

 Direct

Experimental Material

 Left ventricular cardiac tissues of human

  Epigenetic Phenomenon 16

 miR-4801 directly targets SLCO5A1 [ 16 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4801 miRNA Mature ID miR-4801

miRNA Sequence

 UACACAAGAAAACCAAGGCUCA

miRNA Target Type

 Direct

Experimental Material

 Left ventricular cardiac tissues of human

  Epigenetic Phenomenon 17

 miR-519a directly targets SLCO5A1 [ 14 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-519a miRNA Mature ID miR-519a-3p

miRNA Sequence

 AAAGUGCAUCCUUUUAGAGUGU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 18

 miR-519b directly targets SLCO5A1 [ 14 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-519b miRNA Mature ID miR-519b-3p

miRNA Sequence

 AAAGUGCAUCCUUUUAGAGGUU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 19

 miR-519c directly targets SLCO5A1 [ 14 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-519c miRNA Mature ID miR-519c-3p

miRNA Sequence

 AAAGUGCAUCUUUUUAGAGGAU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 20

 miR-519d directly targets SLCO5A1 [ 13 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-519d miRNA Mature ID miR-519d-3p

miRNA Sequence

 CAAAGUGCCUCCCUUUAGAGUG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 21

 miR-526b directly targets SLCO5A1 [ 13 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-526b miRNA Mature ID miR-526b-3p

miRNA Sequence

 GAAAGUGCUUCCUUUUAGAGGC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 22

 miR-548az directly targets SLCO5A1 [ 13 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-548az miRNA Mature ID miR-548az-5p

miRNA Sequence

 CAAAAGUGAUUGUGGUUUUUGC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 23

 miR-548b directly targets SLCO5A1 [ 15 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-548b miRNA Mature ID miR-548b-3p

miRNA Sequence

 CAAGAACCUCAGUUGCUUUUGU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 24

 miR-548s directly targets SLCO5A1 [ 15 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-548s miRNA Mature ID miR-548s

miRNA Sequence

 AUGGCCAAAACUGCAGUUAUUUU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 25

 miR-548t directly targets SLCO5A1 [ 13 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-548t miRNA Mature ID miR-548t-5p

miRNA Sequence

 CAAAAGUGAUCGUGGUUUUUG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 26

 miR-603 directly targets SLCO5A1 [ 16 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-603 miRNA Mature ID miR-603

miRNA Sequence

 CACACACUGCAAUUACUUUUGC

miRNA Target Type

 Direct

Experimental Material

 Left ventricular cardiac tissues of human

  Epigenetic Phenomenon 27

 miR-6128 directly targets SLCO5A1 [ 14 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6128 miRNA Mature ID miR-6128

miRNA Sequence

 ACUGGAAUUGGAGUCAAAA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 28

 miR-6769b directly targets SLCO5A1 [ 15 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6769b miRNA Mature ID miR-6769b-3p

miRNA Sequence

 CCCUCUCUGUCCCACCCAUAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 29

 miR-6817 directly targets SLCO5A1 [ 15 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6817 miRNA Mature ID miR-6817-3p

miRNA Sequence

 UCUCUCUGACUCCAUGGCA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 30

 miR-6849 directly targets SLCO5A1 [ 15 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6849 miRNA Mature ID miR-6849-3p

miRNA Sequence

 ACCAGCCUGUGUCCACCUCCAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 31

 miR-6873 directly targets SLCO5A1 [ 15 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6873 miRNA Mature ID miR-6873-3p

miRNA Sequence

 UUCUCUCUGUCUUUCUCUCUCAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 32

 miR-6892 directly targets SLCO5A1 [ 15 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6892 miRNA Mature ID miR-6892-3p

miRNA Sequence

 UCCCUCUCCCACCCCUUGCAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 33

 miR-7110 directly targets SLCO5A1 [ 15 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-7110 miRNA Mature ID miR-7110-3p

miRNA Sequence

 UCUCUCUCCCACUUCCCUGCAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 34

 miR-767 directly targets SLCO5A1 [ 14 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-767 miRNA Mature ID miR-767-5p

miRNA Sequence

 UGCACCAUGGUUGUCUGAGCAUG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 35

 miR-8485 directly targets SLCO5A1 [ 16 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-8485 miRNA Mature ID miR-8485

miRNA Sequence

 CACACACACACACACACGUAU

miRNA Target Type

 Direct

Experimental Material

 Left ventricular cardiac tissues of human

  Epigenetic Phenomenon 36

 miR-93 directly targets SLCO5A1 [ 13 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-93 miRNA Mature ID miR-93-5p

miRNA Sequence

 CAAAGUGCUGUUCGUGCAGGUAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human
References
1 Reducing the risk of false discovery enabling identification of biologically significant genome-wide methylation status using the HumanMethylation450 array. BMC Genomics. 2014 Jan 22;15:51.
2 DNA Methylation Dynamics in Urological Tumors.
3 Genome-wide Scan for Methylation Profiles in Breast Cancer
4 A CpG-methylation-based assay to predict survival in clear cell renal cell carcinoma. Nat Commun. 2015 Oct 30;6:8699.
5 Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
6 HIV-1 Infection Accelerates Age According to the Epigenetic Clock. J Infect Dis. 2015 Nov 15;212(10):1563-73.
7 DNA Methylation signatures in panic disorder. Transl Psychiatry. 2017 Dec 18;7(12):1287.
8 Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
9 Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
10 Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
11 Genome-wide DNA methylation analysis of systemic lupus erythematosus reveals persistent hypomethylation of interferon genes and compositional changes to CD4+ T-cell populations. PLoS Genet. 2013;9(8):e1003678.
12 Genome-scale analysis of DNA methylation in colorectal cancer using Infinium HumanMethylation450 BeadChips. Epigenetics. 2013 Sep;8(9):921-34.
13 Viral microRNA targetome of KSHV-infected primary effusion lymphoma cell lines. Cell Host Microbe. 2011 Nov 17;10(5):515-26.
14 TP53 regulates miRNA association with AGO2 to remodel the miRNA-mRNA interaction network. Genome Res. 2016 Mar;26(3):331-41.
15 Remodeling of Ago2-mRNA interactions upon cellular stress reflects miRNA complementarity and correlates with altered translation rates. Genes Dev. 2013 Jul 15;27(14):1624-32.
16 Elucidation of transcriptome-wide microRNA binding sites in human cardiac tissues by Ago2 HITS-CLIP. Nucleic Acids Res. 2016 Sep 6;44(15):7120-31.

If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.