Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID DTD0005 Transporter Info
Gene Name SLC22A7
Transporter Name Organic anion transporter 2
Gene ID
10864
UniProt ID
Q9Y694
Epigenetic Regulations of This DT (EGR)

Histone acetylation

  Hepatocellular carcinoma

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Hypoacetylation of SLC22A7 in Hepatocellular carcinoma (compare with non-tumor adjacent tissue) [ 1 ]

Location

 Promoter

Epigenetic Type

 Histone acetylation Experiment Method RT-qPCR

Related Molecular Changes

 Down regulation of SLC22A7 Experiment Method Western Blot

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Hepatocellular carcinoma cell lines (BEL-7402 and SMMC-7721)

Additional Notes

 Significant increases in SLC22A7 mRNA were observed when these cancer cells were cultured in the presence of histone deacetylase (HDAC) inhibitors.

microRNA

  Human liver tissue

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 miR-29a-3p downregulates SLC22A7 expression in human liver cells [ 2 ]

Epigenetic Type

 microRNA Experiment Method Luciferase reporter assay

Related Molecular Changes

 Down regulation of SLC22A7 Experiment Method Western Blot

miRNA Stemloop ID

 miR-29a miRNA Mature ID miR-29a-3p

miRNA Sequence

 UAGCACCAUCUGAAAUCGGUUA

miRNA Target Type

 Direct

Studied Phenotype

 Human liver tissue

Experimental Material

 Multiple cell lines of human

Additional Notes

 Chemically-induced up-regulation of hsa-miR-29a-3p correlated inversely with the expression of SLC22A7.

  Unclear Phenotype

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 miR-29a directly targets SLC22A7 [ 2 ]

Epigenetic Type

 microRNA Experiment Method EMSA//Luciferase reporter assay//qRT-PCR//Western blot

miRNA Stemloop ID

 miR-29a miRNA Mature ID miR-29a-3p

miRNA Sequence

 UAGCACCAUCUGAAAUCGGUUA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

Methylation

  Lymphoma

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Significant hypomethylation of SLC22A7 in lymphoma than that in healthy individual

Studied Phenotype

 Lymphoma [ICD-11:2B30]

The Methylation Level of Disease Section Compare with the Healthy Individual

 p-value: 3.25E-16; Fold-change: -0.479825162; Z-score: -6.496538846
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue
Download DT methylation data in the tissue of healthy individual
References
1 Proteomic and Biochemical Studies of Lysine Malonylation Suggest Its Malonic Aciduria-associated Regulatory Role in Mitochondrial Function and Fatty Acid Oxidation. Mol Cell Proteomics. 2015 Nov;14(11):3056-71.
2 Modulation of ALDH5A1 and SLC22A7 by microRNA hsa-miR-29a-3p in human liver cells. Biochem Pharmacol. 2015 Dec 15;98(4):671-80.

If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.