Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID	DTD0006 Transporter Info
Gene Name	SLC22A2
Transporter Name	Organic cation transporter 2
Gene ID	6582
UniProt ID	O15244

Epigenetic Regulations of This DT (EGR)
Methylation
Renal cell carcinoma	4 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Hypermethylation of SLC22A2 in renal cell carcinoma			[ 1 ]
Location	Proximal promoter
Epigenetic Type	Methylation	Experiment Method	Bisulfite sequencing
Related Molecular Changes	Down regulation of SLC22A2	Experiment Method	RT-qPCR
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Frequency	70% of the studied tumor samples
Experimental Material	Patient tissue samples
Additional Notes	All CpG sites in the OCT2 proximal promoter were hypomethylated in the kidney.
Epigenetic Phenomenon 2	Hypermethylation of SLC22A2 in renal cell carcinoma			[ 2 ]
Location	Promoter
Epigenetic Type	Methylation	Experiment Method	Bisulfite sequencing PCR
Related Molecular Changes	Down regulation of SLC22A2	Experiment Method	RT-qPCR
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Frequency	In all three RCC lines (786-O, 769-P, and Caki-1)
Experimental Material	Multiple cell lines of human; Patients tissue samples
Additional Notes	DNA Hypermethylation blocked MYC activation of OCT2 by disrupting its interaction with the E-Box motif, which prevented MYC from recruiting MLL1 to catalyze H3K4me3 at the OCT2 promoter and resulted in repressed OCT2 transcription.
Epigenetic Phenomenon 3	Hypermethylation of SLC22A2 in renal cell carcinoma			[ 5 ]
Location	Promoter (10 CpG sites)
Epigenetic Type	Methylation	Experiment Method	HumanMethylation450 BeadChip
Related Molecular Changes	Down regulation of SLC22A2	Experiment Method	Affymetrix Human Transcriptome 2.0 microarrays
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Multiple cell lines of human
Additional Notes	In RCC cell lines, OCT2 protein expression is downregulated due to Hypermethylation in the SLC22A2 promoter region compared to primary tumors or metastases.
Esophageal cancer	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Hypermethylation of SLC22A2 in cisplatin-resistant esophageal cancer (compare with parental cells)			[ 3 ]
Location	Promoter
Epigenetic Type	Methylation	Experiment Method	Methylation-sensitive PCR
Related Molecular Changes	Down regulation of SLC22A2	Experiment Method	Western Blot
Studied Phenotype	Esophageal cancer [ ICD-11: 2B70]
Experimental Material	Patient tissue samples
Additional Notes	Long-term exposure to cisplatin promotes methylation of the OCT1 gene in human esophageal cancer cells.
Hepatocellular carcinoma	12 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Hypermethylation of SLC22A2 in hepatocellular carcinoma (compare with non-tumor adjacent tissues)			[ 4 ]
Location	Promoter
Epigenetic Type	Methylation	Experiment Method	MALDI-TOF MS
Related Molecular Changes	Down regulation of SLC22A2	Experiment Method	RT-qPCR
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Additional Notes	DNA methylation is associated with downregulation of the organic cation transporter OCT1 (SLC22A1) in human hepatocellular carcinoma.
Epigenetic Phenomenon 2	Methylation of SLC22A2 in hepatocellular carcinoma			[ 12 ]
Location	TSS1500 (cg07026448)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.16E+00	Statistic Test	p-value: 1.17E-08; Z-score: 1.41E+00
Methylation in Case	6.40E-01 (Median)	Methylation in Control	5.50E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC22A2 in hepatocellular carcinoma			[ 12 ]
Location	TSS1500 (cg23995605)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.01E+00	Statistic Test	p-value: 8.40E-03; Z-score: -3.12E-01
Methylation in Case	8.79E-01 (Median)	Methylation in Control	8.87E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC22A2 in hepatocellular carcinoma			[ 12 ]
Location	TSS1500 (cg14450766)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.07E+00	Statistic Test	p-value: 3.95E-02; Z-score: 3.63E-01
Methylation in Case	4.92E-01 (Median)	Methylation in Control	4.61E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC22A2 in hepatocellular carcinoma			[ 12 ]
Location	TSS200 (cg06236276)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.04E+00	Statistic Test	p-value: 8.34E-03; Z-score: 1.72E-01
Methylation in Case	6.85E-01 (Median)	Methylation in Control	6.60E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC22A2 in hepatocellular carcinoma			[ 12 ]
Location	Body (cg10473100)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.24E+00	Statistic Test	p-value: 6.30E-12; Z-score: -1.29E+01
Methylation in Case	7.82E-01 (Median)	Methylation in Control	9.73E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC22A2 in hepatocellular carcinoma			[ 12 ]
Location	Body (cg08793936)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.26E+00	Statistic Test	p-value: 1.84E-10; Z-score: -3.25E+00
Methylation in Case	5.62E-01 (Median)	Methylation in Control	7.09E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of SLC22A2 in hepatocellular carcinoma			[ 12 ]
Location	Body (cg04310488)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.46E+00	Statistic Test	p-value: 1.36E-06; Z-score: -1.32E+00
Methylation in Case	2.63E-01 (Median)	Methylation in Control	3.84E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 9	Methylation of SLC22A2 in hepatocellular carcinoma			[ 12 ]
Location	Body (cg14918008)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.02E+00	Statistic Test	p-value: 3.70E-03; Z-score: -7.65E-01
Methylation in Case	8.01E-01 (Median)	Methylation in Control	8.19E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 10	Methylation of SLC22A2 in hepatocellular carcinoma			[ 12 ]
Location	Body (cg17098387)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.07E+00	Statistic Test	p-value: 4.77E-03; Z-score: 4.43E-01
Methylation in Case	7.81E-01 (Median)	Methylation in Control	7.33E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 11	Methylation of SLC22A2 in hepatocellular carcinoma			[ 12 ]
Location	Body (cg07601258)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.01E+00	Statistic Test	p-value: 1.45E-02; Z-score: -3.44E-01
Methylation in Case	8.71E-01 (Median)	Methylation in Control	8.80E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 12	Methylation of SLC22A2 in hepatocellular carcinoma			[ 12 ]
Location	3'UTR (cg04092332)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.16E+00	Statistic Test	p-value: 5.29E-11; Z-score: -4.69E+00
Methylation in Case	7.42E-01 (Median)	Methylation in Control	8.63E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Prostate cancer	20 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC22A2 in prostate cancer			[ 6 ]
Location	5'UTR (cg13323097)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.51E+00	Statistic Test	p-value: 1.89E-04; Z-score: 5.73E+00
Methylation in Case	2.20E-01 (Median)	Methylation in Control	1.46E-01 (Median)
Studied Phenotype	Prostate cancer [ ICD-11: 2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC22A2 in prostate cancer			[ 6 ]
Location	5'UTR (cg26248082)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.19E+00	Statistic Test	p-value: 3.00E-02; Z-score: 2.67E+00
Methylation in Case	7.67E-01 (Median)	Methylation in Control	6.44E-01 (Median)
Studied Phenotype	Prostate cancer [ ICD-11: 2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC22A2 in prostate cancer			[ 6 ]
Location	TSS1500 (cg01352551)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.11E+00	Statistic Test	p-value: 3.97E-03; Z-score: 2.49E+00
Methylation in Case	8.12E-01 (Median)	Methylation in Control	7.34E-01 (Median)
Studied Phenotype	Prostate cancer [ ICD-11: 2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC22A2 in prostate cancer			[ 6 ]
Location	TSS1500 (cg17174275)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.09E+00	Statistic Test	p-value: 9.95E-03; Z-score: 2.19E+00
Methylation in Case	8.67E-01 (Median)	Methylation in Control	7.96E-01 (Median)
Studied Phenotype	Prostate cancer [ ICD-11: 2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC22A2 in prostate cancer			[ 6 ]
Location	TSS1500 (cg27043188)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.45E+00	Statistic Test	p-value: 1.29E-02; Z-score: -2.00E+00
Methylation in Case	3.22E-01 (Median)	Methylation in Control	4.66E-01 (Median)
Studied Phenotype	Prostate cancer [ ICD-11: 2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC22A2 in prostate cancer			[ 6 ]
Location	TSS1500 (cg10528482)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.21E+00	Statistic Test	p-value: 1.51E-02; Z-score: 1.57E+01
Methylation in Case	8.28E-01 (Median)	Methylation in Control	6.86E-01 (Median)
Studied Phenotype	Prostate cancer [ ICD-11: 2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC22A2 in prostate cancer			[ 6 ]
Location	TSS1500 (cg04833514)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.17E+00	Statistic Test	p-value: 1.91E-02; Z-score: 3.12E+00
Methylation in Case	8.25E-01 (Median)	Methylation in Control	7.03E-01 (Median)
Studied Phenotype	Prostate cancer [ ICD-11: 2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of SLC22A2 in prostate cancer			[ 6 ]
Location	TSS1500 (cg02707152)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.44E+00	Statistic Test	p-value: 3.01E-02; Z-score: 3.38E+00
Methylation in Case	3.34E-01 (Median)	Methylation in Control	2.31E-01 (Median)
Studied Phenotype	Prostate cancer [ ICD-11: 2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 9	Methylation of SLC22A2 in prostate cancer			[ 6 ]
Location	TSS200 (cg18335740)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.62E+00	Statistic Test	p-value: 3.86E-03; Z-score: 3.84E+00
Methylation in Case	2.91E-01 (Median)	Methylation in Control	1.80E-01 (Median)
Studied Phenotype	Prostate cancer [ ICD-11: 2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 10	Methylation of SLC22A2 in prostate cancer			[ 6 ]
Location	1stExon (cg08457872)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.05E+00	Statistic Test	p-value: 3.39E-02; Z-score: 1.73E+00
Methylation in Case	9.01E-01 (Median)	Methylation in Control	8.56E-01 (Median)
Studied Phenotype	Prostate cancer [ ICD-11: 2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 11	Methylation of SLC22A2 in prostate cancer			[ 6 ]
Location	Body (cg06635952)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 3.11E+00	Statistic Test	p-value: 4.23E-03; Z-score: 1.29E+01
Methylation in Case	6.50E-01 (Median)	Methylation in Control	2.09E-01 (Median)
Studied Phenotype	Prostate cancer [ ICD-11: 2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 12	Methylation of SLC22A2 in prostate cancer			[ 6 ]
Location	Body (cg06145736)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.21E+00	Statistic Test	p-value: 6.78E-03; Z-score: 2.70E+00
Methylation in Case	8.80E-01 (Median)	Methylation in Control	7.29E-01 (Median)
Studied Phenotype	Prostate cancer [ ICD-11: 2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 13	Methylation of SLC22A2 in prostate cancer			[ 6 ]
Location	Body (cg25575590)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.39E+00	Statistic Test	p-value: 8.54E-03; Z-score: -1.19E+01
Methylation in Case	6.48E-01 (Median)	Methylation in Control	9.02E-01 (Median)
Studied Phenotype	Prostate cancer [ ICD-11: 2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 14	Methylation of SLC22A2 in prostate cancer			[ 6 ]
Location	Body (cg15930240)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.33E+00	Statistic Test	p-value: 1.08E-02; Z-score: 1.96E+00
Methylation in Case	7.95E-01 (Median)	Methylation in Control	5.98E-01 (Median)
Studied Phenotype	Prostate cancer [ ICD-11: 2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 15	Methylation of SLC22A2 in prostate cancer			[ 6 ]
Location	Body (cg00551954)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.05E+00	Statistic Test	p-value: 1.29E-02; Z-score: 2.04E+00
Methylation in Case	9.33E-01 (Median)	Methylation in Control	8.85E-01 (Median)
Studied Phenotype	Prostate cancer [ ICD-11: 2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 16	Methylation of SLC22A2 in prostate cancer			[ 6 ]
Location	Body (cg10665321)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.45E+00	Statistic Test	p-value: 2.95E-02; Z-score: 2.02E+00
Methylation in Case	6.35E-01 (Median)	Methylation in Control	4.38E-01 (Median)
Studied Phenotype	Prostate cancer [ ICD-11: 2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 17	Methylation of SLC22A2 in prostate cancer			[ 6 ]
Location	Body (cg22931795)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.51E+00	Statistic Test	p-value: 4.02E-02; Z-score: -2.37E+00
Methylation in Case	4.12E-01 (Median)	Methylation in Control	6.20E-01 (Median)
Studied Phenotype	Prostate cancer [ ICD-11: 2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 18	Methylation of SLC22A2 in prostate cancer			[ 6 ]
Location	Body (cg04954559)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.79E+00	Statistic Test	p-value: 4.95E-02; Z-score: 4.75E+00
Methylation in Case	1.41E-01 (Median)	Methylation in Control	7.88E-02 (Median)
Studied Phenotype	Prostate cancer [ ICD-11: 2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 19	Methylation of SLC22A2 in prostate cancer			[ 6 ]
Location	3'UTR (cg09888840)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.06E+00	Statistic Test	p-value: 8.80E-03; Z-score: 3.47E+00
Methylation in Case	9.35E-01 (Median)	Methylation in Control	8.81E-01 (Median)
Studied Phenotype	Prostate cancer [ ICD-11: 2C82]
Experimental Material	Patient tissue samples
Bladder cancer	14 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC22A2 in bladder cancer			[ 7 ]
Location	TSS1500 (cg07026448)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.37E+00	Statistic Test	p-value: 6.51E-06; Z-score: 1.21E+01
Methylation in Case	6.18E-01 (Median)	Methylation in Control	4.49E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC22A2 in bladder cancer			[ 7 ]
Location	TSS1500 (cg23995605)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.05E+00	Statistic Test	p-value: 2.05E-04; Z-score: -3.50E+00
Methylation in Case	8.82E-01 (Median)	Methylation in Control	9.24E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC22A2 in bladder cancer			[ 7 ]
Location	TSS200 (cg19627213)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.57E+00	Statistic Test	p-value: 3.81E-05; Z-score: -4.72E+00
Methylation in Case	3.93E-01 (Median)	Methylation in Control	6.18E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC22A2 in bladder cancer			[ 7 ]
Location	TSS200 (cg06236276)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.11E+00	Statistic Test	p-value: 5.91E-03; Z-score: -1.99E+00
Methylation in Case	5.95E-01 (Median)	Methylation in Control	6.61E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC22A2 in bladder cancer			[ 7 ]
Location	TSS200 (cg04294894)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.06E+00	Statistic Test	p-value: 1.30E-02; Z-score: -2.26E+00
Methylation in Case	7.62E-01 (Median)	Methylation in Control	8.06E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC22A2 in bladder cancer			[ 7 ]
Location	TSS200 (cg26939503)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.17E+00	Statistic Test	p-value: 1.32E-02; Z-score: -4.78E+00
Methylation in Case	5.51E-01 (Median)	Methylation in Control	6.43E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC22A2 in bladder cancer			[ 7 ]
Location	TSS200 (cg02666489)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.08E+00	Statistic Test	p-value: 1.97E-02; Z-score: -1.90E+00
Methylation in Case	6.54E-01 (Median)	Methylation in Control	7.06E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of SLC22A2 in bladder cancer			[ 7 ]
Location	1stExon (cg27204616)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.06E+00	Statistic Test	p-value: 2.44E-03; Z-score: -4.31E+00
Methylation in Case	9.01E-01 (Median)	Methylation in Control	9.52E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 9	Methylation of SLC22A2 in bladder cancer			[ 7 ]
Location	1stExon (cg19561774)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.03E+00	Statistic Test	p-value: 2.75E-03; Z-score: -1.71E+00
Methylation in Case	8.25E-01 (Median)	Methylation in Control	8.48E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 10	Methylation of SLC22A2 in bladder cancer			[ 7 ]
Location	1stExon (cg13717233)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.03E+00	Statistic Test	p-value: 1.21E-02; Z-score: -1.31E+00
Methylation in Case	8.24E-01 (Median)	Methylation in Control	8.45E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 11	Methylation of SLC22A2 in bladder cancer			[ 7 ]
Location	Body (cg14918008)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.32E+00	Statistic Test	p-value: 8.47E-10; Z-score: 8.08E+00
Methylation in Case	7.69E-01 (Median)	Methylation in Control	5.84E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 12	Methylation of SLC22A2 in bladder cancer			[ 7 ]
Location	Body (cg04310488)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.66E+00	Statistic Test	p-value: 1.06E-05; Z-score: -3.87E+00
Methylation in Case	3.84E-01 (Median)	Methylation in Control	6.40E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 13	Methylation of SLC22A2 in bladder cancer			[ 7 ]
Location	Body (cg02490934)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.48E+00	Statistic Test	p-value: 1.13E-05; Z-score: -4.29E+00
Methylation in Case	4.75E-01 (Median)	Methylation in Control	7.03E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 14	Methylation of SLC22A2 in bladder cancer			[ 7 ]
Location	Body (cg07601258)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.04E+00	Statistic Test	p-value: 3.33E-03; Z-score: -3.43E+00
Methylation in Case	8.79E-01 (Median)	Methylation in Control	9.12E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Breast cancer	19 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC22A2 in breast cancer			[ 8 ]
Location	TSS1500 (cg14450766)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.50E+00	Statistic Test	p-value: 3.71E-15; Z-score: -1.93E+00
Methylation in Case	2.08E-01 (Median)	Methylation in Control	3.11E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC22A2 in breast cancer			[ 8 ]
Location	TSS1500 (cg23995605)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.13E+00	Statistic Test	p-value: 3.50E-14; Z-score: -5.03E+00
Methylation in Case	7.86E-01 (Median)	Methylation in Control	8.87E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC22A2 in breast cancer			[ 8 ]
Location	TSS1500 (cg19499998)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.11E+00	Statistic Test	p-value: 5.42E-13; Z-score: -3.65E+00
Methylation in Case	8.06E-01 (Median)	Methylation in Control	8.96E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC22A2 in breast cancer			[ 8 ]
Location	TSS1500 (cg25545503)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.09E+00	Statistic Test	p-value: 1.14E-09; Z-score: -1.80E+00
Methylation in Case	8.54E-01 (Median)	Methylation in Control	9.32E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC22A2 in breast cancer			[ 8 ]
Location	TSS200 (cg26939503)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.54E+00	Statistic Test	p-value: 3.15E-20; Z-score: -4.08E+00
Methylation in Case	4.32E-01 (Median)	Methylation in Control	6.67E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC22A2 in breast cancer			[ 8 ]
Location	TSS200 (cg06236276)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.32E+00	Statistic Test	p-value: 1.62E-19; Z-score: -4.20E+00
Methylation in Case	5.03E-01 (Median)	Methylation in Control	6.66E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC22A2 in breast cancer			[ 8 ]
Location	TSS200 (cg04294894)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.40E+00	Statistic Test	p-value: 1.45E-16; Z-score: -3.33E+00
Methylation in Case	5.62E-01 (Median)	Methylation in Control	7.89E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of SLC22A2 in breast cancer			[ 8 ]
Location	TSS200 (cg19627213)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.51E+00	Statistic Test	p-value: 8.30E-14; Z-score: -1.97E+00
Methylation in Case	3.98E-01 (Median)	Methylation in Control	6.01E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 9	Methylation of SLC22A2 in breast cancer			[ 8 ]
Location	TSS200 (cg21755969)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.16E+00	Statistic Test	p-value: 1.07E-08; Z-score: -2.33E+00
Methylation in Case	4.74E-01 (Median)	Methylation in Control	5.52E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 10	Methylation of SLC22A2 in breast cancer			[ 8 ]
Location	TSS200 (cg02666489)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.07E+00	Statistic Test	p-value: 5.03E-08; Z-score: -1.06E+00
Methylation in Case	6.99E-01 (Median)	Methylation in Control	7.47E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 11	Methylation of SLC22A2 in breast cancer			[ 8 ]
Location	1stExon (cg13717233)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.11E+00	Statistic Test	p-value: 5.12E-13; Z-score: -4.25E+00
Methylation in Case	7.54E-01 (Median)	Methylation in Control	8.36E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 12	Methylation of SLC22A2 in breast cancer			[ 8 ]
Location	1stExon (cg27204616)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.15E+00	Statistic Test	p-value: 2.39E-12; Z-score: -6.29E+00
Methylation in Case	8.15E-01 (Median)	Methylation in Control	9.36E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 13	Methylation of SLC22A2 in breast cancer			[ 8 ]
Location	1stExon (cg19561774)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.09E+00	Statistic Test	p-value: 1.15E-09; Z-score: -1.89E+00
Methylation in Case	7.54E-01 (Median)	Methylation in Control	8.18E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 14	Methylation of SLC22A2 in breast cancer			[ 8 ]
Location	Body (cg17098387)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.30E+00	Statistic Test	p-value: 6.95E-20; Z-score: -3.61E+00
Methylation in Case	5.59E-01 (Median)	Methylation in Control	7.27E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 15	Methylation of SLC22A2 in breast cancer			[ 8 ]
Location	Body (cg04310488)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.34E+00	Statistic Test	p-value: 5.15E-15; Z-score: -2.69E+00
Methylation in Case	5.64E-01 (Median)	Methylation in Control	7.58E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 16	Methylation of SLC22A2 in breast cancer			[ 8 ]
Location	Body (cg14918008)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.13E+00	Statistic Test	p-value: 2.00E-11; Z-score: -1.81E+00
Methylation in Case	6.82E-01 (Median)	Methylation in Control	7.72E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 17	Methylation of SLC22A2 in breast cancer			[ 8 ]
Location	Body (cg03488613)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.09E+00	Statistic Test	p-value: 8.15E-10; Z-score: -2.01E+00
Methylation in Case	8.03E-01 (Median)	Methylation in Control	8.75E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 18	Methylation of SLC22A2 in breast cancer			[ 8 ]
Location	Body (cg07601258)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.05E+00	Statistic Test	p-value: 2.64E-09; Z-score: -1.64E+00
Methylation in Case	8.43E-01 (Median)	Methylation in Control	8.85E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 19	Methylation of SLC22A2 in breast cancer			[ 8 ]
Location	Body (cg02490934)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.21E+00	Statistic Test	p-value: 8.82E-03; Z-score: -1.05E+00
Methylation in Case	4.20E-01 (Median)	Methylation in Control	5.09E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Renal cell carcinoma	4 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC22A2 in clear cell renal cell carcinoma			[ 9 ]
Location	TSS1500 (cg23995605)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.00E+00	Statistic Test	p-value: 3.94E-04; Z-score: -2.90E-02
Methylation in Case	9.23E-01 (Median)	Methylation in Control	9.24E-01 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC22A2 in clear cell renal cell carcinoma			[ 9 ]
Location	TSS200 (cg04294894)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.10E+00	Statistic Test	p-value: 3.59E-02; Z-score: -1.28E+00
Methylation in Case	6.05E-01 (Median)	Methylation in Control	6.65E-01 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC22A2 in clear cell renal cell carcinoma			[ 9 ]
Location	Body (cg02490934)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.28E+00	Statistic Test	p-value: 3.42E-03; Z-score: -2.82E+00
Methylation in Case	4.94E-01 (Median)	Methylation in Control	6.34E-01 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC22A2 in clear cell renal cell carcinoma			[ 9 ]
Location	Body (cg07601258)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.06E+00	Statistic Test	p-value: 6.36E-03; Z-score: -9.85E-01
Methylation in Case	7.68E-01 (Median)	Methylation in Control	8.14E-01 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Colon cancer	3 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC22A2 in colon adenocarcinoma			[ 10 ]
Location	TSS1500 (cg09595245)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.16E+00	Statistic Test	p-value: 5.57E-04; Z-score: -2.37E+00
Methylation in Case	6.72E-01 (Median)	Methylation in Control	7.80E-01 (Median)
Studied Phenotype	Colon cancer [ ICD-11: 2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC22A2 in colon adenocarcinoma			[ 10 ]
Location	Body (cg05672174)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.09E+00	Statistic Test	p-value: 9.28E-05; Z-score: -2.18E+00
Methylation in Case	6.99E-01 (Median)	Methylation in Control	7.60E-01 (Median)
Studied Phenotype	Colon cancer [ ICD-11: 2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC22A2 in colon adenocarcinoma			[ 10 ]
Location	Body (cg26907313)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.15E+00	Statistic Test	p-value: 1.00E-03; Z-score: -3.03E+00
Methylation in Case	7.19E-01 (Median)	Methylation in Control	8.25E-01 (Median)
Studied Phenotype	Colon cancer [ ICD-11: 2B90]
Experimental Material	Patient tissue samples
Depression	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC22A2 in depression			[ 11 ]
Location	TSS1500 (cg07026448)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.02E+00	Statistic Test	p-value: 4.21E-02; Z-score: 1.81E-01
Methylation in Case	4.21E-01 (Median)	Methylation in Control	4.14E-01 (Median)
Studied Phenotype	Depression [ ICD-11: 6A8Z]
Experimental Material	Patient tissue samples
HIV infection	8 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC22A2 in HIV infection			[ 13 ]
Location	TSS1500 (cg14450766)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.07E+00	Statistic Test	p-value: 6.14E-04; Z-score: -3.43E-01
Methylation in Case	2.51E-01 (Median)	Methylation in Control	2.69E-01 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC22A2 in HIV infection			[ 13 ]
Location	TSS1500 (cg19499998)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.01E+00	Statistic Test	p-value: 7.98E-04; Z-score: 7.92E-01
Methylation in Case	9.33E-01 (Median)	Methylation in Control	9.20E-01 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC22A2 in HIV infection			[ 13 ]
Location	TSS200 (cg19627213)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.15E+00	Statistic Test	p-value: 4.26E-06; Z-score: -1.45E+00
Methylation in Case	5.04E-01 (Median)	Methylation in Control	5.80E-01 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC22A2 in HIV infection			[ 13 ]
Location	TSS200 (cg04294894)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.03E+00	Statistic Test	p-value: 3.10E-03; Z-score: -6.46E-01
Methylation in Case	8.24E-01 (Median)	Methylation in Control	8.48E-01 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC22A2 in HIV infection			[ 13 ]
Location	TSS200 (cg06236276)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.03E+00	Statistic Test	p-value: 3.82E-02; Z-score: -4.79E-01
Methylation in Case	6.56E-01 (Median)	Methylation in Control	6.77E-01 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC22A2 in HIV infection			[ 13 ]
Location	1stExon (cg19561774)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.03E+00	Statistic Test	p-value: 2.37E-06; Z-score: 1.25E+00
Methylation in Case	8.94E-01 (Median)	Methylation in Control	8.69E-01 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC22A2 in HIV infection			[ 13 ]
Location	Body (cg17098387)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.08E+00	Statistic Test	p-value: 2.08E-04; Z-score: -1.02E+00
Methylation in Case	6.62E-01 (Median)	Methylation in Control	7.17E-01 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of SLC22A2 in HIV infection			[ 13 ]
Location	Body (cg02490934)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.08E+00	Statistic Test	p-value: 2.97E-04; Z-score: -1.08E+00
Methylation in Case	7.76E-01 (Median)	Methylation in Control	8.34E-01 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Lung adenocarcinoma	3 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC22A2 in lung adenocarcinoma			[ 14 ]
Location	TSS1500 (cg07026448)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.06E+00	Statistic Test	p-value: 3.92E-02; Z-score: 7.17E-01
Methylation in Case	6.11E-01 (Median)	Methylation in Control	5.78E-01 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC22A2 in lung adenocarcinoma			[ 14 ]
Location	TSS200 (cg19627213)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.12E+00	Statistic Test	p-value: 3.43E-02; Z-score: -3.14E+00
Methylation in Case	5.50E-01 (Median)	Methylation in Control	6.17E-01 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC22A2 in lung adenocarcinoma			[ 14 ]
Location	Body (cg17098387)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.11E+00	Statistic Test	p-value: 2.72E-02; Z-score: -3.43E+00
Methylation in Case	6.86E-01 (Median)	Methylation in Control	7.62E-01 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Papillary thyroid cancer	13 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC22A2 in papillary thyroid cancer			[ 15 ]
Location	TSS1500 (cg25545503)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.06E+00	Statistic Test	p-value: 6.84E-11; Z-score: 1.47E+00
Methylation in Case	8.75E-01 (Median)	Methylation in Control	8.23E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC22A2 in papillary thyroid cancer			[ 15 ]
Location	TSS1500 (cg19499998)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.07E+00	Statistic Test	p-value: 1.17E-10; Z-score: 1.56E+00
Methylation in Case	8.57E-01 (Median)	Methylation in Control	8.01E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC22A2 in papillary thyroid cancer			[ 15 ]
Location	TSS1500 (cg23995605)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.03E+00	Statistic Test	p-value: 1.64E-09; Z-score: -2.12E+00
Methylation in Case	9.27E-01 (Median)	Methylation in Control	9.53E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC22A2 in papillary thyroid cancer			[ 15 ]
Location	TSS1500 (cg07026448)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.08E+00	Statistic Test	p-value: 9.62E-03; Z-score: 1.09E+00
Methylation in Case	6.88E-01 (Median)	Methylation in Control	6.37E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC22A2 in papillary thyroid cancer			[ 15 ]
Location	TSS200 (cg06236276)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.06E+00	Statistic Test	p-value: 1.58E-06; Z-score: -1.16E+00
Methylation in Case	6.87E-01 (Median)	Methylation in Control	7.30E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC22A2 in papillary thyroid cancer			[ 15 ]
Location	TSS200 (cg26939503)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.05E+00	Statistic Test	p-value: 2.36E-05; Z-score: -6.23E-01
Methylation in Case	6.43E-01 (Median)	Methylation in Control	6.72E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC22A2 in papillary thyroid cancer			[ 15 ]
Location	TSS200 (cg02666489)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.10E+00	Statistic Test	p-value: 5.04E-05; Z-score: 1.73E+00
Methylation in Case	8.37E-01 (Median)	Methylation in Control	7.62E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of SLC22A2 in papillary thyroid cancer			[ 15 ]
Location	TSS200 (cg19627213)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.06E+00	Statistic Test	p-value: 3.42E-03; Z-score: -5.49E-01
Methylation in Case	6.66E-01 (Median)	Methylation in Control	7.03E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 9	Methylation of SLC22A2 in papillary thyroid cancer			[ 15 ]
Location	1stExon (cg19561774)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.02E+00	Statistic Test	p-value: 5.02E-09; Z-score: -1.47E+00
Methylation in Case	9.20E-01 (Median)	Methylation in Control	9.37E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 10	Methylation of SLC22A2 in papillary thyroid cancer			[ 15 ]
Location	1stExon (cg27204616)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.02E+00	Statistic Test	p-value: 1.60E-06; Z-score: -1.22E+00
Methylation in Case	9.01E-01 (Median)	Methylation in Control	9.18E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 11	Methylation of SLC22A2 in papillary thyroid cancer			[ 15 ]
Location	1stExon (cg13717233)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.02E+00	Statistic Test	p-value: 3.30E-06; Z-score: -9.37E-01
Methylation in Case	8.97E-01 (Median)	Methylation in Control	9.11E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 12	Methylation of SLC22A2 in papillary thyroid cancer			[ 15 ]
Location	Body (cg02490934)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.07E+00	Statistic Test	p-value: 7.43E-06; Z-score: -1.20E+00
Methylation in Case	7.82E-01 (Median)	Methylation in Control	8.36E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 13	Methylation of SLC22A2 in papillary thyroid cancer			[ 15 ]
Location	Body (cg07601258)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.00E+00	Statistic Test	p-value: 8.06E-04; Z-score: -2.45E-01
Methylation in Case	9.40E-01 (Median)	Methylation in Control	9.43E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Systemic lupus erythematosus	7 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC22A2 in systemic lupus erythematosus			[ 16 ]
Location	TSS1500 (cg23995605)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.00E+00	Statistic Test	p-value: 2.95E-02; Z-score: -2.21E-01
Methylation in Case	9.19E-01 (Median)	Methylation in Control	9.24E-01 (Median)
Studied Phenotype	Systemic lupus erythematosus [ ICD-11: 4A40.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC22A2 in systemic lupus erythematosus			[ 16 ]
Location	TSS200 (cg26939503)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.03E+00	Statistic Test	p-value: 1.19E-03; Z-score: -2.66E-01
Methylation in Case	6.52E-01 (Median)	Methylation in Control	6.72E-01 (Median)
Studied Phenotype	Systemic lupus erythematosus [ ICD-11: 4A40.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC22A2 in systemic lupus erythematosus			[ 16 ]
Location	TSS200 (cg02666489)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.01E+00	Statistic Test	p-value: 1.35E-02; Z-score: -2.51E-01
Methylation in Case	8.70E-01 (Median)	Methylation in Control	8.77E-01 (Median)
Studied Phenotype	Systemic lupus erythematosus [ ICD-11: 4A40.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC22A2 in systemic lupus erythematosus			[ 16 ]
Location	TSS200 (cg06236276)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.01E+00	Statistic Test	p-value: 3.12E-02; Z-score: -1.25E-01
Methylation in Case	7.03E-01 (Median)	Methylation in Control	7.11E-01 (Median)
Studied Phenotype	Systemic lupus erythematosus [ ICD-11: 4A40.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC22A2 in systemic lupus erythematosus			[ 16 ]
Location	Body (cg07601258)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.00E+00	Statistic Test	p-value: 5.79E-03; Z-score: -2.06E-01
Methylation in Case	9.24E-01 (Median)	Methylation in Control	9.28E-01 (Median)
Studied Phenotype	Systemic lupus erythematosus [ ICD-11: 4A40.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC22A2 in systemic lupus erythematosus			[ 16 ]
Location	Body (cg17098387)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.02E+00	Statistic Test	p-value: 7.48E-03; Z-score: -1.85E-01
Methylation in Case	6.55E-01 (Median)	Methylation in Control	6.69E-01 (Median)
Studied Phenotype	Systemic lupus erythematosus [ ICD-11: 4A40.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC22A2 in systemic lupus erythematosus			[ 16 ]
Location	Body (cg02490934)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.02E+00	Statistic Test	p-value: 3.70E-02; Z-score: -1.77E-01
Methylation in Case	7.69E-01 (Median)	Methylation in Control	7.85E-01 (Median)
Studied Phenotype	Systemic lupus erythematosus [ ICD-11: 4A40.0]
Experimental Material	Patient tissue samples
Panic disorder	2 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC22A2 in panic disorder			[ 17 ]
Location	TSS200 (cg04294894)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.08E+00	Statistic Test	p-value: 3.35E-02; Z-score: 4.99E-01
Methylation in Case	2.72E+00 (Median)	Methylation in Control	2.53E+00 (Median)
Studied Phenotype	Panic disorder [ ICD-11: 6B01]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC22A2 in panic disorder			[ 17 ]
Location	TSS200 (cg21755969)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.30E+00	Statistic Test	p-value: 3.64E-02; Z-score: 4.24E-01
Methylation in Case	6.92E-01 (Median)	Methylation in Control	5.31E-01 (Median)
Studied Phenotype	Panic disorder [ ICD-11: 6B01]
Experimental Material	Patient tissue samples
Atypical teratoid rhabdoid tumor	7 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC22A2 in atypical teratoid rhabdoid tumor			[ 18 ]
Location	1stExon (cg13717233)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.49E+00	Statistic Test	p-value: 2.58E-19; Z-score: -3.07E+00
Methylation in Case	5.11E-01 (Median)	Methylation in Control	7.62E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC22A2 in atypical teratoid rhabdoid tumor			[ 18 ]
Location	1stExon (cg19561774)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.18E+00	Statistic Test	p-value: 1.13E-17; Z-score: -2.79E+00
Methylation in Case	7.34E-01 (Median)	Methylation in Control	8.65E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC22A2 in atypical teratoid rhabdoid tumor			[ 18 ]
Location	1stExon (cg27204616)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.36E+00	Statistic Test	p-value: 9.27E-16; Z-score: -3.43E+00
Methylation in Case	5.38E-01 (Median)	Methylation in Control	7.33E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC22A2 in atypical teratoid rhabdoid tumor			[ 18 ]
Location	Body (cg02490934)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.03E+00	Statistic Test	p-value: 1.67E-04; Z-score: -7.24E-01
Methylation in Case	8.91E-01 (Median)	Methylation in Control	9.16E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC22A2 in atypical teratoid rhabdoid tumor			[ 18 ]
Location	Body (cg03488613)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.33E+00	Statistic Test	p-value: 3.52E-04; Z-score: -1.02E+00
Methylation in Case	5.67E-01 (Median)	Methylation in Control	7.52E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC22A2 in atypical teratoid rhabdoid tumor			[ 18 ]
Location	Body (cg04310488)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.04E+00	Statistic Test	p-value: 7.00E-04; Z-score: -4.47E-01
Methylation in Case	7.84E-01 (Median)	Methylation in Control	8.16E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC22A2 in atypical teratoid rhabdoid tumor			[ 18 ]
Location	Body (cg07601258)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.06E+00	Statistic Test	p-value: 4.49E-03; Z-score: 6.32E-01
Methylation in Case	9.30E-01 (Median)	Methylation in Control	8.75E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Colorectal cancer	3 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC22A2 in colorectal cancer			[ 19 ]
Location	1stExon (cg19561774)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.00E+00	Statistic Test	p-value: 8.06E-03; Z-score: -1.88E-01
Methylation in Case	9.48E-01 (Median)	Methylation in Control	9.50E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC22A2 in colorectal cancer			[ 19 ]
Location	Body (cg03488613)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.03E+00	Statistic Test	p-value: 9.96E-03; Z-score: 9.12E-01
Methylation in Case	9.20E-01 (Median)	Methylation in Control	8.94E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC22A2 in colorectal cancer			[ 19 ]
Location	Body (cg07601258)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.01E+00	Statistic Test	p-value: 2.47E-02; Z-score: 3.07E-01
Methylation in Case	9.45E-01 (Median)	Methylation in Control	9.40E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Pancretic ductal adenocarcinoma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC22A2 in pancretic ductal adenocarcinoma			[ 20 ]
Location	Body (cg12933431)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.26E+00	Statistic Test	p-value: 1.75E-03; Z-score: 1.32E+00
Methylation in Case	6.71E-01 (Median)	Methylation in Control	5.32E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Esthesioneuroblastoma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Moderate hypomethylation of SLC22A2 in esthesioneuroblastoma than that in healthy individual
Studied Phenotype	Esthesioneuroblastoma [ICD-11:2D50.1]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 1.63E-05; Fold-change: -0.213965366; Z-score: -1.711614709
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Medulloblastoma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Moderate hypomethylation of SLC22A2 in medulloblastoma than that in healthy individual
Studied Phenotype	Medulloblastoma [ICD-11:2A00.10]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 6.98E-86; Fold-change: -0.263759902; Z-score: -3.445624036
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Melanoma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Moderate hypomethylation of SLC22A2 in melanoma than that in healthy individual
Studied Phenotype	Melanoma [ICD-11:2C30]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 0.002420386; Fold-change: -0.241840851; Z-score: -1.569377238
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Multilayered rosettes embryonal tumour	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Moderate hypomethylation of SLC22A2 in multilayered rosettes embryonal tumour than that in healthy individual
Studied Phenotype	Multilayered rosettes embryonal tumour [ICD-11:2A00.1]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 1.37E-09; Fold-change: -0.261324171; Z-score: -2.25939206
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Cerebellar liponeurocytoma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Significant hypomethylation of SLC22A2 in cerebellar liponeurocytoma than that in healthy individual
Studied Phenotype	Cerebellar liponeurocytoma [ICD-11:2A00.0Y]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 1.59E-08; Fold-change: -0.617671121; Z-score: -2.933433032
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Lymphoma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Significant hypomethylation of SLC22A2 in lymphoma than that in healthy individual
Studied Phenotype	Lymphoma [ICD-11:2B30]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 1.35E-08; Fold-change: -0.308339461; Z-score: -2.124187076
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Meningioma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Significant hypomethylation of SLC22A2 in meningioma than that in healthy individual
Studied Phenotype	Meningioma [ICD-11:2A01.0Z]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 1.25E-62; Fold-change: -0.340860889; Z-score: -3.217549796
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Posterior fossa ependymoma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Significant hypomethylation of SLC22A2 in posterior fossa ependymoma than that in healthy individual
Studied Phenotype	Posterior fossa ependymoma [ICD-11:2D50.2]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 3.20E-102; Fold-change: -0.383390542; Z-score: -3.474081509
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Histone acetylation
Renal cell carcinoma	2 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Hypoacetylation of SLC22A2 in renal cell carcinoma			[ 21 ]
Location	Promoter
Epigenetic Type	Histone acetylation	Experiment Method	Chromatin immunoprecipitation
Related Molecular Changes	Down regulation of SLC22A2	Experiment Method	RT-qPCR
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patients samples of human; Multiple cell lines of human
Additional Notes	Combined treatment using the DNA methylation inhibitor decitabine and the histone deacetylase inhibitor vorinostat significantly increased the expression of OCT2 in RCC cell lines, which sensitized these cells to oxaliplatin.
Epigenetic Phenomenon 2	Hypoacetylation of SLC22A2 in renal cell carcinoma			[ 21 ]
Location	Promoter
Epigenetic Type	Histone acetylation	Experiment Method	Chromatin immunoprecipitation
Related Molecular Changes	Down regulation of SLC22A2	Experiment Method	RT-qPCR
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patients samples of human; Multiple cell lines of human
Additional Notes	Combined treatment using the DNA methylation inhibitor decitabine and the histone deacetylase inhibitor vorinostat significantly increased the expression of OCT2 in RCC cell lines, which sensitized these cells to oxaliplatin.
microRNA
Renal cell carcinoma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	miR-21 silencing increased SLC22A2 expression			[ 22 ]
Epigenetic Type	microRNA	Experiment Method	.
Related Molecular Changes	Down regulation of SLC22A2	Experiment Method	RT-qPCR
miRNA Stemloop ID	miR-21	miRNA Mature ID	miR-21-5p
miRNA Sequence	UAGCUUAUCAGACUGAUGUUGA
miRNA Target Type	Unknown
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Multiple cell lines of human
Additional Notes	Targeting miR-21 decreases expression of SLC22A2 and promotes chemosensitivity of renal carcinoma.
Unclear Phenotype	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	miR-335 directly targets SLC22A2			[ 23 ]
Epigenetic Type	microRNA	Experiment Method	Microarray
miRNA Stemloop ID	miR-335	miRNA Mature ID	miR-335-5p
miRNA Sequence	UCAAGAGCAAUAACGAAAAAUGU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human

References
1	Kidney-specific expression of human organic cation transporter 2 (OCT2/SLC22A2) is regulated by DNA methylation. Am J Physiol Renal Physiol. 2008 Jul;295(1):F165-70.
2	Epigenetic activation of the drug transporter OCT2 sensitizes renal cell carcinoma to oxaliplatin. Sci Transl Med. 2016 Jul 20;8(348):348ra97.
3	Long-term cisplatin exposure promotes methylation of the OCT1 gene in human esophageal cancer cells. Dig Dis Sci. 2013 Mar;58(3):694-8.
4	Epigenetic events involved in organic cation transporter 1-dependent impaired response of hepatocellular carcinoma to sorafenib. Br J Pharmacol. 2019 Mar;176(6):787-800.
5	Methylomes of renal cell lines and tumors or metastases differ significantly with impact on pharmacogenes. Sci Rep. 2016 Jul 20;6:29930.
6	Reducing the risk of false discovery enabling identification of biologically significant genome-wide methylation status using the HumanMethylation450 array. BMC Genomics. 2014 Jan 22;15:51.
7	DNA Methylation Dynamics in Urological Tumors.
8	Genome-wide Scan for Methylation Profiles in Breast Cancer
9	A CpG-methylation-based assay to predict survival in clear cell renal cell carcinoma. Nat Commun. 2015 Oct 30;6:8699.
10	Genome-scale analysis of DNA methylation in colorectal cancer using Infinium HumanMethylation450 BeadChips. Epigenetics. 2013 Sep;8(9):921-34.
11	DNA methylation and inflammation marker profiles associated with a history of depression. Hum Mol Genet. 2018 Aug 15;27(16):2840-2850.
12	Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
13	HIV-1 Infection Accelerates Age According to the Epigenetic Clock. J Infect Dis. 2015 Nov 15;212(10):1563-73.
14	DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
15	Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
16	Genome-wide DNA methylation analysis of systemic lupus erythematosus reveals persistent hypomethylation of interferon genes and compositional changes to CD4+ T-cell populations. PLoS Genet. 2013;9(8):e1003678.
17	DNA Methylation signatures in panic disorder. Transl Psychiatry. 2017 Dec 18;7(12):1287.
18	Atypical Teratoid/Rhabdoid Tumors Are Comprised of Three Epigenetic Subgroups with Distinct Enhancer Landscapes. Cancer Cell. 2016 Mar 14;29(3):379-393.
19	Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
20	Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
21	Regulation of OCT2 transcriptional repression by histone acetylation in renal cell carcinoma. Epigenetics. 2019 May 15:1-13.
22	Targeting miR-21 decreases expression of multi-drug resistant genes and promotes chemosensitivity of renal carcinoma. Tumour Biol. 2017 Jul;39(7):1010428317707372.
23	Endogenous human microRNAs that suppress breast cancer metastasis. Nature. 2008 Jan 10;451(7175):147-52.

If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.

Detail Information of Epigenetic Regulations

Visitor Map

Correspondence