Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID	DTD0004 Transporter Info
Gene Name	ABCG2
Transporter Name	Breast cancer resistance protein
Gene ID	9429
UniProt ID	Q9UNQ0

Epigenetic Regulations of This DT (EGR)
Methylation
Pancreatic cancer	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Hypomethylation of ABCG2 in pancreatic cancer			[ 1 ]
Location	Promoter
Epigenetic Type	Methylation	Experiment Method	Bisulfite sequencing
Related Molecular Changes	Up regulation of ABCG2	Experiment Method	RT-qPCR
Studied Phenotype	Pancreatic cancer [ ICD-11: 2C10]
Experimental Material	Multiple cell lines of human
Additional Notes	ABCG2 expression correlated with pancreatic cancer tumorigenesis and drug resistance in a mechanism that is independent of promoter methylation.
Chronic myelogenous leukemia	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Hypermethylation of ABCG2 in chronic myelogenous leukemia			[ 2 ]
Location	Promoter
Epigenetic Type	Methylation	Experiment Method	Methylation-sensitive PCR
Related Molecular Changes	Down regulation of ABCG2	Experiment Method	Southern blotting
Studied Phenotype	Chronic myelogenous leukemia [ ICD-11: 2A20.0]
Experimental Material	Multiple cell lines of human
Additional Notes	c-MYCmediated transcription of ABCG2 gene is controlled by its CpG islandpromoter methylation status.
Small cell lung cancer	2 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Hypermethylation of ABCG2 in lung cancer (compare with drug-resistant counterpart cells)			[ 3 ]
Location	Promoter
Epigenetic Type	Methylation	Experiment Method	Methylation-specific PCR
Related Molecular Changes	Down regulation of ABCG2	Experiment Method	RT-qPCR
Studied Phenotype	Small cell lung cancer [ ICD-11: 2C25.1]
Experimental Material	Multiple cell lines of human
Additional Notes	Methylation status of ABCG2 is correlated inversely with its expression in drug-resistant lung cancer cells.
Epigenetic Phenomenon 2	Hypermethylation of ABCG2 in lung cancer (compare with drug-resistant counterpart cells)			[ 3 ]
Location	Promoter
Epigenetic Type	Methylation	Experiment Method	Methylation-specific PCR
Related Molecular Changes	Down regulation of ABCG2	Experiment Method	Western Blot
Studied Phenotype	Small cell lung cancer [ ICD-11: 2C25.1]
Experimental Material	Multiple cell lines of human
Additional Notes	Methylation status of ABCG2 is correlated inversely with its expression in drug-resistant lung cancer cells.
Multiple myeloma	2 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Hypermethylation of ABCG2 in multiple myeloma			[ 4 ]
Location	Promoter
Epigenetic Type	Methylation	Experiment Method	Methylation-specific PCR
Related Molecular Changes	Down regulation of ABCG2	Experiment Method	RT-qPCR
Studied Phenotype	Multiple myeloma [ ICD-11: 2A83]
Experimental Material	Multiple cell lines of human
Additional Notes	Demethylation of the promoter increased ABCG2 mRNA and protein expression.
Epigenetic Phenomenon 2	Hypermethylation of ABCG2 in multiple myeloma			[ 4 ]
Location	Promoter
Epigenetic Type	Methylation	Experiment Method	Methylation-specific PCR
Related Molecular Changes	Down regulation of ABCG2	Experiment Method	Western Blot
Studied Phenotype	Multiple myeloma [ ICD-11: 2A83]
Experimental Material	Multiple cell lines of human
Additional Notes	Demethylation of the promoter increased ABCG2 mRNA and protein expression.
Renal cell carcinoma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Hypermethylation of ABCG2 in renal carcinoma			[ 5 ]
Location	Promoter (-599 to +329 bp)
Epigenetic Type	Methylation	Experiment Method	Bisulfite sequencing
Related Molecular Changes	Down regulation of ABCG2	Experiment Method	Semiquantitative RT-PCR
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Multiple cell lines of human
Additional Notes	Methylation of the ABCG2 promoter inhibited transcriptional activity.
Glioblastoma multiforme	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Hypermethylation of ABCG2 in glioblastoma multiforme			[ 6 ]
Location	Promoter
Epigenetic Type	Methylation	Experiment Method	Methylation-specific PCR
Related Molecular Changes	level of ABCG2 Unchanged	Experiment Method	RT-qPCR
Studied Phenotype	Glioblastoma multiforme [ ICD-11: 2A00.00]
Experimental Material	Patient tissue samples
Additional Notes	No association between ABCG2 promoter methylation and ABCG2 expression or overall survival was seen.
Atypical teratoid rhabdoid tumor	4 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of ABCG2 in atypical teratoid rhabdoid tumor			[ 7 ]
Location	5'UTR (cg02016771)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.06E+00	Statistic Test	p-value: 1.18E-08; Z-score: -1.25E+00
Methylation in Case	7.75E-01 (Median)	Methylation in Control	8.23E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of ABCG2 in atypical teratoid rhabdoid tumor			[ 7 ]
Location	5'UTR (cg05919690)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.75E+00	Statistic Test	p-value: 4.99E-08; Z-score: 1.51E+00
Methylation in Case	8.62E-02 (Median)	Methylation in Control	4.92E-02 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of ABCG2 in atypical teratoid rhabdoid tumor			[ 7 ]
Location	5'UTR (cg15443907)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.05E+00	Statistic Test	p-value: 1.19E-06; Z-score: -1.09E+00
Methylation in Case	8.21E-01 (Median)	Methylation in Control	8.60E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of ABCG2 in atypical teratoid rhabdoid tumor			[ 7 ]
Location	Body (cg04064583)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.09E+00	Statistic Test	p-value: 5.50E-04; Z-score: -4.51E-01
Methylation in Case	4.65E-01 (Median)	Methylation in Control	5.07E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Bladder cancer	6 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of ABCG2 in bladder cancer			[ 8 ]
Location	5'UTR (cg02016771)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -2.36E+00	Statistic Test	p-value: 2.42E-09; Z-score: -9.59E+00
Methylation in Case	3.19E-01 (Median)	Methylation in Control	7.54E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of ABCG2 in bladder cancer			[ 8 ]
Location	5'UTR (cg15443907)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.02E+00	Statistic Test	p-value: 3.60E-02; Z-score: -7.05E-01
Methylation in Case	8.77E-01 (Median)	Methylation in Control	8.93E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of ABCG2 in bladder cancer			[ 8 ]
Location	TSS1500 (cg24352530)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -3.96E+00	Statistic Test	p-value: 1.17E-05; Z-score: -5.36E+00
Methylation in Case	8.59E-02 (Median)	Methylation in Control	3.40E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of ABCG2 in bladder cancer			[ 8 ]
Location	TSS1500 (cg11000292)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -2.39E+00	Statistic Test	p-value: 5.90E-03; Z-score: -2.04E+00
Methylation in Case	3.05E-02 (Median)	Methylation in Control	7.31E-02 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of ABCG2 in bladder cancer			[ 8 ]
Location	TSS200 (cg26489994)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.81E+00	Statistic Test	p-value: 3.96E-03; Z-score: -2.69E+00
Methylation in Case	1.89E-02 (Median)	Methylation in Control	3.42E-02 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of ABCG2 in bladder cancer			[ 8 ]
Location	Body (cg04064583)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.92E+00	Statistic Test	p-value: 1.37E-04; Z-score: -3.80E+00
Methylation in Case	6.39E-02 (Median)	Methylation in Control	1.23E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Breast cancer	9 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of ABCG2 in breast cancer			[ 9 ]
Location	5'UTR (cg15443907)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.03E+00	Statistic Test	p-value: 8.04E-04; Z-score: -9.54E-01
Methylation in Case	8.80E-01 (Median)	Methylation in Control	9.05E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of ABCG2 in breast cancer			[ 9 ]
Location	5'UTR (cg02016771)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.09E+00	Statistic Test	p-value: 2.29E-03; Z-score: -8.10E-01
Methylation in Case	6.82E-01 (Median)	Methylation in Control	7.45E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of ABCG2 in breast cancer			[ 9 ]
Location	5'UTR (cg05919690)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.02E+00	Statistic Test	p-value: 3.56E-02; Z-score: -3.32E-01
Methylation in Case	6.67E-01 (Median)	Methylation in Control	6.82E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of ABCG2 in breast cancer			[ 9 ]
Location	TSS1500 (cg11000292)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.07E+00	Statistic Test	p-value: 1.13E-02; Z-score: 1.82E-01
Methylation in Case	3.61E-02 (Median)	Methylation in Control	3.37E-02 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of ABCG2 in breast cancer			[ 9 ]
Location	TSS1500 (cg27493371)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.05E+00	Statistic Test	p-value: 3.71E-02; Z-score: 3.45E-01
Methylation in Case	1.68E-01 (Median)	Methylation in Control	1.59E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of ABCG2 in breast cancer			[ 9 ]
Location	TSS200 (cg03415858)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.10E+00	Statistic Test	p-value: 7.24E-03; Z-score: 3.28E-01
Methylation in Case	5.32E-02 (Median)	Methylation in Control	4.83E-02 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of ABCG2 in breast cancer			[ 9 ]
Location	TSS200 (cg26489994)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.16E+00	Statistic Test	p-value: 1.47E-02; Z-score: 1.05E-01
Methylation in Case	1.79E-02 (Median)	Methylation in Control	1.54E-02 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of ABCG2 in breast cancer			[ 9 ]
Location	TSS200 (cg25295218)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.64E+00	Statistic Test	p-value: 3.85E-02; Z-score: 4.58E-01
Methylation in Case	2.71E-02 (Median)	Methylation in Control	1.65E-02 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 9	Methylation of ABCG2 in breast cancer			[ 9 ]
Location	Body (cg04064583)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.61E+00	Statistic Test	p-value: 1.25E-06; Z-score: -1.66E+00
Methylation in Case	1.87E-01 (Median)	Methylation in Control	3.01E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Hepatocellular carcinoma	6 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of ABCG2 in hepatocellular carcinoma			[ 10 ]
Location	5'UTR (cg15443907)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.03E+00	Statistic Test	p-value: 4.49E-03; Z-score: -6.16E-01
Methylation in Case	8.44E-01 (Median)	Methylation in Control	8.66E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of ABCG2 in hepatocellular carcinoma			[ 10 ]
Location	5'UTR (cg02016771)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.00E+00	Statistic Test	p-value: 1.69E-02; Z-score: -5.10E-03
Methylation in Case	8.32E-01 (Median)	Methylation in Control	8.33E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of ABCG2 in hepatocellular carcinoma			[ 10 ]
Location	TSS1500 (cg24352530)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.38E+00	Statistic Test	p-value: 2.61E-03; Z-score: -1.33E+00
Methylation in Case	9.47E-02 (Median)	Methylation in Control	1.30E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of ABCG2 in hepatocellular carcinoma			[ 10 ]
Location	Body (cg20080616)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.53E+00	Statistic Test	p-value: 1.91E-14; Z-score: -5.48E+00
Methylation in Case	5.09E-01 (Median)	Methylation in Control	7.80E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of ABCG2 in hepatocellular carcinoma			[ 10 ]
Location	Body (cg05369268)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.17E+00	Statistic Test	p-value: 5.10E-11; Z-score: -4.61E+00
Methylation in Case	8.25E-01 (Median)	Methylation in Control	9.62E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of ABCG2 in hepatocellular carcinoma			[ 10 ]
Location	Body (cg04064583)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.24E+00	Statistic Test	p-value: 1.92E-06; Z-score: -8.38E-01
Methylation in Case	1.21E-01 (Median)	Methylation in Control	1.50E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Panic disorder	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of ABCG2 in panic disorder			[ 11 ]
Location	5'UTR (cg02016771)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.04E+00	Statistic Test	p-value: 8.39E-03; Z-score: 2.81E-01
Methylation in Case	2.33E+00 (Median)	Methylation in Control	2.25E+00 (Median)
Studied Phenotype	Panic disorder [ ICD-11: 6B01]
Experimental Material	Patient tissue samples
Renal cell carcinoma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of ABCG2 in clear cell renal cell carcinoma			[ 12 ]
Location	TSS1500 (cg24352530)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.31E+00	Statistic Test	p-value: 1.06E-02; Z-score: -1.20E+00
Methylation in Case	1.64E-01 (Median)	Methylation in Control	2.15E-01 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Colorectal cancer	5 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of ABCG2 in colorectal cancer			[ 13 ]
Location	TSS1500 (cg02196227)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.00E+00	Statistic Test	p-value: 3.72E-02; Z-score: -2.59E-02
Methylation in Case	1.22E-01 (Median)	Methylation in Control	1.22E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of ABCG2 in colorectal cancer			[ 13 ]
Location	TSS200 (cg26489994)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.13E+00	Statistic Test	p-value: 3.86E-02; Z-score: 3.87E-01
Methylation in Case	1.66E-02 (Median)	Methylation in Control	1.47E-02 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of ABCG2 in colorectal cancer			[ 13 ]
Location	TSS200 (cg25295218)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.05E+00	Statistic Test	p-value: 4.93E-02; Z-score: 1.31E-01
Methylation in Case	1.62E-02 (Median)	Methylation in Control	1.54E-02 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of ABCG2 in colorectal cancer			[ 13 ]
Location	Body (cg04064583)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.17E+00	Statistic Test	p-value: 2.96E-02; Z-score: 6.86E-01
Methylation in Case	1.82E-01 (Median)	Methylation in Control	1.55E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Depression	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of ABCG2 in depression			[ 14 ]
Location	TSS1500 (cg24352530)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.06E+00	Statistic Test	p-value: 4.59E-02; Z-score: 5.87E-01
Methylation in Case	1.09E-01 (Median)	Methylation in Control	1.03E-01 (Median)
Studied Phenotype	Depression [ ICD-11: 6A8Z]
Experimental Material	Patient tissue samples
Pancretic ductal adenocarcinoma	9 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of ABCG2 in pancretic ductal adenocarcinoma			[ 15 ]
Location	TSS1500 (cg24507762)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.67E+00	Statistic Test	p-value: 1.93E-13; Z-score: 2.55E+00
Methylation in Case	3.72E-01 (Median)	Methylation in Control	2.23E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of ABCG2 in pancretic ductal adenocarcinoma			[ 15 ]
Location	TSS1500 (cg06213598)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.04E+00	Statistic Test	p-value: 1.68E-02; Z-score: -5.28E-01
Methylation in Case	7.99E-01 (Median)	Methylation in Control	8.27E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of ABCG2 in pancretic ductal adenocarcinoma			[ 15 ]
Location	TSS200 (cg13120771)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.53E+00	Statistic Test	p-value: 2.42E-04; Z-score: -1.17E+00
Methylation in Case	9.04E-02 (Median)	Methylation in Control	1.38E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of ABCG2 in pancretic ductal adenocarcinoma			[ 15 ]
Location	TSS200 (cg24084363)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.11E+00	Statistic Test	p-value: 1.31E-03; Z-score: 4.54E-01
Methylation in Case	1.03E-01 (Median)	Methylation in Control	9.27E-02 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of ABCG2 in pancretic ductal adenocarcinoma			[ 15 ]
Location	TSS200 (cg09796800)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.01E+00	Statistic Test	p-value: 1.53E-02; Z-score: 3.57E-01
Methylation in Case	9.52E-01 (Median)	Methylation in Control	9.42E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of ABCG2 in pancretic ductal adenocarcinoma			[ 15 ]
Location	Body (cg00244747)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.10E+00	Statistic Test	p-value: 4.31E-05; Z-score: -1.12E+00
Methylation in Case	7.22E-01 (Median)	Methylation in Control	7.94E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of ABCG2 in pancretic ductal adenocarcinoma			[ 15 ]
Location	Body (cg25453063)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.02E+00	Statistic Test	p-value: 2.46E-03; Z-score: 4.70E-01
Methylation in Case	8.71E-01 (Median)	Methylation in Control	8.52E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of ABCG2 in pancretic ductal adenocarcinoma			[ 15 ]
Location	Body (cg02414785)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.04E+00	Statistic Test	p-value: 3.72E-03; Z-score: -6.37E-01
Methylation in Case	6.19E-01 (Median)	Methylation in Control	6.43E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 9	Methylation of ABCG2 in pancretic ductal adenocarcinoma			[ 15 ]
Location	Body (cg15599483)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.16E+00	Statistic Test	p-value: 1.57E-02; Z-score: -9.46E-01
Methylation in Case	7.34E-01 (Median)	Methylation in Control	8.51E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Papillary thyroid cancer	5 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of ABCG2 in papillary thyroid cancer			[ 16 ]
Location	TSS1500 (cg24352530)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.32E+00	Statistic Test	p-value: 4.57E-05; Z-score: -1.30E+00
Methylation in Case	1.18E-01 (Median)	Methylation in Control	1.55E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of ABCG2 in papillary thyroid cancer			[ 16 ]
Location	TSS1500 (cg11000292)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.20E+00	Statistic Test	p-value: 9.42E-04; Z-score: -6.16E-01
Methylation in Case	2.60E-02 (Median)	Methylation in Control	3.12E-02 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of ABCG2 in papillary thyroid cancer			[ 16 ]
Location	TSS200 (cg26489994)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.15E+00	Statistic Test	p-value: 3.36E-06; Z-score: -8.46E-01
Methylation in Case	5.05E-02 (Median)	Methylation in Control	5.82E-02 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of ABCG2 in papillary thyroid cancer			[ 16 ]
Location	TSS200 (cg25295218)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.06E+00	Statistic Test	p-value: 9.48E-03; Z-score: -3.98E-01
Methylation in Case	5.39E-02 (Median)	Methylation in Control	5.71E-02 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of ABCG2 in papillary thyroid cancer			[ 16 ]
Location	Body (cg04064583)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.14E+00	Statistic Test	p-value: 4.19E-05; Z-score: -1.01E+00
Methylation in Case	4.99E-01 (Median)	Methylation in Control	5.68E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Systemic lupus erythematosus	4 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of ABCG2 in systemic lupus erythematosus			[ 17 ]
Location	TSS1500 (cg11000292)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.10E+00	Statistic Test	p-value: 3.53E-03; Z-score: -2.70E-01
Methylation in Case	5.39E-02 (Median)	Methylation in Control	5.92E-02 (Median)
Studied Phenotype	Systemic lupus erythematosus [ ICD-11: 4A40.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of ABCG2 in systemic lupus erythematosus			[ 17 ]
Location	TSS1500 (cg24352530)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.11E+00	Statistic Test	p-value: 4.38E-03; Z-score: -4.23E-01
Methylation in Case	2.00E-01 (Median)	Methylation in Control	2.21E-01 (Median)
Studied Phenotype	Systemic lupus erythematosus [ ICD-11: 4A40.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of ABCG2 in systemic lupus erythematosus			[ 17 ]
Location	TSS1500 (cg02196227)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.03E+00	Statistic Test	p-value: 5.16E-03; Z-score: -1.68E-01
Methylation in Case	9.74E-02 (Median)	Methylation in Control	1.00E-01 (Median)
Studied Phenotype	Systemic lupus erythematosus [ ICD-11: 4A40.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of ABCG2 in systemic lupus erythematosus			[ 17 ]
Location	TSS200 (cg01263075)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.02E+00	Statistic Test	p-value: 6.00E-03; Z-score: -1.22E-01
Methylation in Case	8.00E-02 (Median)	Methylation in Control	8.20E-02 (Median)
Studied Phenotype	Systemic lupus erythematosus [ ICD-11: 4A40.0]
Experimental Material	Patient tissue samples
HIV infection	2 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of ABCG2 in HIV infection			[ 18 ]
Location	TSS200 (cg03415858)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.09E+00	Statistic Test	p-value: 1.25E-02; Z-score: 4.98E-01
Methylation in Case	5.89E-02 (Median)	Methylation in Control	5.39E-02 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of ABCG2 in HIV infection			[ 18 ]
Location	Body (cg04064583)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.42E+00	Statistic Test	p-value: 5.66E-05; Z-score: 1.86E+00
Methylation in Case	2.74E-01 (Median)	Methylation in Control	1.92E-01 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Lung adenocarcinoma	2 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of ABCG2 in lung adenocarcinoma			[ 19 ]
Location	TSS200 (cg26489994)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.19E+00	Statistic Test	p-value: 1.27E-02; Z-score: -1.30E+00
Methylation in Case	3.39E-02 (Median)	Methylation in Control	4.03E-02 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of ABCG2 in lung adenocarcinoma			[ 19 ]
Location	Body (cg04064583)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.18E+00	Statistic Test	p-value: 3.40E-02; Z-score: 1.16E+00
Methylation in Case	2.06E-01 (Median)	Methylation in Control	1.74E-01 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Colon cancer	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of ABCG2 in colon adenocarcinoma			[ 20 ]
Location	Body (cg04310063)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.16E+00	Statistic Test	p-value: 1.63E-03; Z-score: -3.79E+00
Methylation in Case	6.73E-01 (Median)	Methylation in Control	7.84E-01 (Median)
Studied Phenotype	Colon cancer [ ICD-11: 2B90]
Experimental Material	Patient tissue samples
Nodular goiter	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Hypomethylation of ABCG2 in nodular goiter			[ 42 ]
Location	Promoter
Epigenetic Type	Methylation	Experiment Method	Methylation-sensitive PCR
Studied Phenotype	Nodular goiter [ ICD-11: 5A01.Z]
Experimental Material	Patient tissue samples
Additional Notes	Promoter methylation of ABCG2 was significantly positively associated with a family history of thyroid diseases (P < 0.05).
Melanocytoma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Moderate hypermethylation of ABCG2 in melanocytoma than that in healthy individual
Studied Phenotype	Melanocytoma [ICD-11:2F36.2]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 0.000153163; Fold-change: 0.217764519; Z-score: 6.04339989
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Histone acetylation
Acute myeloid leukemia	3 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Hypoacetylation of ABCG2 in acute myeloid leukemia (compare with valproate-treatment counterpart AML cells)			[ 21 ]
Location	Promoter
Epigenetic Type	Histone acetylation	Experiment Method	Chromatin immunoprecipitation
Related Molecular Changes	Down regulation of ABCG2	Experiment Method	RT-qPCR
Studied Phenotype	Acute myeloid leukemia [ ICD-11: 2A60]
Experimental Material	Multiple cell lines of human
Additional Notes	Chromatin immunoprecipitation revealed the?hyperacetylation?of?histone?proteins in the promoter regions of?BCRP on valproate treatment.
Epigenetic Phenomenon 2	Hypoacetylation of ABCG2 in AML (compare with valproate treatment counterpart cells)			[ 21 ]
Location	Promoter
Epigenetic Type	Histone acetylation	Experiment Method	Chromatin immunoprecipitation
Related Molecular Changes	Down regulation of ABCG2	Experiment Method	Western Blot
Studied Phenotype	Acute myeloid leukemia [ ICD-11: 2A60]
Experimental Material	Multiple cell lines of human
Additional Notes	Hyperacetylation of histone proteins in the promoter regions of BCRP on valproate treatment.
Epigenetic Phenomenon 3	Hypoacetylation of ABCG2 in AML (compare with valproate treatment counterpart cells)			[ 21 ]
Location	Promoter
Epigenetic Type	Histone acetylation	Experiment Method	Chromatin immunoprecipitation
Related Molecular Changes	Down regulation of ABCG2	Experiment Method	Western Blot
Studied Phenotype	Acute myeloid leukemia [ ICD-11: 2A60]
Experimental Material	Multiple cell lines of human
Additional Notes	Hyperacetylation of histone proteins in the promoter regions of BCRP on valproate treatment.
Breast cancer	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Hypoacetylation of ABCG2 in breast cancer (compare with doxorubicin-resistant counterpart cells)			[ 22 ]
Location	Promoter
Epigenetic Type	Histone acetylation	Experiment Method	Chromatin immunoprecipitation
Related Molecular Changes	Down regulation of ABCG2	Experiment Method	RT-qPCR
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Multiple cell lines of human
Additional Notes	High acetylation level of histone H3 of ABCG2 in doxorubicin-resistant breast cancer cells associated with higher ABCG2 expression.
Colon cancer	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Hypoacetylation of ABCG2 in colon cancer (compare with romidepsin-resistant counterpart cells)			[ 23 ]
Location	Promoter
Epigenetic Type	Histone acetylation	Experiment Method	Chromatin immunoprecipitation
Related Molecular Changes	Down regulation of ABCG2	Experiment Method	RT-qPCR
Studied Phenotype	Colon cancer [ ICD-11: 2B90]
Experimental Material	Multiple cell lines of human
Additional Notes	High acetylation level of histone H3 of ABCG2 in romidepsin-resistant colon cancer cells associated with higher ABCG2 expression.
Promyeloblastic leukemia	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Hypoacetylation of ABCG2 in acute myeloid leukemia (compare with valproate-treatment counterpart AML cells)			[ 24 ]
Epigenetic Type	Histone acetylation	Experiment Method	Chromatin immunoprecipitation
Related Molecular Changes	Down regulation of ABCG2	Experiment Method	RT-qPCR
Studied Phenotype	Promyeloblastic leukemia [ ICD-11: 2A60.0]
Experimental Material	Human leukemia stem cell-like cell line (KG-1a)
Additional Notes	Exposure of promyeloblastic leukemia cells for 24 h to 2 mM of the weak histone deacetylase inhibitor phenylbutyrate resulted in enhanced and marked expression of BCRP.
microRNA
Breast cancer	5 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Higher expression of miR-106a in breast cancer (compare with adjacent normal tissue)			[ 25 ]
Epigenetic Type	microRNA	Experiment Method	.
Related Molecular Changes	Up regulation of ABCG2	Experiment Method	Western Blot
miRNA Stemloop ID	miR-106a	miRNA Mature ID	miR-106a-5p
miRNA Sequence	AAAAGUGCUUACAGUGCAGGUAG
miRNA Target Type	Unknown
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Multiple cell lines of human
Additional Notes	miRNA-106a was upregulated in human breast cancer tissues. miRNA-106a promoted the proliferation, clonogenicity, migration, and invasion of breast cancer MCF-7 and MDA-MB-231 cells, and decreased their apoptosis.
Epigenetic Phenomenon 2	Higher expression of miR-181a in breast cancer (compare with mitoxantrone-resistant cells)			[ 28 ]
Epigenetic Type	microRNA	Experiment Method	Luciferase reporter assay
Related Molecular Changes	Down regulation of ABCG2	Experiment Method	RT-qPCR
miRNA Stemloop ID	miR-181a	miRNA Mature ID	miR-181a-5p
miRNA Sequence	AACAUUCAACGCUGUCGGUGAGU
miRNA Target Type	Direct
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Human breast adenocarcinoma cell line (MCF-7)
Additional Notes	miR-181a was down-regulated in mitoxantrone-resistant MCF-7/MX cells and regulated BCRP expression via binding to the 3-UTR of BCRP mRNA.
Epigenetic Phenomenon 3	Higher expression of miR-200c in breast cancer (compare with doxorubicin-resistant cells)			[ 29 ]
Epigenetic Type	microRNA	Experiment Method	Bioinformatic prediction
Related Molecular Changes	Down regulation of ABCG2	Experiment Method	RT-qPCR
miRNA Stemloop ID	miR-200c	miRNA Mature ID	Unclear
miRNA Target Type	Direct
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Human breast adenocarcinoma cell line (MCF-7)
Additional Notes	Down-regulation of microRNA-200c is associated with drug resistance in human breast cancer.
Epigenetic Phenomenon 4	Higher expression of miR-328 in breast cancer (compare with mitoxantrone-resistant cells)			[ 32 ]
Epigenetic Type	microRNA	Experiment Method	Luciferase reporter assay
Related Molecular Changes	Down regulation of ABCG2	Experiment Method	Western Blot
miRNA Stemloop ID	miR-328	miRNA Mature ID	miR-328-3p
miRNA Sequence	CUGGCCCUCUCUGCCCUUCCGU
miRNA Target Type	Direct
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Human breast adenocarcinoma cell line (MCF-7)
Additional Notes	miR-328 negatively regulates ABCG2 protein expression by acting on the 3-UTR segment and that repression of ABCG2 expression via miR-328-mediated pathway is translated into significantly increased drug sensitivity in cancer cells.
Epigenetic Phenomenon 5	Higher expression of miR-487a in breast cancer (compare with mitoxantrone-resistant cells)			[ 34 ]
Epigenetic Type	microRNA	Experiment Method	Luciferase reporter assay
Related Molecular Changes	Down regulation of ABCG2	Experiment Method	Western Blot
miRNA Stemloop ID	miR-487a	miRNA Mature ID	miR-487a-3p
miRNA Sequence	AAUCAUACAGGGACAUCCAGUU
miRNA Target Type	Direct
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Human breast adenocarcinoma cell line (MCF-7)
Additional Notes	miR-487a can directly regulate BCRP expression and reverse chemotherapeutic drug resistance in a subset of breast cancers.
Gastric cancer	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Higher expression of miR-132 in Lgr5+ gastric cancer (compare with Lgr5- counterpart cells)			[ 26 ]
Epigenetic Type	microRNA	Experiment Method	Luciferase reporter assay
Related Molecular Changes	Up regulation of ABCG2	Experiment Method	RT-qPCR
miRNA Stemloop ID	miR-132	miRNA Mature ID	miR-132-3p
miRNA Sequence	UAACAGUCUACAGCCAUGGUCG
miRNA Target Type	Indirect(SIRT1; CREB; ABCG2)
Studied Phenotype	Gastric cancer [ ICD-11: 2B72]
Experimental Material	Multiple cell lines of human; Model organism in vivo (mouse)
Additional Notes	The expression of miR132 was inversely correlated with SIRT1 in gastric cancer. Down-regulation of SIRT1 led to a subsequent increase of the level of acetylated CREB which in turn activated the ABCG2 signaling pathway.
Glioma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Higher expression of miR-145 in glioma (compare with glioma stem cells)			[ 27 ]
Epigenetic Type	microRNA	Experiment Method	Luciferase reporter assay
Related Molecular Changes	Down regulation of ABCG2	Experiment Method	RT-qPCR
miRNA Stemloop ID	miR-145	miRNA Mature ID	miR-145-5p
miRNA Sequence	GUCCAGUUUUCCCAGGAAUCCCU
miRNA Target Type	Direct
Studied Phenotype	Glioma [ ICD-11: 2A00.0]
Experimental Material	Chinese patient tissue samples
Additional Notes	miR-145 downregulated ABCG2 expression, and miR-145-ABCG2MMP-2/9 pathway regulated the migration and invasion in GSCs.
Chronic myeloid leukemia	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Higher expression of miR-212 in chronic myeloid leukemia (compare with imatinib-resistant cells)			[ 30 ]
Epigenetic Type	microRNA	Experiment Method	Luciferase reporter assay
Related Molecular Changes	Down regulation of ABCG2	Experiment Method	RT-qPCR
miRNA Stemloop ID	miR-212	miRNA Mature ID	Unclear
miRNA Target Type	Direct
Studied Phenotype	Chronic myeloid leukemia [ ICD-11: 2B33.1]
Experimental Material	Human immortalized myelogenous leukemia cell line(K-562)
Additional Notes	Short-term and long-term imatinib treatment downregulates miR-212 expression, leading to the abolition of suppression of ABCG2 gene expression.
Tongue squamous cell carcinoma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Higher expression of miR-212 in squamous cell carcinoma (compare with cisplatin-resistant cells)			[ 31 ]
Epigenetic Type	microRNA	Experiment Method	Dual-luciferase reporter assay
Related Molecular Changes	Down regulation of ABCG2	Experiment Method	Western Blot
miRNA Stemloop ID	miR-222	miRNA Mature ID	miR-222-3p
miRNA Sequence	AGCUACAUCUGGCUACUGGGU
miRNA Target Type	Direct
Studied Phenotype	Tongue squamous cell carcinoma [ ICD-11: 2B61.0]
Experimental Material	Patient tissue samples
Additional Notes	miR-222 overexpression may increase the sensitivity of tongue squamous cell carcinoma to cisplatin by targeting ABCG2.
Colorectal cancer	2 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Higher expression of miR-328 in colorectal cancer (compare with adjacent normal tissue)			[ 33 ]
Epigenetic Type	microRNA	Experiment Method	Luciferase reporter assay
Related Molecular Changes	Down regulation of ABCG2	Experiment Method	RT-qPCR
miRNA Stemloop ID	miR-328	miRNA Mature ID	miR-328-3p
miRNA Sequence	CUGGCCCUCUCUGCCCUUCCGU
miRNA Target Type	Direct
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Multiple cell lines of human
Additional Notes	miR-328 downregulates ABCG2 in colorectal cancer.
Epigenetic Phenomenon 2	Lower expression of miR-519c in colorectal cancer (compare with adjacent normal tissue)			[ 37 ]
Epigenetic Type	microRNA	Experiment Method	Ribonucleoprotein immunoprecipitation
Related Molecular Changes	Down regulation of ABCG2	Experiment Method	RT-qPCR
miRNA Stemloop ID	miR-519c	miRNA Mature ID	miR-519c-3p
miRNA Sequence	AAAGUGCAUCUUUUUAGAGGAU
miRNA Target Type	Indirect(HuR; ABCG2)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Multiple cell lines of human
Additional Notes	miR-519c downregulates ABCG2 via miR-519c/HuR/ ABCG2 pathway.
Prostate cancer	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Lower expression of miR-133b in prostate cancer (compare with adjacent normal tissue)			[ 35 ]
Epigenetic Type	microRNA	Experiment Method	Luciferase reporter assay
Related Molecular Changes	Down regulation of ABCG2	Experiment Method	RT-qPCR
miRNA Stemloop ID	miR-133b	miRNA Mature ID	Unclear
miRNA Target Type	Indirect(HuR; ABCG2)
Studied Phenotype	Prostate cancer [ ICD-11: 2C82]
Experimental Material	Multiple cell lines of human
Additional Notes	miR-133b downregulates ABCG2 via miR-133b/HuR/ ABCG2 pathway.
Non-small cell lung cancer	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Lower expression of miR-495 in non-small cell lung cancer (compare with adjacent normal tissue)			[ 36 ]
Epigenetic Type	microRNA	Experiment Method	Luciferase reporter assay
Related Molecular Changes	Down regulation of ABCG2	Experiment Method	Western Blot
miRNA Stemloop ID	miR-495	miRNA Mature ID	miR-495-5p
miRNA Sequence	GAAGUUGCCCAUGUUAUUUUCG
miRNA Target Type	Indirect(UBE2C; ABCG2)
Studied Phenotype	Non-small cell lung cancer [ ICD-11: 2C25.4]
Experimental Material	Multiple cell lines of human
Additional Notes	The miR495-UBE2C-ABCG2/ERCC1 axis reverses DDP resistance via downregulation of anti-drug genes and reducing EMT in DDP-resistant NSCLC cells.
Colon cancer	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	miR-142-3p downregulates ABCG2 expression in colon cancer			[ 38 ]
Epigenetic Type	microRNA	Experiment Method	Luciferase reporter assay
Related Molecular Changes	Down regulation of ABCG2	Experiment Method	RT-qPCR
miRNA Stemloop ID	miR-142	miRNA Mature ID	miR-142-3p
miRNA Sequence	UGUAGUGUUUCCUACUUUAUGGA
miRNA Target Type	Direct
Studied Phenotype	Colon cancer [ ICD-11: 2B90]
Experimental Material	Multiple cell lines of human
Additional Notes	OCT4 promoter is hypomethylated in colon cancer tissues, resulting in persistent low levels of miR-142-3p. The repression of miR-142-3p results in loss of inhibition of CD133, Lgr5, and ABCG2 in the cancer cells.
Retinoblastoma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	miR-3163 downregulates ABCG2 expression			[ 39 ]
Epigenetic Type	microRNA	Experiment Method	Luciferase reporter assay
Related Molecular Changes	Down regulation of ABCG2	Experiment Method	Western Blot
miRNA Stemloop ID	miR-3163	miRNA Mature ID	miR-3163
miRNA Sequence	UAUAAAAUGAGGGCAGUAAGAC
miRNA Target Type	Direct
Studied Phenotype	Retinoblastoma [ ICD-11: 2D02.2]
Experimental Material	Human retinoblastoma cell line (WERI-Rb1)
Additional Notes	miR-3163 has a significant impact on ABCG2 expression and can influence proliferation, apoptosis, and drug resistance in RCSCs.
Hepatocellular carcinoma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	miR-491 regulates ABCG2 expression in hepatocellular carcinoma			[ 40 ]
Epigenetic Type	microRNA	Experiment Method	Luciferase reporter assay
Related Molecular Changes	Down regulation of ABCG2	Experiment Method	Western Blot
miRNA Stemloop ID	miR-491	miRNA Mature ID	miR-491-5p
miRNA Sequence	AGUGGGGAACCCUUCCAUGAGG
miRNA Target Type	Direct
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Hepatocellular carcinoma cell line (MHCC-97L)
Additional Notes	Aspirin enhanced the sensitivity of side population cells to doxorubicin via regulating the miR-491/ABCG2 signaling pathway.
Pancreatic cancer	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	miR-520h regulates ABCG2 expression			[ 41 ]
Epigenetic Type	microRNA	Experiment Method	Bioinformatic prediction
Related Molecular Changes	Down regulation of ABCG2	Experiment Method	RT-qPCR
miRNA Stemloop ID	miR-520h	miRNA Mature ID	miR-520h
miRNA Sequence	ACAAAGUGCUUCCCUUUAGAGU
miRNA Target Type	Direct
Studied Phenotype	Pancreatic cancer [ ICD-11: 2C10]
Experimental Material	Multiple cell lines of human
Additional Notes	miR-520h downregulates ABCG2 in pancreatic cancer cells to inhibit migration, invasion, and side populations.
Unclear Phenotype	25 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	miR-10a directly targets ABCG2			[ 43 ]
Epigenetic Type	microRNA	Experiment Method	CLASH
miRNA Stemloop ID	miR-10a	miRNA Mature ID	miR-10a-5p
miRNA Sequence	UACCCUGUAGAUCCGAAUUUGUG
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 2	miR-142 directly targets ABCG2			[ 38 ]
Epigenetic Type	microRNA	Experiment Method	Luciferase reporter assay//Western blot
miRNA Stemloop ID	miR-142	miRNA Mature ID	miR-142-3p
miRNA Sequence	UGUAGUGUUUCCUACUUUAUGGA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 3	miR-16-2 directly targets ABCG2			[ 44 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-16-2	miRNA Mature ID	miR-16-2-3p
miRNA Sequence	CCAAUAUUACUGUGCUGCUUUA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 4	miR-181a directly targets ABCG2			[ 28 ]
Epigenetic Type	microRNA	Experiment Method	Luciferase reporter assay//Microarray//qRT-PCR//Western blot
miRNA Stemloop ID	miR-181a	miRNA Mature ID	miR-181a-5p
miRNA Sequence	AACAUUCAACGCUGUCGGUGAGU
miRNA Target Type	Direct
Experimental Material	Human breast adenocarcinoma cell line (MCF-7)
Epigenetic Phenomenon 5	miR-192 directly targets ABCG2			[ 45 ]
Epigenetic Type	microRNA	Experiment Method	Microarray
miRNA Stemloop ID	miR-192	miRNA Mature ID	miR-192-5p
miRNA Sequence	CUGACCUAUGAAUUGACAGCC
miRNA Target Type	Direct
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	miR-195 directly targets ABCG2			[ 44 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-195	miRNA Mature ID	miR-195-3p
miRNA Sequence	CCAAUAUUGGCUGUGCUGCUCC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 7	miR-222 directly targets ABCG2			[ 31 ]
Epigenetic Type	microRNA	Experiment Method	Luciferase reporter assay
miRNA Stemloop ID	miR-222	miRNA Mature ID	miR-222-3p
miRNA Sequence	AGCUACAUCUGGCUACUGGGU
miRNA Target Type	Direct
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	miR-26b directly targets ABCG2			[ 46 ]
Epigenetic Type	microRNA	Experiment Method	Microarray
miRNA Stemloop ID	miR-26b	miRNA Mature ID	miR-26b-5p
miRNA Sequence	UUCAAGUAAUUCAGGAUAGGU
miRNA Target Type	Direct
Experimental Material	Human cervical cancer cell line (Hela)
Epigenetic Phenomenon 9	miR-3167 directly targets ABCG2			[ 44 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-3167	miRNA Mature ID	miR-3167
miRNA Sequence	AGGAUUUCAGAAAUACUGGUGU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 10	miR-328 directly targets ABCG2			[ 33 ]
Epigenetic Type	microRNA	Experiment Method	Luciferase reporter assay//qRT-PCR//Western blot
miRNA Stemloop ID	miR-328	miRNA Mature ID	miR-328-3p
miRNA Sequence	CUGGCCCUCUCUGCCCUUCCGU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 11	miR-340 directly targets ABCG2			[ 47 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-340	miRNA Mature ID	miR-340-5p
miRNA Sequence	UUAUAAAGCAAUGAGACUGAUU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 12	miR-369 directly targets ABCG2			[ 44 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-369	miRNA Mature ID	miR-369-3p
miRNA Sequence	AAUAAUACAUGGUUGAUCUUU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 13	miR-374a directly targets ABCG2			[ 44 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-374a	miRNA Mature ID	miR-374a-5p
miRNA Sequence	UUAUAAUACAACCUGAUAAGUG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 14	miR-374b directly targets ABCG2			[ 44 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-374b	miRNA Mature ID	miR-374b-5p
miRNA Sequence	AUAUAAUACAACCUGCUAAGUG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 15	miR-4539 directly targets ABCG2			[ 47 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-4539	miRNA Mature ID	miR-4539
miRNA Sequence	GCUGAACUGGGCUGAGCUGGGC
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 16	miR-4635 directly targets ABCG2			[ 44 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-4635	miRNA Mature ID	miR-4635
miRNA Sequence	UCUUGAAGUCAGAACCCGCAA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 17	miR-4724 directly targets ABCG2			[ 47 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-4724	miRNA Mature ID	miR-4724-5p
miRNA Sequence	AACUGAACCAGGAGUGAGCUUCG
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 18	miR-487a directly targets ABCG2			[ 34 ]
Epigenetic Type	microRNA	Experiment Method	Luciferase reporter assay//qRT-PCR//Western blot
miRNA Stemloop ID	miR-487a	miRNA Mature ID	miR-487a-3p
miRNA Sequence	AAUCAUACAGGGACAUCCAGUU
miRNA Target Type	Direct
Experimental Material	Human breast adenocarcinoma cell line (MCF-7)
Epigenetic Phenomenon 19	miR-497 directly targets ABCG2			[ 47 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-497	miRNA Mature ID	miR-497-3p
miRNA Sequence	CAAACCACACUGUGGUGUUAGA
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 20	miR-520h directly targets ABCG2			[ 41 ]
Epigenetic Type	microRNA	Experiment Method	qRT-PCR//Western blot
miRNA Stemloop ID	miR-520h	miRNA Mature ID	miR-520h
miRNA Sequence	ACAAAGUGCUUCCCUUUAGAGU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 21	miR-5692b directly targets ABCG2			[ 44 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-5692b	miRNA Mature ID	miR-5692b
miRNA Sequence	AAUAAUAUCACAGUAGGUGU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 22	miR-5692c directly targets ABCG2			[ 44 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-5692c	miRNA Mature ID	miR-5692c
miRNA Sequence	AAUAAUAUCACAGUAGGUGUAC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 23	miR-7158 directly targets ABCG2			[ 47 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-7158	miRNA Mature ID	miR-7158-3p
miRNA Sequence	CUGAACUAGAGAUUGGGCCCA
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 24	miR-876 directly targets ABCG2			[ 44 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-876	miRNA Mature ID	miR-876-5p
miRNA Sequence	UGGAUUUCUUUGUGAAUCACCA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 25	miR-889 directly targets ABCG2			[ 44 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-889	miRNA Mature ID	miR-889-3p
miRNA Sequence	UUAAUAUCGGACAACCAUUGU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human

References
1	Expression and promoter methylation analysis of ATP-binding cassette genes in pancreatic cancer. Oncol Rep. 2012 Jan;27(1):265-9.
2	c-MYC oncoprotein dictates transcriptional profiles of ATP-binding cassette transporter genes in chronic myelogenous leukemia CD34+ hematopoietic progenitor cells. Mol Cancer Res. 2011 Aug;9(8):1054-66.
3	Methylation status of breast cancer resistance protein detected by methylation-specific polymerase chain reaction analysis is correlated inversely with its expression in drug-resistant lung cancer cells. Cancer. 2008 Mar 1;112(5):1122-30.
4	ABCG2 expression, function, and promoter methylation in human multiple myeloma. Blood. 2006 Dec 1;108(12):3881-9.
5	Aberrant promoter methylation of the ABCG2 gene in renal carcinoma. Mol Cell Biol. 2006 Nov;26(22):8572-85.
6	Epigenetic modulation of the drug resistance genes MGMT, ABCB1 and ABCG2 in glioblastoma multiforme. BMC Cancer. 2013 Dec 31;13:617.
7	Atypical Teratoid/Rhabdoid Tumors Are Comprised of Three Epigenetic Subgroups with Distinct Enhancer Landscapes. Cancer Cell. 2016 Mar 14;29(3):379-393.
8	DNA Methylation Dynamics in Urological Tumors.
9	Genome-wide Scan for Methylation Profiles in Breast Cancer
10	Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
11	DNA Methylation signatures in panic disorder. Transl Psychiatry. 2017 Dec 18;7(12):1287.
12	A CpG-methylation-based assay to predict survival in clear cell renal cell carcinoma. Nat Commun. 2015 Oct 30;6:8699.
13	Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
14	DNA methylation and inflammation marker profiles associated with a history of depression. Hum Mol Genet. 2018 Aug 15;27(16):2840-2850.
15	Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
16	Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
17	Genome-wide DNA methylation analysis of systemic lupus erythematosus reveals persistent hypomethylation of interferon genes and compositional changes to CD4+ T-cell populations. PLoS Genet. 2013;9(8):e1003678.
18	HIV-1 Infection Accelerates Age According to the Epigenetic Clock. J Infect Dis. 2015 Nov 15;212(10):1563-73.
19	DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
20	Genome-scale analysis of DNA methylation in colorectal cancer using Infinium HumanMethylation450 BeadChips. Epigenetics. 2013 Sep;8(9):921-34.
21	Histone deacetylase inhibitors induce a very broad, pleiotropic anticancer drug resistance phenotype in acute myeloid leukemia cells by modulation of multiple ABC transporter genes. Clin Cancer Res. 2009 Jun 1;15(11):3705-15.
22	Single-step doxorubicin-selected cancer cells overexpress the ABCG2 drug transporter through epigenetic changes. Br J Cancer. 2008 May 6;98(9):1515-24.
23	Histone modifications at the ABCG2 promoter following treatment with histone deacetylase inhibitor mirror those in multidrug-resistant cells. Mol Cancer Res. 2008 Jan;6(1):151-64.
24	Salinomycin overcomes ABC transporter-mediated multidrug and apoptosis resistance in human leukemia stem cell-like KG-1a cells. Biochem Biophys Res Commun. 2010 Apr 16;394(4):1098-104.
25	miRNA-106a Promotes Breast Cancer Cell Proliferation, Clonogenicity, Migration, and Invasion Through Inhibiting Apoptosis and Chemosensitivity. DNA Cell Biol. 2019 Feb;38(2):198-207.
26	Upregulated miR-132 in Lgr5+ gastric cancer stem cell-like cells contributes to cisplatin-resistance via SIRT1/CREB/ABCG2 signaling pathway. Mol Carcinog. 2017 Sep;56(9):2022-2034.
27	Escape from hsa-miR-519c enables drug-resistant cells to maintain high expression of ABCG2. Mol Cancer Ther. 2009 Oct;8(10):2959-68.
28	MiR-181a enhances drug sensitivity in mitoxantone-resistant breast cancer cells by targeting breast cancer resistance protein (BCRP/ABCG2). Breast Cancer Res Treat. 2013 Jun;139(3):717-30.
29	MicroRNA-199a targets CD44 to suppress the tumorigenicity and multidrug resistance of ovarian cancer-initiating cells. FEBS J. 2012 Jun;279(11):2047-59.
30	MicroRNA profiling in K-562 cells under imatinib treatment: influence of miR-212 and miR-328 on ABCG2 expression. Pharmacogenet Genomics. 2012 Mar;22(3):198-205.
31	Deregulation of the miR-222-ABCG2 regulatory module in tongue squamous cell carcinoma contributes to chemoresistance and enhanced migratory/invasive potential. Oncotarget. 2015 Dec 29;6(42):44538-50.
32	MicroRNA-328 negatively regulates the expression of breast cancer resistance protein (BCRP/ABCG2) in human cancer cells. Mol Pharmacol. 2009 Jun;75(6):1374-9.
33	MicroRNA expression profiling identifies miR-328 regulates cancer stem cell-like SP cells in colorectal cancer. Br J Cancer. 2012 Mar 27;106(7):1320-30.
34	MiR-487a resensitizes mitoxantrone (MX)-resistant breast cancer cells (MCF-7/MX) to MX by targeting breast cancer resistance protein (BCRP/ABCG2). Cancer Lett. 2013 Oct 1;339(1):107-15.
35	Posttranscriptional Regulation of Human Antigen R by miR-133b Enhances Docetaxel Cytotoxicity Through the Inhibition of ATP-Binding Cassette Subfamily G Member 2 in Prostate Cancer Cells. DNA Cell Biol. 2018 Mar;37(3):210-219.
36	The miR 495-UBE2C-ABCG2/ERCC1 axis reverses cisplatin resistance by downregulating drug resistance genes in cisplatin-resistant non-small cell lung cancer cells. EBioMedicine. 2018 Sep;35:204-221.
37	Exploiting a novel miR-519c-HuR-ABCG2 regulatory pathway to overcome chemoresistance in colorectal cancer. Exp Cell Res. 2015 Nov 1;338(2):222-31.
38	MiR-142-3p functions as a tumor suppressor by targeting CD133, ABCG2, and Lgr5 in colon cancer cells. J Mol Med (Berl). 2013 Aug;91(8):989-1000.
39	Silencing of ABCG2 by MicroRNA-3163 Inhibits Multidrug Resistance in Retinoblastoma Cancer Stem Cells. J Korean Med Sci. 2016 Jun;31(6):836-42.
40	Aspirin enhances the sensitivity of hepatocellular carcinoma side population cells to doxorubicin via miR-491/ABCG2. Biosci Rep. 2018 Nov 9;38(6). pii: BSR20180854.
41	hsa-miR-520h downregulates ABCG2 in pancreatic cancer cells to inhibit migration, invasion, and side populations. Br J Cancer. 2010 Aug 10;103(4):567-74.
42	Aberrant DNA methylation of drug metabolism and transport genes in nodular goiter. Thyroid Res. 2011 Oct 12;4(1):15.
43	Mapping the human miRNA interactome by CLASH reveals frequent noncanonical binding. Cell. 2013 Apr 25;153(3):654-65.
44	Viral microRNA targetome of KSHV-infected primary effusion lymphoma cell lines. Cell Host Microbe. 2011 Nov 17;10(5):515-26.
45	A limited set of human MicroRNA is deregulated in follicular thyroid carcinoma. J Clin Endocrinol Metab. 2006 Sep;91(9):3584-91.
46	MicroRNA target prediction by expression analysis of host genes. Genome Res. 2009 Mar;19(3):481-90.
47	Genome-wide identification of microRNA targets in human ES cells reveals a role for miR-302 in modulating BMP response. Genes Dev. 2011 Oct 15;25(20):2173-86.

If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.

Detail Information of Epigenetic Regulations

Visitor Map

Correspondence