Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID	DTD0002 Transporter Info
Gene Name	ABCC2
Transporter Name	Multidrug resistance-associated protein 2
Gene ID	1244
UniProt ID	Q92887

Epigenetic Regulations of This DT (EGR)
Methylation
Pancretic ductal adenocarcinoma	11 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of ABCC2 in pancretic ductal adenocarcinoma			[ 1 ]
Location	5'UTR (cg10264188)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.13E+00	Statistic Test	p-value: 2.32E-07; Z-score: 1.27E+00
Methylation in Case	5.65E-01 (Median)	Methylation in Control	5.00E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of ABCC2 in pancretic ductal adenocarcinoma			[ 1 ]
Location	TSS1500 (cg09177518)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 3.22E+00	Statistic Test	p-value: 4.10E-24; Z-score: 4.91E+00
Methylation in Case	2.67E-01 (Median)	Methylation in Control	8.30E-02 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of ABCC2 in pancretic ductal adenocarcinoma			[ 1 ]
Location	TSS1500 (cg14208112)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.63E+00	Statistic Test	p-value: 3.05E-17; Z-score: 3.28E+00
Methylation in Case	1.14E-01 (Median)	Methylation in Control	7.02E-02 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of ABCC2 in pancretic ductal adenocarcinoma			[ 1 ]
Location	TSS1500 (cg15623519)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.30E+00	Statistic Test	p-value: 6.60E-07; Z-score: -2.16E+00
Methylation in Case	2.83E-01 (Median)	Methylation in Control	3.69E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of ABCC2 in pancretic ductal adenocarcinoma			[ 1 ]
Location	TSS200 (cg06210630)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.05E+00	Statistic Test	p-value: 1.52E-04; Z-score: -7.42E-01
Methylation in Case	5.45E-01 (Median)	Methylation in Control	5.71E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of ABCC2 in pancretic ductal adenocarcinoma			[ 1 ]
Location	TSS200 (cg21378238)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.03E+00	Statistic Test	p-value: 3.61E-03; Z-score: 1.86E-01
Methylation in Case	2.97E-01 (Median)	Methylation in Control	2.87E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of ABCC2 in pancretic ductal adenocarcinoma			[ 1 ]
Location	1stExon (cg24173049)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -2.52E+00	Statistic Test	p-value: 5.09E-05; Z-score: -1.22E+00
Methylation in Case	1.14E-01 (Median)	Methylation in Control	2.88E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of ABCC2 in pancretic ductal adenocarcinoma			[ 1 ]
Location	Body (cg09283154)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.87E+00	Statistic Test	p-value: 8.12E-16; Z-score: 2.76E+00
Methylation in Case	3.94E-01 (Median)	Methylation in Control	2.10E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 9	Methylation of ABCC2 in pancretic ductal adenocarcinoma			[ 1 ]
Location	Body (cg15889012)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.37E+00	Statistic Test	p-value: 6.34E-08; Z-score: -2.06E+00
Methylation in Case	1.61E-01 (Median)	Methylation in Control	2.21E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 10	Methylation of ABCC2 in pancretic ductal adenocarcinoma			[ 1 ]
Location	Body (cg11201401)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.10E+00	Statistic Test	p-value: 7.04E-04; Z-score: 7.93E-01
Methylation in Case	5.28E-01 (Median)	Methylation in Control	4.78E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 11	Methylation of ABCC2 in pancretic ductal adenocarcinoma			[ 1 ]
Location	Body (cg11805188)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.13E+00	Statistic Test	p-value: 2.70E-02; Z-score: 7.94E-01
Methylation in Case	4.88E-01 (Median)	Methylation in Control	4.30E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Bladder cancer	10 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of ABCC2 in bladder cancer			[ 2 ]
Location	TSS1500 (cg05914069)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.06E+00	Statistic Test	p-value: 1.00E-03; Z-score: -2.28E+00
Methylation in Case	7.39E-01 (Median)	Methylation in Control	7.83E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of ABCC2 in bladder cancer			[ 2 ]
Location	TSS200 (cg09448875)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.31E+00	Statistic Test	p-value: 1.24E-05; Z-score: -2.28E+01
Methylation in Case	6.29E-01 (Median)	Methylation in Control	8.27E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of ABCC2 in bladder cancer			[ 2 ]
Location	Body (cg17044311)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.92E+00	Statistic Test	p-value: 3.57E-13; Z-score: -1.45E+01
Methylation in Case	4.06E-01 (Median)	Methylation in Control	7.78E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of ABCC2 in bladder cancer			[ 2 ]
Location	Body (cg13617376)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.77E+00	Statistic Test	p-value: 2.90E-11; Z-score: -1.73E+01
Methylation in Case	4.73E-01 (Median)	Methylation in Control	8.38E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of ABCC2 in bladder cancer			[ 2 ]
Location	Body (cg02672229)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.88E+00	Statistic Test	p-value: 1.09E-08; Z-score: -2.14E+01
Methylation in Case	4.49E-01 (Median)	Methylation in Control	8.46E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of ABCC2 in bladder cancer			[ 2 ]
Location	Body (cg00706648)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.09E+00	Statistic Test	p-value: 1.61E-06; Z-score: -7.42E+00
Methylation in Case	7.31E-01 (Median)	Methylation in Control	7.94E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of ABCC2 in bladder cancer			[ 2 ]
Location	Body (cg14303526)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.12E+00	Statistic Test	p-value: 1.40E-04; Z-score: -2.97E+00
Methylation in Case	7.31E-01 (Median)	Methylation in Control	8.15E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of ABCC2 in bladder cancer			[ 2 ]
Location	Body (cg05916255)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.06E+00	Statistic Test	p-value: 1.41E-02; Z-score: -1.95E+00
Methylation in Case	7.40E-01 (Median)	Methylation in Control	7.86E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 9	Methylation of ABCC2 in bladder cancer			[ 2 ]
Location	Body (cg08720365)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.02E+00	Statistic Test	p-value: 2.42E-02; Z-score: -6.97E-01
Methylation in Case	7.62E-01 (Median)	Methylation in Control	7.80E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 10	Methylation of ABCC2 in bladder cancer			[ 2 ]
Location	3'UTR (cg10841077)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.03E+00	Statistic Test	p-value: 8.61E-03; Z-score: -2.36E+00
Methylation in Case	8.94E-01 (Median)	Methylation in Control	9.17E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Breast cancer	12 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of ABCC2 in breast cancer			[ 3 ]
Location	TSS1500 (cg00826767)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.08E+00	Statistic Test	p-value: 3.34E-07; Z-score: -1.85E+00
Methylation in Case	7.28E-01 (Median)	Methylation in Control	7.89E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of ABCC2 in breast cancer			[ 3 ]
Location	TSS200 (cg09448875)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.13E+00	Statistic Test	p-value: 2.55E-08; Z-score: -2.20E+00
Methylation in Case	6.99E-01 (Median)	Methylation in Control	7.86E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of ABCC2 in breast cancer			[ 3 ]
Location	Body (cg00706648)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.08E+00	Statistic Test	p-value: 3.52E-10; Z-score: -2.13E+00
Methylation in Case	7.26E-01 (Median)	Methylation in Control	7.85E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of ABCC2 in breast cancer			[ 3 ]
Location	Body (cg14303526)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.16E+00	Statistic Test	p-value: 1.28E-07; Z-score: -1.52E+00
Methylation in Case	6.53E-01 (Median)	Methylation in Control	7.60E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of ABCC2 in breast cancer			[ 3 ]
Location	Body (cg19378330)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 2.33E+00	Statistic Test	p-value: 4.65E-07; Z-score: 1.65E+00
Methylation in Case	9.35E-02 (Median)	Methylation in Control	4.01E-02 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of ABCC2 in breast cancer			[ 3 ]
Location	Body (cg02672229)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.17E+00	Statistic Test	p-value: 3.30E-05; Z-score: -1.28E+00
Methylation in Case	7.06E-01 (Median)	Methylation in Control	8.23E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of ABCC2 in breast cancer			[ 3 ]
Location	Body (cg12673726)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.38E+00	Statistic Test	p-value: 5.66E-05; Z-score: 1.06E+00
Methylation in Case	5.37E-02 (Median)	Methylation in Control	3.89E-02 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of ABCC2 in breast cancer			[ 3 ]
Location	Body (cg25290633)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.04E+00	Statistic Test	p-value: 9.35E-05; Z-score: -8.82E-01
Methylation in Case	8.52E-01 (Median)	Methylation in Control	8.83E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 9	Methylation of ABCC2 in breast cancer			[ 3 ]
Location	Body (cg05916255)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.11E+00	Statistic Test	p-value: 9.11E-04; Z-score: -7.14E-01
Methylation in Case	7.52E-01 (Median)	Methylation in Control	8.38E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 10	Methylation of ABCC2 in breast cancer			[ 3 ]
Location	Body (cg16201095)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.01E+00	Statistic Test	p-value: 4.02E-03; Z-score: -4.81E-01
Methylation in Case	9.58E-01 (Median)	Methylation in Control	9.68E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 11	Methylation of ABCC2 in breast cancer			[ 3 ]
Location	Body (cg17044311)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.06E+00	Statistic Test	p-value: 1.43E-02; Z-score: -7.52E-01
Methylation in Case	7.89E-01 (Median)	Methylation in Control	8.34E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 12	Methylation of ABCC2 in breast cancer			[ 3 ]
Location	3'UTR (cg10841077)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.01E+00	Statistic Test	p-value: 1.75E-03; Z-score: -5.33E-01
Methylation in Case	9.08E-01 (Median)	Methylation in Control	9.18E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Colorectal cancer	13 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of ABCC2 in colorectal cancer			[ 4 ]
Location	TSS1500 (cg00826767)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.02E+00	Statistic Test	p-value: 2.40E-05; Z-score: -9.89E-01
Methylation in Case	8.99E-01 (Median)	Methylation in Control	9.17E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of ABCC2 in colorectal cancer			[ 4 ]
Location	TSS1500 (cg16377144)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.02E+00	Statistic Test	p-value: 4.26E-05; Z-score: -1.18E+00
Methylation in Case	9.03E-01 (Median)	Methylation in Control	9.24E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of ABCC2 in colorectal cancer			[ 4 ]
Location	TSS1500 (cg05914069)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.02E+00	Statistic Test	p-value: 1.54E-04; Z-score: -7.53E-01
Methylation in Case	8.88E-01 (Median)	Methylation in Control	9.05E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of ABCC2 in colorectal cancer			[ 4 ]
Location	Body (cg00706648)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.07E+00	Statistic Test	p-value: 8.51E-12; Z-score: -2.74E+00
Methylation in Case	7.66E-01 (Median)	Methylation in Control	8.18E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of ABCC2 in colorectal cancer			[ 4 ]
Location	Body (cg02672229)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.08E+00	Statistic Test	p-value: 2.68E-09; Z-score: -2.86E+00
Methylation in Case	8.39E-01 (Median)	Methylation in Control	9.04E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of ABCC2 in colorectal cancer			[ 4 ]
Location	Body (cg17044311)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.08E+00	Statistic Test	p-value: 3.35E-09; Z-score: -3.22E+00
Methylation in Case	8.61E-01 (Median)	Methylation in Control	9.26E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of ABCC2 in colorectal cancer			[ 4 ]
Location	Body (cg13617376)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.06E+00	Statistic Test	p-value: 6.36E-08; Z-score: -1.99E+00
Methylation in Case	8.56E-01 (Median)	Methylation in Control	9.11E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of ABCC2 in colorectal cancer			[ 4 ]
Location	Body (cg19604369)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.01E+00	Statistic Test	p-value: 6.49E-06; Z-score: -1.11E+00
Methylation in Case	9.16E-01 (Median)	Methylation in Control	9.27E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 9	Methylation of ABCC2 in colorectal cancer			[ 4 ]
Location	Body (cg19378330)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.19E+00	Statistic Test	p-value: 1.64E-04; Z-score: 3.41E-01
Methylation in Case	1.28E-01 (Median)	Methylation in Control	1.08E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 10	Methylation of ABCC2 in colorectal cancer			[ 4 ]
Location	Body (cg12673726)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.09E+00	Statistic Test	p-value: 4.10E-03; Z-score: -1.58E-01
Methylation in Case	1.02E-01 (Median)	Methylation in Control	1.12E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 11	Methylation of ABCC2 in colorectal cancer			[ 4 ]
Location	Body (cg05916255)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.03E+00	Statistic Test	p-value: 1.33E-02; Z-score: -1.50E+00
Methylation in Case	8.75E-01 (Median)	Methylation in Control	8.98E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 12	Methylation of ABCC2 in colorectal cancer			[ 4 ]
Location	Body (cg07520093)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.07E+00	Statistic Test	p-value: 2.73E-02; Z-score: -2.90E-01
Methylation in Case	7.10E-02 (Median)	Methylation in Control	7.62E-02 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Hepatocellular carcinoma	12 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of ABCC2 in hepatocellular carcinoma			[ 5 ]
Location	TSS1500 (cg05914069)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.02E+00	Statistic Test	p-value: 1.26E-03; Z-score: -4.21E-01
Methylation in Case	7.48E-01 (Median)	Methylation in Control	7.59E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of ABCC2 in hepatocellular carcinoma			[ 5 ]
Location	Body (cg14645545)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 2.09E+00	Statistic Test	p-value: 1.52E-18; Z-score: 3.28E+00
Methylation in Case	4.51E-01 (Median)	Methylation in Control	2.16E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of ABCC2 in hepatocellular carcinoma			[ 5 ]
Location	Body (cg19708984)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -2.20E+00	Statistic Test	p-value: 2.19E-18; Z-score: -4.26E+00
Methylation in Case	3.12E-01 (Median)	Methylation in Control	6.87E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of ABCC2 in hepatocellular carcinoma			[ 5 ]
Location	Body (cg10333311)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.37E+00	Statistic Test	p-value: 7.44E-14; Z-score: -4.94E+00
Methylation in Case	5.00E-01 (Median)	Methylation in Control	6.87E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of ABCC2 in hepatocellular carcinoma			[ 5 ]
Location	Body (cg04558907)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.49E+00	Statistic Test	p-value: 5.18E-13; Z-score: -3.81E+00
Methylation in Case	4.96E-01 (Median)	Methylation in Control	7.41E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of ABCC2 in hepatocellular carcinoma			[ 5 ]
Location	Body (cg19715414)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 2.08E+00	Statistic Test	p-value: 1.82E-11; Z-score: 3.10E+00
Methylation in Case	3.47E-01 (Median)	Methylation in Control	1.67E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of ABCC2 in hepatocellular carcinoma			[ 5 ]
Location	Body (cg13617376)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.35E+00	Statistic Test	p-value: 2.29E-09; Z-score: -1.42E+00
Methylation in Case	4.54E-01 (Median)	Methylation in Control	6.15E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of ABCC2 in hepatocellular carcinoma			[ 5 ]
Location	Body (cg12673726)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.48E+00	Statistic Test	p-value: 5.80E-08; Z-score: 1.72E+00
Methylation in Case	4.31E-01 (Median)	Methylation in Control	2.91E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 9	Methylation of ABCC2 in hepatocellular carcinoma			[ 5 ]
Location	Body (cg16201095)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.02E+00	Statistic Test	p-value: 2.75E-07; Z-score: -1.24E+00
Methylation in Case	9.38E-01 (Median)	Methylation in Control	9.57E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 10	Methylation of ABCC2 in hepatocellular carcinoma			[ 5 ]
Location	Body (cg14303526)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.09E+00	Statistic Test	p-value: 6.29E-07; Z-score: -1.62E+00
Methylation in Case	7.12E-01 (Median)	Methylation in Control	7.75E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 11	Methylation of ABCC2 in hepatocellular carcinoma			[ 5 ]
Location	Body (cg07520093)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.30E+00	Statistic Test	p-value: 3.75E-05; Z-score: 7.74E-01
Methylation in Case	6.19E-02 (Median)	Methylation in Control	4.76E-02 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 12	Methylation of ABCC2 in hepatocellular carcinoma			[ 5 ]
Location	3'UTR (cg10841077)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.01E+00	Statistic Test	p-value: 1.40E-03; Z-score: -5.05E-01
Methylation in Case	8.98E-01 (Median)	Methylation in Control	9.07E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
HIV infection	12 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of ABCC2 in HIV infection			[ 6 ]
Location	TSS1500 (cg05914069)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.04E+00	Statistic Test	p-value: 7.08E-04; Z-score: -1.46E+00
Methylation in Case	8.21E-01 (Median)	Methylation in Control	8.57E-01 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of ABCC2 in HIV infection			[ 6 ]
Location	TSS1500 (cg16377144)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.03E+00	Statistic Test	p-value: 3.75E-03; Z-score: -1.02E+00
Methylation in Case	8.10E-01 (Median)	Methylation in Control	8.37E-01 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of ABCC2 in HIV infection			[ 6 ]
Location	TSS200 (cg09448875)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.01E+00	Statistic Test	p-value: 1.70E-02; Z-score: -6.37E-01
Methylation in Case	9.44E-01 (Median)	Methylation in Control	9.55E-01 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of ABCC2 in HIV infection			[ 6 ]
Location	Body (cg17044311)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.26E+00	Statistic Test	p-value: 2.88E-23; Z-score: 3.42E+00
Methylation in Case	8.68E-01 (Median)	Methylation in Control	6.87E-01 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of ABCC2 in HIV infection			[ 6 ]
Location	Body (cg14303526)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.21E+00	Statistic Test	p-value: 5.25E-22; Z-score: 3.19E+00
Methylation in Case	8.63E-01 (Median)	Methylation in Control	7.13E-01 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of ABCC2 in HIV infection			[ 6 ]
Location	Body (cg03381359)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.21E+00	Statistic Test	p-value: 2.52E-18; Z-score: 3.77E+00
Methylation in Case	8.95E-01 (Median)	Methylation in Control	7.40E-01 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of ABCC2 in HIV infection			[ 6 ]
Location	Body (cg19604369)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.11E+00	Statistic Test	p-value: 3.99E-16; Z-score: 2.21E+00
Methylation in Case	8.78E-01 (Median)	Methylation in Control	7.90E-01 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of ABCC2 in HIV infection			[ 6 ]
Location	Body (cg19378330)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.77E+00	Statistic Test	p-value: 5.17E-07; Z-score: 2.08E+00
Methylation in Case	6.80E-02 (Median)	Methylation in Control	3.85E-02 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 9	Methylation of ABCC2 in HIV infection			[ 6 ]
Location	Body (cg02672229)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.06E+00	Statistic Test	p-value: 1.38E-05; Z-score: 6.75E-01
Methylation in Case	7.69E-01 (Median)	Methylation in Control	7.27E-01 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 10	Methylation of ABCC2 in HIV infection			[ 6 ]
Location	Body (cg12673726)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.75E+00	Statistic Test	p-value: 4.33E-05; Z-score: 2.23E+00
Methylation in Case	5.89E-02 (Median)	Methylation in Control	3.36E-02 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 11	Methylation of ABCC2 in HIV infection			[ 6 ]
Location	Body (cg05403832)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.04E+00	Statistic Test	p-value: 4.05E-02; Z-score: -5.39E-01
Methylation in Case	6.04E-01 (Median)	Methylation in Control	6.25E-01 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 12	Methylation of ABCC2 in HIV infection			[ 6 ]
Location	3'UTR (cg10841077)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.02E+00	Statistic Test	p-value: 2.09E-04; Z-score: 8.29E-01
Methylation in Case	9.45E-01 (Median)	Methylation in Control	9.31E-01 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Lung adenocarcinoma	6 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of ABCC2 in lung adenocarcinoma			[ 7 ]
Location	TSS1500 (cg00826767)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.05E+00	Statistic Test	p-value: 3.52E-03; Z-score: 1.22E+00
Methylation in Case	8.42E-01 (Median)	Methylation in Control	7.99E-01 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of ABCC2 in lung adenocarcinoma			[ 7 ]
Location	TSS1500 (cg16377144)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.05E+00	Statistic Test	p-value: 1.98E-02; Z-score: 1.32E+00
Methylation in Case	7.81E-01 (Median)	Methylation in Control	7.43E-01 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of ABCC2 in lung adenocarcinoma			[ 7 ]
Location	Body (cg08720365)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.05E+00	Statistic Test	p-value: 3.81E-05; Z-score: -2.85E+00
Methylation in Case	7.92E-01 (Median)	Methylation in Control	8.29E-01 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of ABCC2 in lung adenocarcinoma			[ 7 ]
Location	Body (cg00706648)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.05E+00	Statistic Test	p-value: 3.88E-03; Z-score: -2.14E+00
Methylation in Case	7.50E-01 (Median)	Methylation in Control	7.90E-01 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of ABCC2 in lung adenocarcinoma			[ 7 ]
Location	Body (cg05916255)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.03E+00	Statistic Test	p-value: 1.54E-02; Z-score: -1.73E+00
Methylation in Case	8.09E-01 (Median)	Methylation in Control	8.36E-01 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of ABCC2 in lung adenocarcinoma			[ 7 ]
Location	Body (cg13617376)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.03E+00	Statistic Test	p-value: 3.05E-02; Z-score: -1.69E+00
Methylation in Case	8.44E-01 (Median)	Methylation in Control	8.73E-01 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Papillary thyroid cancer	9 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of ABCC2 in papillary thyroid cancer			[ 8 ]
Location	TSS1500 (cg05914069)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.01E+00	Statistic Test	p-value: 3.54E-02; Z-score: -2.16E-01
Methylation in Case	7.84E-01 (Median)	Methylation in Control	7.90E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of ABCC2 in papillary thyroid cancer			[ 8 ]
Location	TSS200 (cg09448875)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.02E+00	Statistic Test	p-value: 5.11E-03; Z-score: 7.78E-01
Methylation in Case	9.14E-01 (Median)	Methylation in Control	8.94E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of ABCC2 in papillary thyroid cancer			[ 8 ]
Location	Body (cg00706648)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.03E+00	Statistic Test	p-value: 5.10E-08; Z-score: -1.28E+00
Methylation in Case	7.45E-01 (Median)	Methylation in Control	7.64E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of ABCC2 in papillary thyroid cancer			[ 8 ]
Location	Body (cg03381359)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.01E+00	Statistic Test	p-value: 5.04E-05; Z-score: -7.06E-01
Methylation in Case	9.28E-01 (Median)	Methylation in Control	9.38E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of ABCC2 in papillary thyroid cancer			[ 8 ]
Location	Body (cg14303526)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.05E+00	Statistic Test	p-value: 6.17E-05; Z-score: 7.22E-01
Methylation in Case	8.58E-01 (Median)	Methylation in Control	8.18E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of ABCC2 in papillary thyroid cancer			[ 8 ]
Location	Body (cg07520093)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.15E+00	Statistic Test	p-value: 1.75E-03; Z-score: -5.30E-01
Methylation in Case	3.86E-02 (Median)	Methylation in Control	4.43E-02 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of ABCC2 in papillary thyroid cancer			[ 8 ]
Location	Body (cg08720365)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.02E+00	Statistic Test	p-value: 2.24E-03; Z-score: -6.77E-01
Methylation in Case	8.59E-01 (Median)	Methylation in Control	8.76E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of ABCC2 in papillary thyroid cancer			[ 8 ]
Location	Body (cg25290633)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.01E+00	Statistic Test	p-value: 3.49E-03; Z-score: -4.69E-01
Methylation in Case	9.10E-01 (Median)	Methylation in Control	9.19E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 9	Methylation of ABCC2 in papillary thyroid cancer			[ 8 ]
Location	Body (cg13617376)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.01E+00	Statistic Test	p-value: 7.84E-03; Z-score: -4.76E-01
Methylation in Case	9.11E-01 (Median)	Methylation in Control	9.22E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Prostate cancer	3 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of ABCC2 in prostate cancer			[ 9 ]
Location	TSS1500 (cg07337598)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.03E+00	Statistic Test	p-value: 2.65E-02; Z-score: 2.69E+00
Methylation in Case	8.79E-01 (Median)	Methylation in Control	8.51E-01 (Median)
Studied Phenotype	Prostate cancer [ ICD-11: 2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of ABCC2 in prostate cancer			[ 9 ]
Location	3'UTR (cg07551022)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.02E+00	Statistic Test	p-value: 4.47E-02; Z-score: 1.74E+00
Methylation in Case	9.43E-01 (Median)	Methylation in Control	9.20E-01 (Median)
Studied Phenotype	Prostate cancer [ ICD-11: 2C82]
Experimental Material	Patient tissue samples
Systemic lupus erythematosus	4 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of ABCC2 in systemic lupus erythematosus			[ 10 ]
Location	TSS1500 (cg16377144)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.01E+00	Statistic Test	p-value: 9.52E-03; Z-score: -2.64E-01
Methylation in Case	8.51E-01 (Median)	Methylation in Control	8.59E-01 (Median)
Studied Phenotype	Systemic lupus erythematosus [ ICD-11: 4A40.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of ABCC2 in systemic lupus erythematosus			[ 10 ]
Location	TSS1500 (cg05914069)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.01E+00	Statistic Test	p-value: 3.41E-02; Z-score: -2.01E-01
Methylation in Case	8.53E-01 (Median)	Methylation in Control	8.61E-01 (Median)
Studied Phenotype	Systemic lupus erythematosus [ ICD-11: 4A40.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of ABCC2 in systemic lupus erythematosus			[ 10 ]
Location	Body (cg05916255)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.00E+00	Statistic Test	p-value: 2.47E-02; Z-score: -1.70E-01
Methylation in Case	8.36E-01 (Median)	Methylation in Control	8.39E-01 (Median)
Studied Phenotype	Systemic lupus erythematosus [ ICD-11: 4A40.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of ABCC2 in systemic lupus erythematosus			[ 10 ]
Location	Body (cg02672229)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.00E+00	Statistic Test	p-value: 3.41E-02; Z-score: -4.79E-02
Methylation in Case	7.58E-01 (Median)	Methylation in Control	7.60E-01 (Median)
Studied Phenotype	Systemic lupus erythematosus [ ICD-11: 4A40.0]
Experimental Material	Patient tissue samples
Atypical teratoid rhabdoid tumor	11 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of ABCC2 in atypical teratoid rhabdoid tumor			[ 11 ]
Location	Body (cg00706648)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.13E+00	Statistic Test	p-value: 3.37E-05; Z-score: -1.13E+00
Methylation in Case	7.43E-01 (Median)	Methylation in Control	8.39E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of ABCC2 in atypical teratoid rhabdoid tumor			[ 11 ]
Location	Body (cg02672229)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.10E+00	Statistic Test	p-value: 1.99E-04; Z-score: -9.80E-01
Methylation in Case	7.26E-01 (Median)	Methylation in Control	7.95E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of ABCC2 in atypical teratoid rhabdoid tumor			[ 11 ]
Location	Body (cg03381359)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.05E+00	Statistic Test	p-value: 2.97E-04; Z-score: 5.67E-01
Methylation in Case	9.40E-01 (Median)	Methylation in Control	8.98E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of ABCC2 in atypical teratoid rhabdoid tumor			[ 11 ]
Location	Body (cg05403832)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.66E+00	Statistic Test	p-value: 1.45E-03; Z-score: -8.63E-01
Methylation in Case	1.53E-01 (Median)	Methylation in Control	2.55E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of ABCC2 in atypical teratoid rhabdoid tumor			[ 11 ]
Location	Body (cg05916255)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -2.41E+00	Statistic Test	p-value: 1.82E-03; Z-score: -4.43E-01
Methylation in Case	4.40E-02 (Median)	Methylation in Control	1.06E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of ABCC2 in atypical teratoid rhabdoid tumor			[ 11 ]
Location	Body (cg07520093)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.06E+00	Statistic Test	p-value: 4.03E-03; Z-score: 1.98E-01
Methylation in Case	3.25E-01 (Median)	Methylation in Control	3.06E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of ABCC2 in atypical teratoid rhabdoid tumor			[ 11 ]
Location	Body (cg08720365)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.15E+00	Statistic Test	p-value: 7.81E-03; Z-score: 1.23E+00
Methylation in Case	8.31E-01 (Median)	Methylation in Control	7.25E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of ABCC2 in atypical teratoid rhabdoid tumor			[ 11 ]
Location	Body (cg12673726)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.05E+00	Statistic Test	p-value: 2.86E-02; Z-score: 4.19E-01
Methylation in Case	1.04E-01 (Median)	Methylation in Control	9.91E-02 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 9	Methylation of ABCC2 in atypical teratoid rhabdoid tumor			[ 11 ]
Location	Body (cg13617376)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.01E+00	Statistic Test	p-value: 3.76E-02; Z-score: 7.52E-02
Methylation in Case	1.14E-01 (Median)	Methylation in Control	1.13E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 10	Methylation of ABCC2 in atypical teratoid rhabdoid tumor			[ 11 ]
Location	Body (cg14303526)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.03E+00	Statistic Test	p-value: 4.45E-02; Z-score: 4.23E-01
Methylation in Case	8.53E-01 (Median)	Methylation in Control	8.28E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 11	Methylation of ABCC2 in atypical teratoid rhabdoid tumor			[ 11 ]
Location	3'UTR (cg10841077)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.09E+00	Statistic Test	p-value: 4.01E-12; Z-score: -4.80E+00
Methylation in Case	9.03E-01 (Median)	Methylation in Control	9.83E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Panic disorder	2 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of ABCC2 in panic disorder			[ 12 ]
Location	Body (cg12673726)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -9.76E-01	Statistic Test	p-value: 1.52E-02; Z-score: -4.21E-01
Methylation in Case	-4.77E+00 (Median)	Methylation in Control	-4.65E+00 (Median)
Studied Phenotype	Panic disorder [ ICD-11: 6B01]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of ABCC2 in panic disorder			[ 12 ]
Location	Body (cg03381359)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.17E+00	Statistic Test	p-value: 1.92E-02; Z-score: -5.68E-01
Methylation in Case	1.29E+00 (Median)	Methylation in Control	1.51E+00 (Median)
Studied Phenotype	Panic disorder [ ICD-11: 6B01]
Experimental Material	Patient tissue samples
Liver cancer	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Significant/significant hypermethylation of ABCC2 in liver cancer than that in healthy individual/adjacent tissue
Studied Phenotype	Liver cancer [ICD-11:2C12]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 1.47E-09; Fold-change: -0.330225144; Z-score: -1.734613148
The Methylation Level of Disease Section Compare with the Adjacent Tissue	p-value: 2.92E-10; Fold-change: -0.327111157; Z-score: -2.331280663
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue adjacent to the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals DT methylation level in tissue other than the diseased tissue of patients
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data of patients in the normal section of the tissue adjacent to the disease section Download DT methylation data in the tissue of healthy individual Download DT methylation data in the tissue of the other disease section
Melanocytoma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Significant hypomethylation of ABCC2 in melanocytoma than that in healthy individual
Studied Phenotype	Melanocytoma [ICD-11:2F36.2]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 1.16E-11; Fold-change: -0.616986191; Z-score: -33.83827015
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Melanoma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Significant hypomethylation of ABCC2 in melanoma than that in healthy individual
Studied Phenotype	Melanoma [ICD-11:2C30]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 1.22E-05; Fold-change: -0.430938666; Z-score: -16.04603395
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
microRNA
Colorectal cancer	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	High expression of miR-297 in colorectal cancer (compare to oxaliplatin-resistance counterpart cell)			[ 13 ]
Epigenetic Type	microRNA	Experiment Method	Luciferase reporter assay
Related Molecular Changes	Down regulation of ABCC2	Experiment Method	RT-qPCR
miRNA Stemloop ID	miR-297	miRNA Mature ID	miR-297
miRNA Sequence	AUGUAUGUGUGCAUGUGCAUG
miRNA Target Type	Direct
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples, Multiple cell lines of human
Additional Notes	miR-297 modulates multidrug resistance in human colorectal carcinoma by down-regulating MRP-2.
Ovarian cancer	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	High expression of miR-490-3p in ovarian cancer (compare to multidrug-resistance counterpart cell)			[ 14 ]
Epigenetic Type	microRNA	Experiment Method	Luciferase reporter assay
Related Molecular Changes	Down regulation of ABCC2	Experiment Method	Immunohistochemical staining
miRNA Stemloop ID	miR-490	miRNA Mature ID	miR-490-3p
miRNA Sequence	CAACCUGGAGGACUCCAUGCUG
miRNA Target Type	Direct
Studied Phenotype	Ovarian cancer [ ICD-11: 2C73]
Experimental Material	Multiple cell lines of human
Additional Notes	miR-490-3p overexpression may increase the sensitivity of ovarian cancer cells to cisplatin by targeting ABCC2.
Hepatocellular carcinoma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Low expression of miR-379 in HCC (compare with rifampicin treatment counterpart cells)			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	Luciferase reporter assay
Related Molecular Changes	Down regulation of ABCC2	Experiment Method	Western Blot
miRNA Stemloop ID	miR-379	miRNA Mature ID	miR-379-5p
miRNA Sequence	UGGUAGACUAUGGAACGUAGG
miRNA Target Type	Direct
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Human hepatocellular carcinoma cells line (HepG2)
Additional Notes	Down-regulation of ABCC2 protein expression in HepG2 cells after rifampicin treatment is mediated by microRNA-379
Chronic myeloid leukemia	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	miR-205-5p downregulate ABCC2 expression			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	Luciferase reporter assay
Related Molecular Changes	Down regulation of ABCC2	Experiment Method	Western Blot
miRNA Stemloop ID	miR-205	miRNA Mature ID	miR-205-5p
miRNA Sequence	UCCUUCAUUCCACCGGAGUCUG
miRNA Target Type	Direct
Studied Phenotype	Chronic myeloid leukemia [ ICD-11: 2B33.1]
Experimental Material	Chronic myelocytic leukemia cell line (K562)
Additional Notes	miR-205-5p overexpression may increase the sensitivity of chronic myeloid leukemia cells to imatinib by targeting ABCC2.
Unclear Phenotype	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	miR-490 directly targets ABCC2			[ 14 ]
Epigenetic Type	microRNA	Experiment Method	Immunohistochemistry//Luciferase reporter assay//qRT-PCR//Western blot
miRNA Stemloop ID	miR-490	miRNA Mature ID	miR-490-3p
miRNA Sequence	CAACCUGGAGGACUCCAUGCUG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human

References
1	Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
2	DNA Methylation Dynamics in Urological Tumors.
3	Genome-wide Scan for Methylation Profiles in Breast Cancer
4	Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
5	Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
6	HIV-1 Infection Accelerates Age According to the Epigenetic Clock. J Infect Dis. 2015 Nov 15;212(10):1563-73.
7	DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
8	Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
9	Reducing the risk of false discovery enabling identification of biologically significant genome-wide methylation status using the HumanMethylation450 array. BMC Genomics. 2014 Jan 22;15:51.
10	Genome-wide DNA methylation analysis of systemic lupus erythematosus reveals persistent hypomethylation of interferon genes and compositional changes to CD4+ T-cell populations. PLoS Genet. 2013;9(8):e1003678.
11	Atypical Teratoid/Rhabdoid Tumors Are Comprised of Three Epigenetic Subgroups with Distinct Enhancer Landscapes. Cancer Cell. 2016 Mar 14;29(3):379-393.
12	DNA Methylation signatures in panic disorder. Transl Psychiatry. 2017 Dec 18;7(12):1287.
13	miR-297 modulates multidrug resistance in human colorectal carcinoma by down-regulating MRP-2. Biochem J. 2012 Sep 1;446(2):291-300.
14	MiR-490-3p sensitizes ovarian cancer cells to cisplatin by directly targeting ABCC2. Am J Transl Res. 2017 Mar 15;9(3):1127-1138. eCollection 2017.
15	Down-regulation of ATP-binding cassette C2 protein expression in HepG2 cells after rifampicin treatment is mediated by microRNA-379. Mol Pharmacol. 2011 Aug;80(2):314-20.
16	LncRNA SNHG5 regulates imatinib resistance in chronic myeloid leukemia via acting as a CeRNA against MiR-205-5p. Am J Cancer Res. 2017 Aug 1;7(8):1704-1713. eCollection 2017.

If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.

Detail Information of Epigenetic Regulations

Visitor Map

Correspondence