Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID	DTD0007 Transporter Info
Gene Name	SLC47A1
Transporter Name	Multidrug and toxin extrusion protein 1
Gene ID	55244
UniProt ID	Q96FL8

Epigenetic Regulations of This DT (EGR)
Methylation
Diabetes	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Hypermethylation of SLC47A1 in diabetes			[ 1 ]
Location	Promoter (11 CpG sites)
Epigenetic Type	Methylation	Experiment Method	HumanMethylation450 BeadChip
Related Molecular Changes	Down regulation of SLC47A1	Experiment Method	BeadChip
Studied Phenotype	Diabetes [ ICD-11: 5A10-5A14]
Experimental Material	Patient tissue samples
Additional Notes	Lower average and promoter DNA methylation of SLC47A1 was found in diabetic subjects receiving just metformin,compared to those who took insulin plus metformin or no diabetes medication.
Human liver tissue	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Hypermethylation of SLC47A1 in human liver tissue			[ 2 ]
Location	27 kb upstream of gene
Epigenetic Type	Methylation	Experiment Method	Bisulfite sequencing
Related Molecular Changes	Down regulation of SLC47A1	Experiment Method	Semiquantitative RT-PCR
Studied Phenotype	Human liver tissue
Experimental Material	Caucasian patient tissue samples
Additional Notes	A relationship was not found between DNA methylation in the SLC47A1 promoter and MATE1 mRNA expression.
Non-alcoholic fatty liver disease	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Hypermethylation of SLC47A1 in non-alcoholic fatty liver disease			[ 3 ]
Location	6 CpG sites
Epigenetic Type	Methylation	Experiment Method	HumanMethylation450 BeadChip
Related Molecular Changes	Down regulation of SLC47A1	Experiment Method	Methylation microarray
Studied Phenotype	Non-alcoholic fatty liver disease [ ICD-11: DB92]
Experimental Material	Patient tissue samples
Additional Notes	SLC47A1 was detected to be significantly inversely associated with the transcriptional expression.
Colon cancer	7 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC47A1 in colon adenocarcinoma			[ 4 ]
Location	5'UTR (cg05373457)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.30E+00	Statistic Test	p-value: 1.89E-06; Z-score: 2.08E+00
Methylation in Case	5.58E-01 (Median)	Methylation in Control	4.29E-01 (Median)
Studied Phenotype	Colon cancer [ ICD-11: 2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC47A1 in colon adenocarcinoma			[ 4 ]
Location	TSS1500 (cg02577240)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.16E+00	Statistic Test	p-value: 7.18E-04; Z-score: -1.49E+00
Methylation in Case	6.01E-01 (Median)	Methylation in Control	6.98E-01 (Median)
Studied Phenotype	Colon cancer [ ICD-11: 2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC47A1 in colon adenocarcinoma			[ 4 ]
Location	TSS200 (cg05311412)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 2.34E+00	Statistic Test	p-value: 7.92E-07; Z-score: 3.02E+00
Methylation in Case	6.11E-01 (Median)	Methylation in Control	2.60E-01 (Median)
Studied Phenotype	Colon cancer [ ICD-11: 2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC47A1 in colon adenocarcinoma			[ 4 ]
Location	Body (cg01454305)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.46E+00	Statistic Test	p-value: 3.53E-07; Z-score: -3.88E+00
Methylation in Case	4.91E-01 (Median)	Methylation in Control	7.16E-01 (Median)
Studied Phenotype	Colon cancer [ ICD-11: 2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC47A1 in colon adenocarcinoma			[ 4 ]
Location	Body (cg10311318)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.14E+00	Statistic Test	p-value: 4.42E-04; Z-score: 8.90E-01
Methylation in Case	5.39E-01 (Median)	Methylation in Control	4.72E-01 (Median)
Studied Phenotype	Colon cancer [ ICD-11: 2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC47A1 in colon adenocarcinoma			[ 4 ]
Location	Body (cg12866656)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.19E+00	Statistic Test	p-value: 2.22E-03; Z-score: -1.58E+00
Methylation in Case	5.17E-01 (Median)	Methylation in Control	6.16E-01 (Median)
Studied Phenotype	Colon cancer [ ICD-11: 2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC47A1 in colon adenocarcinoma			[ 4 ]
Location	3'UTR (cg08828816)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.08E+00	Statistic Test	p-value: 4.55E-03; Z-score: -2.33E+00
Methylation in Case	6.88E-01 (Median)	Methylation in Control	7.42E-01 (Median)
Studied Phenotype	Colon cancer [ ICD-11: 2B90]
Experimental Material	Patient tissue samples
Hepatocellular carcinoma	18 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC47A1 in hepatocellular carcinoma			[ 5 ]
Location	5'UTR (cg14932645)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.13E+00	Statistic Test	p-value: 5.28E-10; Z-score: -3.98E+00
Methylation in Case	7.68E-01 (Median)	Methylation in Control	8.67E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC47A1 in hepatocellular carcinoma			[ 5 ]
Location	TSS1500 (cg21692194)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.17E+00	Statistic Test	p-value: 8.19E-06; Z-score: -6.73E-01
Methylation in Case	1.09E-01 (Median)	Methylation in Control	1.28E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC47A1 in hepatocellular carcinoma			[ 5 ]
Location	TSS1500 (cg15971010)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.40E+00	Statistic Test	p-value: 6.81E-04; Z-score: -8.39E-01
Methylation in Case	1.08E-01 (Median)	Methylation in Control	1.50E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC47A1 in hepatocellular carcinoma			[ 5 ]
Location	TSS1500 (cg25387636)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.46E+00	Statistic Test	p-value: 1.62E-02; Z-score: -8.51E-01
Methylation in Case	5.88E-02 (Median)	Methylation in Control	8.59E-02 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC47A1 in hepatocellular carcinoma			[ 5 ]
Location	TSS1500 (cg12133118)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.14E+00	Statistic Test	p-value: 1.66E-02; Z-score: -7.27E-01
Methylation in Case	3.22E-01 (Median)	Methylation in Control	3.67E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC47A1 in hepatocellular carcinoma			[ 5 ]
Location	TSS200 (cg07829432)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.24E+00	Statistic Test	p-value: 6.45E-04; Z-score: -7.82E-01
Methylation in Case	8.02E-02 (Median)	Methylation in Control	9.95E-02 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC47A1 in hepatocellular carcinoma			[ 5 ]
Location	TSS200 (cg15014549)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.13E+00	Statistic Test	p-value: 6.52E-03; Z-score: -5.87E-01
Methylation in Case	6.69E-02 (Median)	Methylation in Control	7.54E-02 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of SLC47A1 in hepatocellular carcinoma			[ 5 ]
Location	TSS200 (cg13004927)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.28E+00	Statistic Test	p-value: 1.84E-02; Z-score: -2.52E-01
Methylation in Case	2.58E-02 (Median)	Methylation in Control	3.31E-02 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 9	Methylation of SLC47A1 in hepatocellular carcinoma			[ 5 ]
Location	Body (cg02068832)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.79E+00	Statistic Test	p-value: 1.39E-18; Z-score: -6.05E+00
Methylation in Case	4.16E-01 (Median)	Methylation in Control	7.44E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 10	Methylation of SLC47A1 in hepatocellular carcinoma			[ 5 ]
Location	Body (cg16925177)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.67E+00	Statistic Test	p-value: 3.76E-17; Z-score: -5.57E+00
Methylation in Case	4.81E-01 (Median)	Methylation in Control	8.03E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 11	Methylation of SLC47A1 in hepatocellular carcinoma			[ 5 ]
Location	Body (cg05510976)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.51E+00	Statistic Test	p-value: 2.88E-16; Z-score: -6.93E+00
Methylation in Case	5.25E-01 (Median)	Methylation in Control	7.91E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 12	Methylation of SLC47A1 in hepatocellular carcinoma			[ 5 ]
Location	Body (cg07566700)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.36E+00	Statistic Test	p-value: 5.37E-16; Z-score: -4.42E+00
Methylation in Case	5.62E-01 (Median)	Methylation in Control	7.66E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 13	Methylation of SLC47A1 in hepatocellular carcinoma			[ 5 ]
Location	Body (cg00601711)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.19E+00	Statistic Test	p-value: 4.46E-12; Z-score: 2.14E+00
Methylation in Case	7.63E-01 (Median)	Methylation in Control	6.42E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 14	Methylation of SLC47A1 in hepatocellular carcinoma			[ 5 ]
Location	Body (cg10718608)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.32E+00	Statistic Test	p-value: 4.40E-08; Z-score: -1.60E+00
Methylation in Case	3.71E-01 (Median)	Methylation in Control	4.91E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 15	Methylation of SLC47A1 in hepatocellular carcinoma			[ 5 ]
Location	Body (cg08895056)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.31E+00	Statistic Test	p-value: 8.41E-08; Z-score: -1.61E+00
Methylation in Case	3.71E-01 (Median)	Methylation in Control	4.87E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 16	Methylation of SLC47A1 in hepatocellular carcinoma			[ 5 ]
Location	Body (cg20930201)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.27E+00	Statistic Test	p-value: 1.63E-05; Z-score: -7.83E-01
Methylation in Case	1.15E-01 (Median)	Methylation in Control	1.45E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 17	Methylation of SLC47A1 in hepatocellular carcinoma			[ 5 ]
Location	Body (cg12894055)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.38E+00	Statistic Test	p-value: 5.37E-03; Z-score: -1.06E+00
Methylation in Case	9.94E-02 (Median)	Methylation in Control	1.37E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 18	Methylation of SLC47A1 in hepatocellular carcinoma			[ 5 ]
Location	3'UTR (cg12550399)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.04E+00	Statistic Test	p-value: 7.52E-05; Z-score: 3.90E-01
Methylation in Case	7.69E-01 (Median)	Methylation in Control	7.40E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Pancretic ductal adenocarcinoma	15 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC47A1 in pancretic ductal adenocarcinoma			[ 6 ]
Location	5'UTR (cg26590537)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 2.70E+00	Statistic Test	p-value: 1.17E-24; Z-score: 3.82E+00
Methylation in Case	4.11E-01 (Median)	Methylation in Control	1.52E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC47A1 in pancretic ductal adenocarcinoma			[ 6 ]
Location	TSS1500 (cg24079038)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.48E+00	Statistic Test	p-value: 5.82E-10; Z-score: -1.78E+00
Methylation in Case	2.97E-01 (Median)	Methylation in Control	4.39E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC47A1 in pancretic ductal adenocarcinoma			[ 6 ]
Location	TSS1500 (cg18646365)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.36E+00	Statistic Test	p-value: 1.57E-08; Z-score: 1.31E+00
Methylation in Case	3.98E-01 (Median)	Methylation in Control	2.93E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC47A1 in pancretic ductal adenocarcinoma			[ 6 ]
Location	TSS200 (cg06750832)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 5.47E+00	Statistic Test	p-value: 3.34E-33; Z-score: 5.41E+00
Methylation in Case	4.26E-01 (Median)	Methylation in Control	7.79E-02 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC47A1 in pancretic ductal adenocarcinoma			[ 6 ]
Location	Body (cg14994247)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.21E+00	Statistic Test	p-value: 2.01E-20; Z-score: -2.74E+00
Methylation in Case	3.94E-01 (Median)	Methylation in Control	4.76E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC47A1 in pancretic ductal adenocarcinoma			[ 6 ]
Location	Body (cg04320476)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.09E+00	Statistic Test	p-value: 7.13E-09; Z-score: -1.61E+00
Methylation in Case	7.94E-01 (Median)	Methylation in Control	8.67E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC47A1 in pancretic ductal adenocarcinoma			[ 6 ]
Location	Body (cg10605137)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.10E+00	Statistic Test	p-value: 1.54E-05; Z-score: -9.81E-01
Methylation in Case	3.28E-01 (Median)	Methylation in Control	3.61E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of SLC47A1 in pancretic ductal adenocarcinoma			[ 6 ]
Location	Body (cg04726373)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.07E+00	Statistic Test	p-value: 1.65E-05; Z-score: -9.44E-01
Methylation in Case	7.20E-01 (Median)	Methylation in Control	7.73E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 9	Methylation of SLC47A1 in pancretic ductal adenocarcinoma			[ 6 ]
Location	Body (cg19866594)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.01E+00	Statistic Test	p-value: 2.23E-05; Z-score: -3.92E-01
Methylation in Case	8.70E-01 (Median)	Methylation in Control	8.78E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 10	Methylation of SLC47A1 in pancretic ductal adenocarcinoma			[ 6 ]
Location	Body (cg13755144)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.02E+00	Statistic Test	p-value: 2.94E-04; Z-score: 5.86E-01
Methylation in Case	8.87E-01 (Median)	Methylation in Control	8.68E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 11	Methylation of SLC47A1 in pancretic ductal adenocarcinoma			[ 6 ]
Location	Body (cg00714531)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.04E+00	Statistic Test	p-value: 1.25E-03; Z-score: 6.19E-01
Methylation in Case	8.82E-01 (Median)	Methylation in Control	8.47E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 12	Methylation of SLC47A1 in pancretic ductal adenocarcinoma			[ 6 ]
Location	Body (cg26129353)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.10E+00	Statistic Test	p-value: 1.62E-02; Z-score: -6.53E-01
Methylation in Case	7.43E-01 (Median)	Methylation in Control	8.17E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 13	Methylation of SLC47A1 in pancretic ductal adenocarcinoma			[ 6 ]
Location	Body (cg13405678)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.03E+00	Statistic Test	p-value: 2.79E-02; Z-score: 5.36E-01
Methylation in Case	5.86E-01 (Median)	Methylation in Control	5.67E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 14	Methylation of SLC47A1 in pancretic ductal adenocarcinoma			[ 6 ]
Location	Body (cg22288309)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.01E+00	Statistic Test	p-value: 2.98E-02; Z-score: -1.32E-01
Methylation in Case	8.00E-01 (Median)	Methylation in Control	8.06E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 15	Methylation of SLC47A1 in pancretic ductal adenocarcinoma			[ 6 ]
Location	3'UTR (cg06566678)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.04E+00	Statistic Test	p-value: 4.11E-06; Z-score: 1.77E+00
Methylation in Case	8.55E-01 (Median)	Methylation in Control	8.22E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Bladder cancer	14 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC47A1 in bladder cancer			[ 7 ]
Location	TSS1500 (cg01530032)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.33E+00	Statistic Test	p-value: 6.81E-07; Z-score: -4.41E+00
Methylation in Case	4.58E-01 (Median)	Methylation in Control	6.10E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC47A1 in bladder cancer			[ 7 ]
Location	TSS1500 (cg15971010)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.35E+00	Statistic Test	p-value: 4.06E-02; Z-score: 2.06E+00
Methylation in Case	3.92E-01 (Median)	Methylation in Control	2.90E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC47A1 in bladder cancer			[ 7 ]
Location	TSS200 (cg13004927)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.67E+00	Statistic Test	p-value: 3.00E-03; Z-score: 1.60E+00
Methylation in Case	5.99E-02 (Median)	Methylation in Control	3.59E-02 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC47A1 in bladder cancer			[ 7 ]
Location	TSS200 (cg07829432)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.07E+00	Statistic Test	p-value: 3.22E-02; Z-score: 4.08E-01
Methylation in Case	1.18E-01 (Median)	Methylation in Control	1.10E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC47A1 in bladder cancer			[ 7 ]
Location	TSS200 (cg15014549)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.01E+00	Statistic Test	p-value: 4.71E-02; Z-score: -7.98E-02
Methylation in Case	9.52E-02 (Median)	Methylation in Control	9.62E-02 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC47A1 in bladder cancer			[ 7 ]
Location	Body (cg24151087)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -2.86E+00	Statistic Test	p-value: 6.51E-16; Z-score: -2.13E+01
Methylation in Case	1.40E-01 (Median)	Methylation in Control	4.01E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC47A1 in bladder cancer			[ 7 ]
Location	Body (cg04308167)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.84E+00	Statistic Test	p-value: 1.65E-08; Z-score: -7.26E+00
Methylation in Case	3.43E-01 (Median)	Methylation in Control	6.32E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of SLC47A1 in bladder cancer			[ 7 ]
Location	Body (cg12799818)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -3.91E+00	Statistic Test	p-value: 1.22E-07; Z-score: -7.78E+00
Methylation in Case	8.98E-02 (Median)	Methylation in Control	3.51E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 9	Methylation of SLC47A1 in bladder cancer			[ 7 ]
Location	Body (cg08895056)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.32E+00	Statistic Test	p-value: 4.88E-07; Z-score: -4.70E+00
Methylation in Case	5.41E-01 (Median)	Methylation in Control	7.15E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 10	Methylation of SLC47A1 in bladder cancer			[ 7 ]
Location	Body (cg10718608)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.35E+00	Statistic Test	p-value: 1.43E-05; Z-score: -5.59E+00
Methylation in Case	5.02E-01 (Median)	Methylation in Control	6.75E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 11	Methylation of SLC47A1 in bladder cancer			[ 7 ]
Location	Body (cg20930201)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.46E+00	Statistic Test	p-value: 2.90E-04; Z-score: 7.75E+00
Methylation in Case	2.29E-01 (Median)	Methylation in Control	1.57E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 12	Methylation of SLC47A1 in bladder cancer			[ 7 ]
Location	Body (cg26959235)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.44E+00	Statistic Test	p-value: 2.52E-03; Z-score: 2.84E+00
Methylation in Case	1.58E-01 (Median)	Methylation in Control	1.09E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 13	Methylation of SLC47A1 in bladder cancer			[ 7 ]
Location	Body (cg16887170)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.11E+00	Statistic Test	p-value: 2.74E-03; Z-score: -2.16E+00
Methylation in Case	7.06E-01 (Median)	Methylation in Control	7.85E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 14	Methylation of SLC47A1 in bladder cancer			[ 7 ]
Location	Body (cg17332016)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.27E+00	Statistic Test	p-value: 1.14E-02; Z-score: 9.85E-01
Methylation in Case	5.12E-02 (Median)	Methylation in Control	4.02E-02 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Breast cancer	15 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC47A1 in breast cancer			[ 8 ]
Location	TSS1500 (cg15971010)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.35E+00	Statistic Test	p-value: 2.21E-07; Z-score: 1.10E+00
Methylation in Case	2.49E-01 (Median)	Methylation in Control	1.85E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC47A1 in breast cancer			[ 8 ]
Location	TSS1500 (cg21692194)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.22E+00	Statistic Test	p-value: 6.56E-06; Z-score: 8.36E-01
Methylation in Case	1.73E-01 (Median)	Methylation in Control	1.42E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC47A1 in breast cancer			[ 8 ]
Location	TSS1500 (cg25387636)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.39E+00	Statistic Test	p-value: 1.52E-05; Z-score: 1.00E+00
Methylation in Case	1.40E-01 (Median)	Methylation in Control	1.00E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC47A1 in breast cancer			[ 8 ]
Location	TSS1500 (cg01530032)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.14E+00	Statistic Test	p-value: 2.09E-04; Z-score: -1.21E+00
Methylation in Case	5.58E-01 (Median)	Methylation in Control	6.35E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC47A1 in breast cancer			[ 8 ]
Location	TSS1500 (cg12133118)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.08E+00	Statistic Test	p-value: 3.78E-02; Z-score: -7.59E-01
Methylation in Case	5.23E-01 (Median)	Methylation in Control	5.65E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC47A1 in breast cancer			[ 8 ]
Location	TSS200 (cg07829432)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.22E+00	Statistic Test	p-value: 1.95E-05; Z-score: 8.84E-01
Methylation in Case	1.07E-01 (Median)	Methylation in Control	8.72E-02 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC47A1 in breast cancer			[ 8 ]
Location	TSS200 (cg13004927)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.35E+00	Statistic Test	p-value: 5.95E-04; Z-score: 3.49E-01
Methylation in Case	3.88E-02 (Median)	Methylation in Control	2.88E-02 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of SLC47A1 in breast cancer			[ 8 ]
Location	TSS200 (cg15014549)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.13E+00	Statistic Test	p-value: 6.71E-03; Z-score: 4.96E-01
Methylation in Case	7.76E-02 (Median)	Methylation in Control	6.84E-02 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 9	Methylation of SLC47A1 in breast cancer			[ 8 ]
Location	Body (cg08895056)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.28E+00	Statistic Test	p-value: 8.26E-13; Z-score: -2.23E+00
Methylation in Case	5.37E-01 (Median)	Methylation in Control	6.88E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 10	Methylation of SLC47A1 in breast cancer			[ 8 ]
Location	Body (cg20930201)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.45E+00	Statistic Test	p-value: 1.40E-10; Z-score: 2.48E+00
Methylation in Case	2.07E-01 (Median)	Methylation in Control	1.43E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 11	Methylation of SLC47A1 in breast cancer			[ 8 ]
Location	Body (cg10718608)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.19E+00	Statistic Test	p-value: 7.64E-08; Z-score: -1.82E+00
Methylation in Case	5.62E-01 (Median)	Methylation in Control	6.67E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 12	Methylation of SLC47A1 in breast cancer			[ 8 ]
Location	Body (cg04308167)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.27E+00	Statistic Test	p-value: 1.27E-07; Z-score: -1.55E+00
Methylation in Case	4.38E-01 (Median)	Methylation in Control	5.57E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 13	Methylation of SLC47A1 in breast cancer			[ 8 ]
Location	Body (cg16887170)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.26E+00	Statistic Test	p-value: 4.94E-04; Z-score: -1.23E+00
Methylation in Case	6.20E-01 (Median)	Methylation in Control	7.83E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 14	Methylation of SLC47A1 in breast cancer			[ 8 ]
Location	Body (cg26959235)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.09E+00	Statistic Test	p-value: 5.02E-04; Z-score: 4.52E-01
Methylation in Case	1.29E-01 (Median)	Methylation in Control	1.18E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 15	Methylation of SLC47A1 in breast cancer			[ 8 ]
Location	Body (cg17332016)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.06E+00	Statistic Test	p-value: 2.52E-03; Z-score: 1.73E-01
Methylation in Case	4.83E-02 (Median)	Methylation in Control	4.55E-02 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Celiac disease	3 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC47A1 in celiac disease			[ 9 ]
Location	TSS1500 (cg21692194)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.61E+00	Statistic Test	p-value: 1.38E-03; Z-score: 1.91E+00
Methylation in Case	2.10E-01 (Median)	Methylation in Control	1.31E-01 (Median)
Studied Phenotype	Celiac disease [ ICD-11: DA95]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC47A1 in celiac disease			[ 9 ]
Location	TSS1500 (cg25387636)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.84E+00	Statistic Test	p-value: 3.58E-02; Z-score: 5.26E-01
Methylation in Case	9.86E-02 (Median)	Methylation in Control	5.37E-02 (Median)
Studied Phenotype	Celiac disease [ ICD-11: DA95]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC47A1 in celiac disease			[ 9 ]
Location	Body (cg16887170)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.22E+00	Statistic Test	p-value: 3.07E-02; Z-score: -1.14E+00
Methylation in Case	7.01E-01 (Median)	Methylation in Control	8.55E-01 (Median)
Studied Phenotype	Celiac disease [ ICD-11: DA95]
Experimental Material	Patient tissue samples
Colorectal cancer	18 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC47A1 in colorectal cancer			[ 10 ]
Location	TSS1500 (cg15971010)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 2.20E+00	Statistic Test	p-value: 1.59E-12; Z-score: 4.44E+00
Methylation in Case	4.89E-01 (Median)	Methylation in Control	2.22E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC47A1 in colorectal cancer			[ 10 ]
Location	TSS1500 (cg25387636)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 2.95E+00	Statistic Test	p-value: 2.49E-11; Z-score: 6.62E+00
Methylation in Case	3.66E-01 (Median)	Methylation in Control	1.24E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC47A1 in colorectal cancer			[ 10 ]
Location	TSS1500 (cg21692194)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.91E+00	Statistic Test	p-value: 1.67E-09; Z-score: 3.73E+00
Methylation in Case	3.04E-01 (Median)	Methylation in Control	1.59E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC47A1 in colorectal cancer			[ 10 ]
Location	TSS1500 (cg01530032)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.11E+00	Statistic Test	p-value: 1.31E-08; Z-score: -2.16E+00
Methylation in Case	7.03E-01 (Median)	Methylation in Control	7.80E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC47A1 in colorectal cancer			[ 10 ]
Location	TSS200 (cg07829432)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.82E+00	Statistic Test	p-value: 2.59E-09; Z-score: 3.90E+00
Methylation in Case	3.13E-01 (Median)	Methylation in Control	1.71E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC47A1 in colorectal cancer			[ 10 ]
Location	TSS200 (cg15014549)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.64E+00	Statistic Test	p-value: 1.01E-08; Z-score: 3.34E+00
Methylation in Case	1.91E-01 (Median)	Methylation in Control	1.17E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC47A1 in colorectal cancer			[ 10 ]
Location	TSS200 (cg13004927)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 2.17E+00	Statistic Test	p-value: 3.99E-08; Z-score: 1.58E+00
Methylation in Case	6.96E-02 (Median)	Methylation in Control	3.21E-02 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of SLC47A1 in colorectal cancer			[ 10 ]
Location	Body (cg24151087)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.34E+00	Statistic Test	p-value: 1.12E-06; Z-score: 1.88E+00
Methylation in Case	4.17E-01 (Median)	Methylation in Control	3.12E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 9	Methylation of SLC47A1 in colorectal cancer			[ 10 ]
Location	Body (cg26959235)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.29E+00	Statistic Test	p-value: 1.15E-06; Z-score: 1.32E+00
Methylation in Case	1.71E-01 (Median)	Methylation in Control	1.32E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 10	Methylation of SLC47A1 in colorectal cancer			[ 10 ]
Location	Body (cg04308167)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.07E+00	Statistic Test	p-value: 2.25E-06; Z-score: -1.17E+00
Methylation in Case	7.72E-01 (Median)	Methylation in Control	8.29E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 11	Methylation of SLC47A1 in colorectal cancer			[ 10 ]
Location	Body (cg20930201)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.40E+00	Statistic Test	p-value: 3.29E-06; Z-score: 1.80E+00
Methylation in Case	3.26E-01 (Median)	Methylation in Control	2.34E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 12	Methylation of SLC47A1 in colorectal cancer			[ 10 ]
Location	Body (cg17332016)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.04E+00	Statistic Test	p-value: 7.25E-05; Z-score: 2.14E-01
Methylation in Case	1.37E-01 (Median)	Methylation in Control	1.32E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 13	Methylation of SLC47A1 in colorectal cancer			[ 10 ]
Location	Body (cg10718608)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.05E+00	Statistic Test	p-value: 5.08E-04; Z-score: -7.26E-01
Methylation in Case	8.24E-01 (Median)	Methylation in Control	8.62E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 14	Methylation of SLC47A1 in colorectal cancer			[ 10 ]
Location	Body (cg11784214)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.01E+00	Statistic Test	p-value: 8.98E-04; Z-score: -9.82E-01
Methylation in Case	9.32E-01 (Median)	Methylation in Control	9.41E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 15	Methylation of SLC47A1 in colorectal cancer			[ 10 ]
Location	Body (cg08895056)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.04E+00	Statistic Test	p-value: 9.10E-04; Z-score: -6.30E-01
Methylation in Case	7.92E-01 (Median)	Methylation in Control	8.20E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 16	Methylation of SLC47A1 in colorectal cancer			[ 10 ]
Location	Body (cg16887170)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.01E+00	Statistic Test	p-value: 1.94E-02; Z-score: -4.04E-01
Methylation in Case	8.71E-01 (Median)	Methylation in Control	8.81E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 17	Methylation of SLC47A1 in colorectal cancer			[ 10 ]
Location	Body (cg12799818)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.01E+00	Statistic Test	p-value: 4.17E-02; Z-score: 9.34E-02
Methylation in Case	2.71E-01 (Median)	Methylation in Control	2.67E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
HIV infection	11 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC47A1 in HIV infection			[ 11 ]
Location	TSS1500 (cg15971010)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.25E+00	Statistic Test	p-value: 4.88E-03; Z-score: 6.76E-01
Methylation in Case	1.70E-01 (Median)	Methylation in Control	1.36E-01 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC47A1 in HIV infection			[ 11 ]
Location	TSS1500 (cg25387636)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.32E+00	Statistic Test	p-value: 5.93E-03; Z-score: 9.43E-01
Methylation in Case	9.77E-02 (Median)	Methylation in Control	7.37E-02 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC47A1 in HIV infection			[ 11 ]
Location	TSS200 (cg07829432)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.34E+00	Statistic Test	p-value: 1.21E-04; Z-score: 1.43E+00
Methylation in Case	1.14E-01 (Median)	Methylation in Control	8.46E-02 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC47A1 in HIV infection			[ 11 ]
Location	TSS200 (cg13004927)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 2.65E+00	Statistic Test	p-value: 1.73E-03; Z-score: 2.20E+00
Methylation in Case	4.52E-02 (Median)	Methylation in Control	1.71E-02 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC47A1 in HIV infection			[ 11 ]
Location	Body (cg24151087)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.49E+00	Statistic Test	p-value: 2.12E-06; Z-score: 2.25E+00
Methylation in Case	1.91E-01 (Median)	Methylation in Control	1.28E-01 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC47A1 in HIV infection			[ 11 ]
Location	Body (cg16887170)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.10E+00	Statistic Test	p-value: 1.11E-05; Z-score: -2.19E+00
Methylation in Case	7.61E-01 (Median)	Methylation in Control	8.36E-01 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC47A1 in HIV infection			[ 11 ]
Location	Body (cg12799818)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.50E+00	Statistic Test	p-value: 2.09E-05; Z-score: 1.85E+00
Methylation in Case	8.68E-02 (Median)	Methylation in Control	5.78E-02 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of SLC47A1 in HIV infection			[ 11 ]
Location	Body (cg20930201)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.34E+00	Statistic Test	p-value: 4.18E-05; Z-score: 2.31E+00
Methylation in Case	2.32E-01 (Median)	Methylation in Control	1.74E-01 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 9	Methylation of SLC47A1 in HIV infection			[ 11 ]
Location	Body (cg12894055)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.25E+00	Statistic Test	p-value: 4.43E-04; Z-score: 8.90E-01
Methylation in Case	5.22E-02 (Median)	Methylation in Control	4.18E-02 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 10	Methylation of SLC47A1 in HIV infection			[ 11 ]
Location	Body (cg26959235)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.19E+00	Statistic Test	p-value: 1.57E-02; Z-score: 7.72E-01
Methylation in Case	1.45E-01 (Median)	Methylation in Control	1.22E-01 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 11	Methylation of SLC47A1 in HIV infection			[ 11 ]
Location	Body (cg10718608)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.18E+00	Statistic Test	p-value: 3.00E-02; Z-score: 1.30E+00
Methylation in Case	3.15E-01 (Median)	Methylation in Control	2.67E-01 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Prostate cancer	3 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC47A1 in prostate cancer			[ 12 ]
Location	TSS1500 (cg20533553)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.22E+00	Statistic Test	p-value: 2.38E-02; Z-score: 2.62E+00
Methylation in Case	7.79E-01 (Median)	Methylation in Control	6.38E-01 (Median)
Studied Phenotype	Prostate cancer [ ICD-11: 2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC47A1 in prostate cancer			[ 12 ]
Location	Body (cg08874645)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.17E+00	Statistic Test	p-value: 1.34E-02; Z-score: 1.88E+00
Methylation in Case	8.36E-01 (Median)	Methylation in Control	7.15E-01 (Median)
Studied Phenotype	Prostate cancer [ ICD-11: 2C82]
Experimental Material	Patient tissue samples
Renal cell carcinoma	7 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC47A1 in clear cell renal cell carcinoma			[ 13 ]
Location	TSS200 (cg15014549)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.13E+00	Statistic Test	p-value: 1.50E-02; Z-score: 5.02E-01
Methylation in Case	3.47E-02 (Median)	Methylation in Control	3.06E-02 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC47A1 in clear cell renal cell carcinoma			[ 13 ]
Location	TSS200 (cg07829432)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.14E+00	Statistic Test	p-value: 3.16E-02; Z-score: 2.64E-01
Methylation in Case	3.80E-02 (Median)	Methylation in Control	3.34E-02 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC47A1 in clear cell renal cell carcinoma			[ 13 ]
Location	Body (cg12894055)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -2.41E+00	Statistic Test	p-value: 6.34E-08; Z-score: -2.52E+00
Methylation in Case	5.62E-02 (Median)	Methylation in Control	1.35E-01 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC47A1 in clear cell renal cell carcinoma			[ 13 ]
Location	Body (cg10718608)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.32E+00	Statistic Test	p-value: 3.14E-07; Z-score: -3.83E+00
Methylation in Case	5.26E-01 (Median)	Methylation in Control	6.94E-01 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC47A1 in clear cell renal cell carcinoma			[ 13 ]
Location	Body (cg08895056)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.32E+00	Statistic Test	p-value: 1.59E-06; Z-score: -3.32E+00
Methylation in Case	5.11E-01 (Median)	Methylation in Control	6.73E-01 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC47A1 in clear cell renal cell carcinoma			[ 13 ]
Location	Body (cg20930201)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.36E+00	Statistic Test	p-value: 4.54E-03; Z-score: 9.20E-01
Methylation in Case	1.07E-01 (Median)	Methylation in Control	7.89E-02 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC47A1 in clear cell renal cell carcinoma			[ 13 ]
Location	3'UTR (cg12550399)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.12E+00	Statistic Test	p-value: 2.75E-03; Z-score: 2.21E+00
Methylation in Case	8.54E-01 (Median)	Methylation in Control	7.64E-01 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Lung adenocarcinoma	8 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC47A1 in lung adenocarcinoma			[ 14 ]
Location	TSS200 (cg07829432)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.46E+00	Statistic Test	p-value: 3.51E-03; Z-score: 3.46E+00
Methylation in Case	1.84E-01 (Median)	Methylation in Control	1.26E-01 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC47A1 in lung adenocarcinoma			[ 14 ]
Location	TSS200 (cg15014549)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.20E+00	Statistic Test	p-value: 7.76E-03; Z-score: 2.65E+00
Methylation in Case	1.25E-01 (Median)	Methylation in Control	1.04E-01 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC47A1 in lung adenocarcinoma			[ 14 ]
Location	TSS200 (cg13004927)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.62E+00	Statistic Test	p-value: 4.44E-02; Z-score: 1.78E+00
Methylation in Case	7.07E-02 (Median)	Methylation in Control	4.38E-02 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC47A1 in lung adenocarcinoma			[ 14 ]
Location	Body (cg10718608)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.29E+00	Statistic Test	p-value: 5.10E-05; Z-score: -3.35E+00
Methylation in Case	4.90E-01 (Median)	Methylation in Control	6.34E-01 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC47A1 in lung adenocarcinoma			[ 14 ]
Location	Body (cg08895056)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.23E+00	Statistic Test	p-value: 1.04E-04; Z-score: -2.47E+00
Methylation in Case	5.25E-01 (Median)	Methylation in Control	6.48E-01 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC47A1 in lung adenocarcinoma			[ 14 ]
Location	Body (cg12894055)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.49E+00	Statistic Test	p-value: 5.84E-03; Z-score: -1.48E+00
Methylation in Case	1.49E-01 (Median)	Methylation in Control	2.22E-01 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC47A1 in lung adenocarcinoma			[ 14 ]
Location	Body (cg16887170)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.06E+00	Statistic Test	p-value: 7.22E-03; Z-score: -1.53E+00
Methylation in Case	7.68E-01 (Median)	Methylation in Control	8.13E-01 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of SLC47A1 in lung adenocarcinoma			[ 14 ]
Location	Body (cg20930201)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.16E+00	Statistic Test	p-value: 2.61E-02; Z-score: 1.29E+00
Methylation in Case	2.47E-01 (Median)	Methylation in Control	2.13E-01 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Panic disorder	3 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC47A1 in panic disorder			[ 15 ]
Location	TSS200 (cg15014549)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 9.75E-01	Statistic Test	p-value: 6.59E-03; Z-score: 3.02E-01
Methylation in Case	-4.09E+00 (Median)	Methylation in Control	-4.19E+00 (Median)
Studied Phenotype	Panic disorder [ ICD-11: 6B01]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC47A1 in panic disorder			[ 15 ]
Location	Body (cg17332016)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -9.80E-01	Statistic Test	p-value: 2.59E-02; Z-score: -3.18E-01
Methylation in Case	-5.20E+00 (Median)	Methylation in Control	-5.10E+00 (Median)
Studied Phenotype	Panic disorder [ ICD-11: 6B01]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC47A1 in panic disorder			[ 15 ]
Location	Body (cg10718608)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 9.46E-01	Statistic Test	p-value: 4.36E-02; Z-score: 3.36E-01
Methylation in Case	-1.97E+00 (Median)	Methylation in Control	-2.09E+00 (Median)
Studied Phenotype	Panic disorder [ ICD-11: 6B01]
Experimental Material	Patient tissue samples
Atypical teratoid rhabdoid tumor	7 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC47A1 in atypical teratoid rhabdoid tumor			[ 16 ]
Location	Body (cg04308167)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.29E+00	Statistic Test	p-value: 6.87E-04; Z-score: -9.00E-01
Methylation in Case	3.86E-01 (Median)	Methylation in Control	4.96E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC47A1 in atypical teratoid rhabdoid tumor			[ 16 ]
Location	Body (cg08895056)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.04E+00	Statistic Test	p-value: 8.62E-03; Z-score: 4.86E-01
Methylation in Case	9.34E-01 (Median)	Methylation in Control	9.02E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC47A1 in atypical teratoid rhabdoid tumor			[ 16 ]
Location	Body (cg10718608)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.05E+00	Statistic Test	p-value: 1.75E-02; Z-score: -3.83E-01
Methylation in Case	7.59E-01 (Median)	Methylation in Control	7.96E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC47A1 in atypical teratoid rhabdoid tumor			[ 16 ]
Location	Body (cg11784214)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.51E+00	Statistic Test	p-value: 2.49E-02; Z-score: -6.29E-01
Methylation in Case	1.74E-01 (Median)	Methylation in Control	2.62E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC47A1 in atypical teratoid rhabdoid tumor			[ 16 ]
Location	Body (cg12799818)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.22E+00	Statistic Test	p-value: 2.97E-02; Z-score: 8.34E-01
Methylation in Case	6.40E-01 (Median)	Methylation in Control	5.27E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC47A1 in atypical teratoid rhabdoid tumor			[ 16 ]
Location	Body (cg12894055)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.05E+00	Statistic Test	p-value: 3.11E-02; Z-score: 3.82E-01
Methylation in Case	8.83E-01 (Median)	Methylation in Control	8.39E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC47A1 in atypical teratoid rhabdoid tumor			[ 16 ]
Location	3'UTR (cg12550399)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.60E+00	Statistic Test	p-value: 1.55E-11; Z-score: -1.75E+00
Methylation in Case	2.62E-01 (Median)	Methylation in Control	4.19E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Depression	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC47A1 in depression			[ 17 ]
Location	Body (cg16887170)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.02E+00	Statistic Test	p-value: 1.07E-03; Z-score: -6.47E-01
Methylation in Case	7.63E-01 (Median)	Methylation in Control	7.80E-01 (Median)
Studied Phenotype	Depression [ ICD-11: 6A8Z]
Experimental Material	Patient tissue samples
Papillary thyroid cancer	8 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC47A1 in papillary thyroid cancer			[ 18 ]
Location	Body (cg12894055)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.65E+00	Statistic Test	p-value: 2.07E-17; Z-score: -1.68E+00
Methylation in Case	9.77E-02 (Median)	Methylation in Control	1.61E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC47A1 in papillary thyroid cancer			[ 18 ]
Location	Body (cg26959235)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.26E+00	Statistic Test	p-value: 5.83E-16; Z-score: -1.96E+00
Methylation in Case	1.52E-01 (Median)	Methylation in Control	1.91E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC47A1 in papillary thyroid cancer			[ 18 ]
Location	Body (cg24151087)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.32E+00	Statistic Test	p-value: 1.46E-13; Z-score: -2.20E+00
Methylation in Case	4.10E-01 (Median)	Methylation in Control	5.41E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC47A1 in papillary thyroid cancer			[ 18 ]
Location	Body (cg08895056)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.32E+00	Statistic Test	p-value: 3.58E-12; Z-score: -1.97E+00
Methylation in Case	3.56E-01 (Median)	Methylation in Control	4.70E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC47A1 in papillary thyroid cancer			[ 18 ]
Location	Body (cg10718608)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.25E+00	Statistic Test	p-value: 1.10E-10; Z-score: -1.78E+00
Methylation in Case	3.68E-01 (Median)	Methylation in Control	4.60E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC47A1 in papillary thyroid cancer			[ 18 ]
Location	Body (cg12799818)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.34E+00	Statistic Test	p-value: 3.35E-07; Z-score: -1.56E+00
Methylation in Case	2.92E-01 (Median)	Methylation in Control	3.90E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC47A1 in papillary thyroid cancer			[ 18 ]
Location	Body (cg17332016)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.10E+00	Statistic Test	p-value: 1.43E-03; Z-score: -4.84E-01
Methylation in Case	4.25E-02 (Median)	Methylation in Control	4.68E-02 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of SLC47A1 in papillary thyroid cancer			[ 18 ]
Location	Body (cg04308167)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.03E+00	Statistic Test	p-value: 1.31E-02; Z-score: -4.65E-01
Methylation in Case	7.60E-01 (Median)	Methylation in Control	7.85E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Systemic lupus erythematosus	4 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC47A1 in systemic lupus erythematosus			[ 19 ]
Location	Body (cg04308167)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.11E+00	Statistic Test	p-value: 6.32E-03; Z-score: -3.99E-01
Methylation in Case	4.89E-01 (Median)	Methylation in Control	5.44E-01 (Median)
Studied Phenotype	Systemic lupus erythematosus [ ICD-11: 4A40.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC47A1 in systemic lupus erythematosus			[ 19 ]
Location	Body (cg11784214)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.01E+00	Statistic Test	p-value: 1.40E-02; Z-score: -1.44E-01
Methylation in Case	8.30E-01 (Median)	Methylation in Control	8.35E-01 (Median)
Studied Phenotype	Systemic lupus erythematosus [ ICD-11: 4A40.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC47A1 in systemic lupus erythematosus			[ 19 ]
Location	Body (cg12894055)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.06E+00	Statistic Test	p-value: 1.79E-02; Z-score: -1.01E-01
Methylation in Case	7.10E-02 (Median)	Methylation in Control	7.53E-02 (Median)
Studied Phenotype	Systemic lupus erythematosus [ ICD-11: 4A40.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC47A1 in systemic lupus erythematosus			[ 19 ]
Location	Body (cg16887170)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.01E+00	Statistic Test	p-value: 3.38E-02; Z-score: -8.87E-02
Methylation in Case	7.87E-01 (Median)	Methylation in Control	7.94E-01 (Median)
Studied Phenotype	Systemic lupus erythematosus [ ICD-11: 4A40.0]
Experimental Material	Patient tissue samples
Gastric cancer	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Moderate/moderate hypermethylation of SLC47A1 in gastric cancer than that in healthy individual/adjacent tissue
Studied Phenotype	Gastric cancer [ICD-11:2B72]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 4.98E-15; Fold-change: 0.209868716; Z-score: 1.624788814
The Methylation Level of Disease Section Compare with the Adjacent Tissue	p-value: 8.21E-66; Fold-change: 0.284929054; Z-score: 170.8903475
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue adjacent to the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data of patients in the normal section of the tissue adjacent to the disease section Download DT methylation data in the tissue of healthy individual
Prostate cancer metastasis	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Moderate hypermethylation of SLC47A1 in prostate cancer metastasis than that in healthy individual
Studied Phenotype	Prostate cancer metastasis [ICD-11:2.00E+06]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 0.037135313; Fold-change: 0.242405384; Z-score: 9.410363493
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
microRNA
Unclear Phenotype	52 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	miR-1275 directly targets SLC47A1			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-1275	miRNA Mature ID	miR-1275
miRNA Sequence	GUGGGGGAGAGGCUGUC
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 2	miR-1307 directly targets SLC47A1			[ 21 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-1307	miRNA Mature ID	miR-1307-3p
miRNA Sequence	ACUCGGCGUGGCGUCGGUCGUG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 3	miR-1343 directly targets SLC47A1			[ 21 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-1343	miRNA Mature ID	miR-1343-5p
miRNA Sequence	UGGGGAGCGGCCCCCGGGUGGG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 4	miR-149 directly targets SLC47A1			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-149	miRNA Mature ID	miR-149-3p
miRNA Sequence	AGGGAGGGACGGGGGCUGUGC
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 5	miR-181d directly targets SLC47A1			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-181d	miRNA Mature ID	miR-181d-3p
miRNA Sequence	CCACCGGGGGAUGAAUGUCAC
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 6	miR-1908 directly targets SLC47A1			[ 21 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-1908	miRNA Mature ID	miR-1908-5p
miRNA Sequence	CGGCGGGGACGGCGAUUGGUC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 7	miR-212 directly targets SLC47A1			[ 21 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-212	miRNA Mature ID	miR-212-5p
miRNA Sequence	ACCUUGGCUCUAGACUGCUUACU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 8	miR-3144 directly targets SLC47A1			[ 21 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-3144	miRNA Mature ID	miR-3144-5p
miRNA Sequence	AGGGGACCAAAGAGAUAUAUAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 9	miR-3189 directly targets SLC47A1			[ 21 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-3189	miRNA Mature ID	miR-3189-3p
miRNA Sequence	CCCUUGGGUCUGAUGGGGUAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 10	miR-326 directly targets SLC47A1			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-326	miRNA Mature ID	miR-326
miRNA Sequence	CCUCUGGGCCCUUCCUCCAG
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 11	miR-330 directly targets SLC47A1			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-330	miRNA Mature ID	miR-330-5p
miRNA Sequence	UCUCUGGGCCUGUGUCUUAGGC
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 12	miR-3616 directly targets SLC47A1			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-3616	miRNA Mature ID	miR-3616-3p
miRNA Sequence	CGAGGGCAUUUCAUGAUGCAGGC
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 13	miR-3960 directly targets SLC47A1			[ 21 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-3960	miRNA Mature ID	miR-3960
miRNA Sequence	GGCGGCGGCGGAGGCGGGGG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 14	miR-4300 directly targets SLC47A1			[ 21 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-4300	miRNA Mature ID	miR-4300
miRNA Sequence	UGGGAGCUGGACUACUUC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 15	miR-4467 directly targets SLC47A1			[ 21 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-4467	miRNA Mature ID	miR-4467
miRNA Sequence	UGGCGGCGGUAGUUAUGGGCUU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 16	miR-4525 directly targets SLC47A1			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-4525	miRNA Mature ID	miR-4525
miRNA Sequence	GGGGGGAUGUGCAUGCUGGUU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 17	miR-4655 directly targets SLC47A1			[ 21 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-4655	miRNA Mature ID	miR-4655-5p
miRNA Sequence	CACCGGGGAUGGCAGAGGGUCG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 18	miR-4665 directly targets SLC47A1			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-4665	miRNA Mature ID	miR-4665-5p
miRNA Sequence	CUGGGGGACGCGUGAGCGCGAGC
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 19	miR-4667 directly targets SLC47A1			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-4667	miRNA Mature ID	miR-4667-5p
miRNA Sequence	ACUGGGGAGCAGAAGGAGAACC
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 20	miR-4680 directly targets SLC47A1			[ 21 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-4680	miRNA Mature ID	miR-4680-5p
miRNA Sequence	AGAACUCUUGCAGUCUUAGAUGU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 21	miR-4700 directly targets SLC47A1			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-4700	miRNA Mature ID	miR-4700-5p
miRNA Sequence	UCUGGGGAUGAGGACAGUGUGU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 22	miR-4706 directly targets SLC47A1			[ 21 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-4706	miRNA Mature ID	miR-4706
miRNA Sequence	AGCGGGGAGGAAGUGGGCGCUGCUU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 23	miR-4723 directly targets SLC47A1			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-4723	miRNA Mature ID	miR-4723-5p
miRNA Sequence	UGGGGGAGCCAUGAGAUAAGAGCA
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 24	miR-4728 directly targets SLC47A1			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-4728	miRNA Mature ID	miR-4728-5p
miRNA Sequence	UGGGAGGGGAGAGGCAGCAAGCA
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 25	miR-4730 directly targets SLC47A1			[ 21 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-4730	miRNA Mature ID	miR-4730
miRNA Sequence	CUGGCGGAGCCCAUUCCAUGCCA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 26	miR-4749 directly targets SLC47A1			[ 21 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-4749	miRNA Mature ID	miR-4749-5p
miRNA Sequence	UGCGGGGACAGGCCAGGGCAUC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 27	miR-5008 directly targets SLC47A1			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-5008	miRNA Mature ID	miR-5008-5p
miRNA Sequence	UGAGGCCCUUGGGGCACAGUGG
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 28	miR-5010 directly targets SLC47A1			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-5010	miRNA Mature ID	miR-5010-5p
miRNA Sequence	AGGGGGAUGGCAGAGCAAAAUU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 29	miR-514a directly targets SLC47A1			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-514a	miRNA Mature ID	miR-514a-5p
miRNA Sequence	UACUCUGGAGAGUGACAAUCAUG
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 30	miR-5591 directly targets SLC47A1			[ 21 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-5591	miRNA Mature ID	miR-5591-5p
miRNA Sequence	UGGGAGCUAAGCUAUGGGUAU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 31	miR-5698 directly targets SLC47A1			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-5698	miRNA Mature ID	miR-5698
miRNA Sequence	UGGGGGAGUGCAGUGAUUGUGG
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 32	miR-625 directly targets SLC47A1			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-625	miRNA Mature ID	miR-625-5p
miRNA Sequence	AGGGGGAAAGUUCUAUAGUCC
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 33	miR-637 directly targets SLC47A1			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-637	miRNA Mature ID	miR-637
miRNA Sequence	ACUGGGGGCUUUCGGGCUCUGCGU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 34	miR-663a directly targets SLC47A1			[ 21 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-663a	miRNA Mature ID	miR-663a
miRNA Sequence	AGGCGGGGCGCCGCGGGACCGC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 35	miR-6726 directly targets SLC47A1			[ 21 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-6726	miRNA Mature ID	miR-6726-5p
miRNA Sequence	CGGGAGCUGGGGUCUGCAGGU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 36	miR-6770 directly targets SLC47A1			[ 21 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-6770	miRNA Mature ID	miR-6770-3p
miRNA Sequence	CUGGCGGCUGUGUCUUCACAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 37	miR-6777 directly targets SLC47A1			[ 21 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-6777	miRNA Mature ID	miR-6777-5p
miRNA Sequence	ACGGGGAGUCAGGCAGUGGUGGA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 38	miR-6784 directly targets SLC47A1			[ 21 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-6784	miRNA Mature ID	miR-6784-5p
miRNA Sequence	GCCGGGGCUUUGGGUGAGGG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 39	miR-6785 directly targets SLC47A1			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-6785	miRNA Mature ID	miR-6785-5p
miRNA Sequence	UGGGAGGGCGUGGAUGAUGGUG
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 40	miR-6787 directly targets SLC47A1			[ 21 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-6787	miRNA Mature ID	miR-6787-5p
miRNA Sequence	UGGCGGGGGUAGAGCUGGCUGC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 41	miR-6825 directly targets SLC47A1			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-6825	miRNA Mature ID	miR-6825-5p
miRNA Sequence	UGGGGAGGUGUGGAGUCAGCAU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 42	miR-6851 directly targets SLC47A1			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-6851	miRNA Mature ID	miR-6851-3p
miRNA Sequence	UGGCCCUUUGUACCCCUCCAG
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 43	miR-6870 directly targets SLC47A1			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-6870	miRNA Mature ID	miR-6870-5p
miRNA Sequence	UGGGGGAGAUGGGGGUUGA
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 44	miR-6883 directly targets SLC47A1			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-6883	miRNA Mature ID	miR-6883-5p
miRNA Sequence	AGGGAGGGUGUGGUAUGGAUGU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 45	miR-6889 directly targets SLC47A1			[ 21 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-6889	miRNA Mature ID	miR-6889-5p
miRNA Sequence	UCGGGGAGUCUGGGGUCCGGAAU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 46	miR-7111 directly targets SLC47A1			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-7111	miRNA Mature ID	miR-7111-5p
miRNA Sequence	UGGGGGAGGAAGGACAGGCCAU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 47	miR-7155 directly targets SLC47A1			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-7155	miRNA Mature ID	miR-7155-5p
miRNA Sequence	UCUGGGGUCUUGGGCCAUC
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 48	miR-7160 directly targets SLC47A1			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-7160	miRNA Mature ID	miR-7160-3p
miRNA Sequence	CAGGGCCCUGGCUUUAGCAGA
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 49	miR-8072 directly targets SLC47A1			[ 21 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-8072	miRNA Mature ID	miR-8072
miRNA Sequence	GGCGGCGGGGAGGUAGGCAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 50	miR-8089 directly targets SLC47A1			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-8089	miRNA Mature ID	miR-8089
miRNA Sequence	CCUGGGGACAGGGGAUUGGGGCAG
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 51	miR-920 directly targets SLC47A1			[ 21 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-920	miRNA Mature ID	miR-920
miRNA Sequence	GGGGAGCUGUGGAAGCAGUA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 52	miR-939 directly targets SLC47A1			[ 21 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-939	miRNA Mature ID	miR-939-5p
miRNA Sequence	UGGGGAGCUGAGGCUCUGGGGGUG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Human liver tissue	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	miR-95 regulates SLC47A1 expression			[ 22 ]
Epigenetic Type	microRNA	Experiment Method	Taqman OpenArray Human miRNA Panel
miRNA Stemloop ID	miR-95	miRNA Mature ID	miR-95-5p
miRNA Sequence	UCAAUAAAUGUCUGUUGAAUU
miRNA Target Type	Undirect
Studied Phenotype	Human liver tissue
Experimental Material	Patient tissue samples
Additional Notes	The effects of rifampin on four uptake drug transporters SLC47A1 were negatively correlated with the rifampin effects on miR-95 expression(r=-0.79, p=0.0048).

References
1	Diabetes medication associates with DNA methylation of metformin transporter genes in the human liver. Clin Epigenetics. 2017 Sep 21;9:102.
2	Relationship between DNA Methylation in the 5' CpG Island of the SLC47A1 (Multidrug and Toxin Extrusion Protein MATE1) Gene and Interindividual Variability in MATE1 Expression in the Human Liver. Mol Pharmacol. 2018 Jan;93(1):1-7.
3	A targeted analysis reveals relevant shifts in the methylation and transcription of genes responsible for bile acid homeostasis and drug metabolism in non-alcoholic fatty liver disease. BMC Genomics. 2016 Jun 14;17:462.
4	Genome-scale analysis of DNA methylation in colorectal cancer using Infinium HumanMethylation450 BeadChips. Epigenetics. 2013 Sep;8(9):921-34.
5	Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
6	Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
7	DNA Methylation Dynamics in Urological Tumors.
8	Genome-wide Scan for Methylation Profiles in Breast Cancer
9	The methylome of the celiac intestinal epithelium harbours genotype-independent alterations in the HLA region. Mol Ther Oncolytics. 2019 Feb 5;12:235-245.
10	Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
11	HIV-1 Infection Accelerates Age According to the Epigenetic Clock. J Infect Dis. 2015 Nov 15;212(10):1563-73.
12	Reducing the risk of false discovery enabling identification of biologically significant genome-wide methylation status using the HumanMethylation450 array. BMC Genomics. 2014 Jan 22;15:51.
13	A CpG-methylation-based assay to predict survival in clear cell renal cell carcinoma. Nat Commun. 2015 Oct 30;6:8699.
14	DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
15	DNA Methylation signatures in panic disorder. Transl Psychiatry. 2017 Dec 18;7(12):1287.
16	Atypical Teratoid/Rhabdoid Tumors Are Comprised of Three Epigenetic Subgroups with Distinct Enhancer Landscapes. Cancer Cell. 2016 Mar 14;29(3):379-393.
17	DNA methylation and inflammation marker profiles associated with a history of depression. Hum Mol Genet. 2018 Aug 15;27(16):2840-2850.
18	Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
19	Genome-wide DNA methylation analysis of systemic lupus erythematosus reveals persistent hypomethylation of interferon genes and compositional changes to CD4+ T-cell populations. PLoS Genet. 2013;9(8):e1003678.
20	Transcriptome-wide identification of RNA-binding protein and microRNA target sites by PAR-CLIP. Cell. 2010 Apr 2;141(1):129-41.
21	In-depth analysis of the interaction of HIV-1 with cellular microRNA biogenesis and effector mechanisms. MBio. 2013 Apr 16;4(2):e000193.
22	Rifampin Regulation of Drug Transporters Gene Expression and the Association of MicroRNAs in Human Hepatocytes. Front Pharmacol. 2016 Apr 26;7:111.

If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.

Detail Information of Epigenetic Regulations

Visitor Map

Correspondence