Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID	DTD0009 Transporter Info
Gene Name	SLC22A3
Transporter Name	Organic cation transporter 3
Gene ID	6581
UniProt ID	O75751

Epigenetic Regulations of This DT (EGR)
Methylation
Prostate cancer	15 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Hypermethylation of SLC22A3 in prostate cancer			[ 1 ]
Location	Promoter
Epigenetic Type	Methylation	Experiment Method	Methylation-specific PCR
Related Molecular Changes	Down regulation of SLC22A3	Experiment Method	RT-qPCR
Studied Phenotype	Prostate cancer [ ICD-11: 2C82]
Frequency	62% of the studied tumor samples
Experimental Material	Patient tissue samples
Additional Notes	Aberrant methylation contributes to the reduced expression of OCT3 in prostate cancer.
Epigenetic Phenomenon 2	Methylation of SLC22A3 in prostate cancer			[ 13 ]
Location	TSS1500 (cg19936194)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.82E+00	Statistic Test	p-value: 1.10E-04; Z-score: 8.72E+00
Methylation in Case	1.29E-01 (Median)	Methylation in Control	7.08E-02 (Median)
Studied Phenotype	Prostate cancer [ ICD-11: 2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC22A3 in prostate cancer			[ 13 ]
Location	TSS1500 (cg27520549)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.12E+00	Statistic Test	p-value: 2.31E-02; Z-score: 1.66E+00
Methylation in Case	9.17E-01 (Median)	Methylation in Control	8.20E-01 (Median)
Studied Phenotype	Prostate cancer [ ICD-11: 2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC22A3 in prostate cancer			[ 13 ]
Location	TSS200 (cg07589968)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.41E+00	Statistic Test	p-value: 7.97E-03; Z-score: 7.46E+00
Methylation in Case	6.61E-01 (Median)	Methylation in Control	4.68E-01 (Median)
Studied Phenotype	Prostate cancer [ ICD-11: 2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC22A3 in prostate cancer			[ 13 ]
Location	1stExon (cg06987672)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 2.00E+00	Statistic Test	p-value: 2.23E-02; Z-score: 8.99E+00
Methylation in Case	1.78E-01 (Median)	Methylation in Control	8.89E-02 (Median)
Studied Phenotype	Prostate cancer [ ICD-11: 2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC22A3 in prostate cancer			[ 13 ]
Location	1stExon (cg09840840)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.45E+00	Statistic Test	p-value: 4.68E-02; Z-score: -2.18E+00
Methylation in Case	5.05E-02 (Median)	Methylation in Control	7.30E-02 (Median)
Studied Phenotype	Prostate cancer [ ICD-11: 2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC22A3 in prostate cancer			[ 13 ]
Location	Body (cg03816707)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 2.12E+00	Statistic Test	p-value: 2.57E-03; Z-score: 3.88E+00
Methylation in Case	5.43E-01 (Median)	Methylation in Control	2.57E-01 (Median)
Studied Phenotype	Prostate cancer [ ICD-11: 2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of SLC22A3 in prostate cancer			[ 13 ]
Location	Body (cg03924551)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.24E+00	Statistic Test	p-value: 3.15E-03; Z-score: 2.84E+00
Methylation in Case	8.75E-01 (Median)	Methylation in Control	7.08E-01 (Median)
Studied Phenotype	Prostate cancer [ ICD-11: 2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 9	Methylation of SLC22A3 in prostate cancer			[ 13 ]
Location	Body (cg02114341)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.13E+00	Statistic Test	p-value: 3.96E-03; Z-score: 3.03E+00
Methylation in Case	9.10E-01 (Median)	Methylation in Control	8.04E-01 (Median)
Studied Phenotype	Prostate cancer [ ICD-11: 2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 10	Methylation of SLC22A3 in prostate cancer			[ 13 ]
Location	Body (cg12619347)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.27E+00	Statistic Test	p-value: 9.34E-03; Z-score: -3.31E+00
Methylation in Case	6.03E-01 (Median)	Methylation in Control	7.68E-01 (Median)
Studied Phenotype	Prostate cancer [ ICD-11: 2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 11	Methylation of SLC22A3 in prostate cancer			[ 13 ]
Location	Body (cg01432055)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.04E+00	Statistic Test	p-value: 9.92E-03; Z-score: 2.59E+00
Methylation in Case	9.52E-01 (Median)	Methylation in Control	9.18E-01 (Median)
Studied Phenotype	Prostate cancer [ ICD-11: 2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 12	Methylation of SLC22A3 in prostate cancer			[ 13 ]
Location	Body (cg09790270)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.36E+00	Statistic Test	p-value: 2.57E-02; Z-score: 2.30E+00
Methylation in Case	7.07E-01 (Median)	Methylation in Control	5.19E-01 (Median)
Studied Phenotype	Prostate cancer [ ICD-11: 2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 13	Methylation of SLC22A3 in prostate cancer			[ 13 ]
Location	Body (cg10125193)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.07E+00	Statistic Test	p-value: 3.83E-02; Z-score: 1.93E+00
Methylation in Case	9.09E-01 (Median)	Methylation in Control	8.51E-01 (Median)
Studied Phenotype	Prostate cancer [ ICD-11: 2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 14	Methylation of SLC22A3 in prostate cancer			[ 13 ]
Location	Body (cg20083442)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.48E+00	Statistic Test	p-value: 3.92E-02; Z-score: -3.02E+00
Methylation in Case	4.19E-01 (Median)	Methylation in Control	6.17E-01 (Median)
Studied Phenotype	Prostate cancer [ ICD-11: 2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 15	Methylation of SLC22A3 in prostate cancer			[ 13 ]
Location	Body (cg22077670)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.27E+00	Statistic Test	p-value: 4.81E-02; Z-score: 1.81E+00
Methylation in Case	8.28E-01 (Median)	Methylation in Control	6.55E-01 (Median)
Studied Phenotype	Prostate cancer [ ICD-11: 2C82]
Experimental Material	Patient tissue samples
Diabetes	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Hypermethylation of SLC22A3 in diabetes			[ 2 ]
Location	Promoter (5 CpG sites)
Epigenetic Type	Methylation	Experiment Method	HumanMethylation450 BeadChip
Related Molecular Changes	Down regulation of SLC22A3	Experiment Method	RT-qPCR
Studied Phenotype	Diabetes [ ICD-11: 5A10-5A14]
Experimental Material	Patient tissue samples
Additional Notes	Higher methylation in a CpG site located in SLC22A3 was associated with lower expression in the human liver and also with insulin plus metformin therapy, higher glucose levels, and BMI.
Esophageal squamous cell carcinoma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Hypermethylation of SLC22A3 in esophageal squamous cell carcinoma			[ 3 ]
Location	Promoter
Epigenetic Type	Methylation	Experiment Method	Methylation-specific PCR
Related Molecular Changes	Down regulation of SLC22A3	Experiment Method	RT-qPCR
Studied Phenotype	Esophageal squamous cell carcinoma [ ICD-11: 2E60.1]
Experimental Material	Patient tissue samples
Additional Notes	SLC22A3 promoter Hypermethylation may directly suppresses its gene transcription, resulting in increased susceptibility to ESCC in high-risk individuals.
Pancretic ductal adenocarcinoma	10 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC22A3 in pancretic ductal adenocarcinoma			[ 4 ]
Location	5'UTR (cg27403989)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.14E+00	Statistic Test	p-value: 1.51E-05; Z-score: -1.23E+00
Methylation in Case	7.10E-01 (Median)	Methylation in Control	8.11E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC22A3 in pancretic ductal adenocarcinoma			[ 4 ]
Location	5'UTR (cg07007420)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.01E+00	Statistic Test	p-value: 2.87E-04; Z-score: -4.82E-01
Methylation in Case	8.93E-01 (Median)	Methylation in Control	9.03E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC22A3 in pancretic ductal adenocarcinoma			[ 4 ]
Location	TSS1500 (cg13875111)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.20E+00	Statistic Test	p-value: 3.67E-02; Z-score: -6.99E-01
Methylation in Case	1.48E-01 (Median)	Methylation in Control	1.78E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC22A3 in pancretic ductal adenocarcinoma			[ 4 ]
Location	TSS200 (cg04431946)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 2.39E+00	Statistic Test	p-value: 2.19E-31; Z-score: 5.00E+00
Methylation in Case	5.04E-01 (Median)	Methylation in Control	2.11E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC22A3 in pancretic ductal adenocarcinoma			[ 4 ]
Location	TSS200 (cg17920479)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.39E+00	Statistic Test	p-value: 3.81E-18; Z-score: 2.96E+00
Methylation in Case	4.49E-01 (Median)	Methylation in Control	3.22E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC22A3 in pancretic ductal adenocarcinoma			[ 4 ]
Location	TSS200 (cg18313899)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.72E+00	Statistic Test	p-value: 7.48E-17; Z-score: 3.10E+00
Methylation in Case	2.60E-01 (Median)	Methylation in Control	1.51E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC22A3 in pancretic ductal adenocarcinoma			[ 4 ]
Location	Body (cg27315497)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.25E+00	Statistic Test	p-value: 1.32E-11; Z-score: 2.34E+00
Methylation in Case	5.50E-01 (Median)	Methylation in Control	4.41E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of SLC22A3 in pancretic ductal adenocarcinoma			[ 4 ]
Location	Body (cg09359103)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.44E+00	Statistic Test	p-value: 3.74E-10; Z-score: -1.71E+00
Methylation in Case	3.31E-01 (Median)	Methylation in Control	4.76E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 9	Methylation of SLC22A3 in pancretic ductal adenocarcinoma			[ 4 ]
Location	Body (cg04860674)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.03E+00	Statistic Test	p-value: 5.68E-09; Z-score: -9.67E-01
Methylation in Case	8.47E-01 (Median)	Methylation in Control	8.74E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 10	Methylation of SLC22A3 in pancretic ductal adenocarcinoma			[ 4 ]
Location	Body (cg04036777)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.16E+00	Statistic Test	p-value: 3.60E-03; Z-score: -6.49E-01
Methylation in Case	4.40E-01 (Median)	Methylation in Control	5.12E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Bladder cancer	13 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC22A3 in bladder cancer			[ 5 ]
Location	TSS1500 (cg25313204)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.32E+00	Statistic Test	p-value: 1.83E-03; Z-score: -2.09E+00
Methylation in Case	4.05E-01 (Median)	Methylation in Control	5.35E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC22A3 in bladder cancer			[ 5 ]
Location	TSS1500 (cg22117918)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.27E+00	Statistic Test	p-value: 3.83E-02; Z-score: 1.40E+00
Methylation in Case	2.03E-01 (Median)	Methylation in Control	1.60E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC22A3 in bladder cancer			[ 5 ]
Location	Body (cg23898998)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.46E+00	Statistic Test	p-value: 2.00E-07; Z-score: -1.15E+01
Methylation in Case	4.58E-01 (Median)	Methylation in Control	6.68E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC22A3 in bladder cancer			[ 5 ]
Location	Body (cg09226986)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.69E+00	Statistic Test	p-value: 3.02E-05; Z-score: 5.16E+00
Methylation in Case	7.96E-01 (Median)	Methylation in Control	4.72E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC22A3 in bladder cancer			[ 5 ]
Location	Body (cg04794858)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.16E+00	Statistic Test	p-value: 2.64E-04; Z-score: -5.28E+00
Methylation in Case	7.45E-01 (Median)	Methylation in Control	8.67E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC22A3 in bladder cancer			[ 5 ]
Location	Body (cg13280882)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.07E+00	Statistic Test	p-value: 1.33E-03; Z-score: -1.96E+00
Methylation in Case	8.01E-01 (Median)	Methylation in Control	8.60E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC22A3 in bladder cancer			[ 5 ]
Location	Body (cg01923312)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.22E+00	Statistic Test	p-value: 1.79E-03; Z-score: -3.77E+00
Methylation in Case	6.32E-01 (Median)	Methylation in Control	7.70E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of SLC22A3 in bladder cancer			[ 5 ]
Location	Body (cg15363979)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.02E+00	Statistic Test	p-value: 5.22E-03; Z-score: -3.02E+00
Methylation in Case	8.95E-01 (Median)	Methylation in Control	9.16E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 9	Methylation of SLC22A3 in bladder cancer			[ 5 ]
Location	Body (cg24358785)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.19E+00	Statistic Test	p-value: 7.04E-03; Z-score: 3.45E+00
Methylation in Case	6.73E-01 (Median)	Methylation in Control	5.67E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 10	Methylation of SLC22A3 in bladder cancer			[ 5 ]
Location	Body (cg06295784)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.09E+00	Statistic Test	p-value: 1.23E-02; Z-score: -1.89E+00
Methylation in Case	6.17E-01 (Median)	Methylation in Control	6.75E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 11	Methylation of SLC22A3 in bladder cancer			[ 5 ]
Location	Body (cg14255768)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.03E+00	Statistic Test	p-value: 3.15E-02; Z-score: -6.38E-01
Methylation in Case	5.07E-01 (Median)	Methylation in Control	5.23E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 12	Methylation of SLC22A3 in bladder cancer			[ 5 ]
Location	Body (cg17768600)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.14E+00	Statistic Test	p-value: 4.23E-02; Z-score: 1.81E+00
Methylation in Case	7.28E-01 (Median)	Methylation in Control	6.41E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 13	Methylation of SLC22A3 in bladder cancer			[ 5 ]
Location	3'UTR (cg00321824)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.41E+00	Statistic Test	p-value: 9.40E-08; Z-score: -1.35E+01
Methylation in Case	5.70E-01 (Median)	Methylation in Control	8.03E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Breast cancer	22 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC22A3 in breast cancer			[ 6 ]
Location	TSS1500 (cg22117918)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.26E+00	Statistic Test	p-value: 6.87E-09; Z-score: 1.49E+00
Methylation in Case	2.80E-01 (Median)	Methylation in Control	2.22E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC22A3 in breast cancer			[ 6 ]
Location	TSS1500 (cg07883823)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.32E+00	Statistic Test	p-value: 8.44E-08; Z-score: 1.48E+00
Methylation in Case	3.14E-01 (Median)	Methylation in Control	2.37E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC22A3 in breast cancer			[ 6 ]
Location	TSS1500 (cg21110739)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.05E+00	Statistic Test	p-value: 2.79E-07; Z-score: -1.26E+00
Methylation in Case	7.68E-01 (Median)	Methylation in Control	8.07E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC22A3 in breast cancer			[ 6 ]
Location	TSS1500 (cg25313204)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.08E+00	Statistic Test	p-value: 2.50E-03; Z-score: -7.53E-01
Methylation in Case	5.95E-01 (Median)	Methylation in Control	6.44E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC22A3 in breast cancer			[ 6 ]
Location	TSS200 (cg17364114)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 2.41E+00	Statistic Test	p-value: 3.71E-08; Z-score: 1.16E+00
Methylation in Case	1.44E-01 (Median)	Methylation in Control	5.98E-02 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC22A3 in breast cancer			[ 6 ]
Location	1stExon (cg07237939)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 2.63E+00	Statistic Test	p-value: 2.56E-10; Z-score: 1.90E+00
Methylation in Case	1.07E-01 (Median)	Methylation in Control	4.05E-02 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC22A3 in breast cancer			[ 6 ]
Location	Body (cg23898998)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.50E+00	Statistic Test	p-value: 2.93E-24; Z-score: -5.02E+00
Methylation in Case	4.70E-01 (Median)	Methylation in Control	7.03E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of SLC22A3 in breast cancer			[ 6 ]
Location	Body (cg15020894)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.55E+00	Statistic Test	p-value: 4.72E-22; Z-score: -3.09E+00
Methylation in Case	3.70E-01 (Median)	Methylation in Control	5.74E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 9	Methylation of SLC22A3 in breast cancer			[ 6 ]
Location	Body (cg04794858)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.37E+00	Statistic Test	p-value: 5.42E-20; Z-score: -6.89E+00
Methylation in Case	6.27E-01 (Median)	Methylation in Control	8.60E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 10	Methylation of SLC22A3 in breast cancer			[ 6 ]
Location	Body (cg15363979)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.10E+00	Statistic Test	p-value: 1.53E-14; Z-score: -3.09E+00
Methylation in Case	8.14E-01 (Median)	Methylation in Control	9.00E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 11	Methylation of SLC22A3 in breast cancer			[ 6 ]
Location	Body (cg09226986)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.61E+00	Statistic Test	p-value: 3.47E-14; Z-score: 2.89E+00
Methylation in Case	5.65E-01 (Median)	Methylation in Control	3.51E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 12	Methylation of SLC22A3 in breast cancer			[ 6 ]
Location	Body (cg13280882)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.14E+00	Statistic Test	p-value: 7.63E-11; Z-score: -2.96E+00
Methylation in Case	7.44E-01 (Median)	Methylation in Control	8.44E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 13	Methylation of SLC22A3 in breast cancer			[ 6 ]
Location	Body (cg02042585)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.17E+00	Statistic Test	p-value: 1.04E-10; Z-score: -1.73E+00
Methylation in Case	6.36E-01 (Median)	Methylation in Control	7.46E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 14	Methylation of SLC22A3 in breast cancer			[ 6 ]
Location	Body (cg17768600)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.18E+00	Statistic Test	p-value: 8.44E-09; Z-score: -1.60E+00
Methylation in Case	5.70E-01 (Median)	Methylation in Control	6.70E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 15	Methylation of SLC22A3 in breast cancer			[ 6 ]
Location	Body (cg14255768)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.43E+00	Statistic Test	p-value: 2.97E-08; Z-score: -1.87E+00
Methylation in Case	3.72E-01 (Median)	Methylation in Control	5.31E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 16	Methylation of SLC22A3 in breast cancer			[ 6 ]
Location	Body (cg19149031)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.13E+00	Statistic Test	p-value: 3.69E-07; Z-score: -1.32E+00
Methylation in Case	7.54E-01 (Median)	Methylation in Control	8.50E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 17	Methylation of SLC22A3 in breast cancer			[ 6 ]
Location	Body (cg18126027)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.08E+00	Statistic Test	p-value: 2.74E-06; Z-score: -1.25E+00
Methylation in Case	8.08E-01 (Median)	Methylation in Control	8.72E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 18	Methylation of SLC22A3 in breast cancer			[ 6 ]
Location	Body (cg24358785)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.12E+00	Statistic Test	p-value: 5.55E-06; Z-score: -1.28E+00
Methylation in Case	5.57E-01 (Median)	Methylation in Control	6.23E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 19	Methylation of SLC22A3 in breast cancer			[ 6 ]
Location	Body (cg08303612)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.20E+00	Statistic Test	p-value: 1.40E-05; Z-score: 5.41E-01
Methylation in Case	1.39E-01 (Median)	Methylation in Control	1.17E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 20	Methylation of SLC22A3 in breast cancer			[ 6 ]
Location	Body (cg11696576)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.09E+00	Statistic Test	p-value: 4.87E-04; Z-score: -5.11E-01
Methylation in Case	6.61E-01 (Median)	Methylation in Control	7.23E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 21	Methylation of SLC22A3 in breast cancer			[ 6 ]
Location	Body (cg06295784)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.01E+00	Statistic Test	p-value: 1.43E-02; Z-score: 1.15E-01
Methylation in Case	6.69E-01 (Median)	Methylation in Control	6.64E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 22	Methylation of SLC22A3 in breast cancer			[ 6 ]
Location	3'UTR (cg00321824)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.36E+00	Statistic Test	p-value: 8.19E-16; Z-score: -3.48E+00
Methylation in Case	5.82E-01 (Median)	Methylation in Control	7.93E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Renal cell carcinoma	7 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC22A3 in clear cell renal cell carcinoma			[ 7 ]
Location	TSS1500 (cg21110739)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.02E+00	Statistic Test	p-value: 1.42E-04; Z-score: -1.09E+00
Methylation in Case	8.93E-01 (Median)	Methylation in Control	9.15E-01 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC22A3 in clear cell renal cell carcinoma			[ 7 ]
Location	TSS1500 (cg22117918)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.16E+00	Statistic Test	p-value: 2.44E-02; Z-score: 5.00E-01
Methylation in Case	1.61E-01 (Median)	Methylation in Control	1.39E-01 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC22A3 in clear cell renal cell carcinoma			[ 7 ]
Location	TSS200 (cg17364114)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.29E+00	Statistic Test	p-value: 3.51E-02; Z-score: 2.07E-01
Methylation in Case	2.36E-02 (Median)	Methylation in Control	1.83E-02 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC22A3 in clear cell renal cell carcinoma			[ 7 ]
Location	1stExon (cg07237939)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.16E+00	Statistic Test	p-value: 2.53E-02; Z-score: 2.01E-01
Methylation in Case	2.13E-02 (Median)	Methylation in Control	1.83E-02 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC22A3 in clear cell renal cell carcinoma			[ 7 ]
Location	Body (cg15363979)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.02E+00	Statistic Test	p-value: 1.51E-06; Z-score: -1.34E+00
Methylation in Case	9.14E-01 (Median)	Methylation in Control	9.37E-01 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC22A3 in clear cell renal cell carcinoma			[ 7 ]
Location	Body (cg13280882)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.03E+00	Statistic Test	p-value: 1.25E-02; Z-score: -6.79E-01
Methylation in Case	8.78E-01 (Median)	Methylation in Control	9.07E-01 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC22A3 in clear cell renal cell carcinoma			[ 7 ]
Location	Body (cg02042585)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.04E+00	Statistic Test	p-value: 1.81E-02; Z-score: -6.75E-01
Methylation in Case	8.61E-01 (Median)	Methylation in Control	8.93E-01 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Colorectal cancer	7 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC22A3 in colorectal cancer			[ 8 ]
Location	TSS1500 (cg21110739)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.01E+00	Statistic Test	p-value: 6.15E-04; Z-score: -9.57E-01
Methylation in Case	9.30E-01 (Median)	Methylation in Control	9.38E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC22A3 in colorectal cancer			[ 8 ]
Location	Body (cg15363979)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.01E+00	Statistic Test	p-value: 6.80E-04; Z-score: -1.16E+00
Methylation in Case	9.27E-01 (Median)	Methylation in Control	9.37E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC22A3 in colorectal cancer			[ 8 ]
Location	Body (cg23898998)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.02E+00	Statistic Test	p-value: 1.75E-02; Z-score: -4.43E-01
Methylation in Case	8.50E-01 (Median)	Methylation in Control	8.68E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC22A3 in colorectal cancer			[ 8 ]
Location	Body (cg14255768)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.02E+00	Statistic Test	p-value: 3.20E-02; Z-score: -6.66E-01
Methylation in Case	8.01E-01 (Median)	Methylation in Control	8.20E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC22A3 in colorectal cancer			[ 8 ]
Location	Body (cg11696576)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.02E+00	Statistic Test	p-value: 4.56E-02; Z-score: -3.56E-01
Methylation in Case	8.90E-01 (Median)	Methylation in Control	9.08E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC22A3 in colorectal cancer			[ 8 ]
Location	Body (cg06295784)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.13E+00	Statistic Test	p-value: 4.93E-02; Z-score: -7.32E-01
Methylation in Case	6.67E-01 (Median)	Methylation in Control	7.53E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC22A3 in colorectal cancer			[ 8 ]
Location	3'UTR (cg00321824)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.02E+00	Statistic Test	p-value: 4.46E-03; Z-score: -3.83E-01
Methylation in Case	7.98E-01 (Median)	Methylation in Control	8.14E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Hepatocellular carcinoma	18 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC22A3 in hepatocellular carcinoma			[ 9 ]
Location	TSS1500 (cg26489057)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.77E+00	Statistic Test	p-value: 1.47E-13; Z-score: 3.67E+00
Methylation in Case	5.21E-01 (Median)	Methylation in Control	2.94E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC22A3 in hepatocellular carcinoma			[ 9 ]
Location	TSS1500 (cg07883823)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.43E+00	Statistic Test	p-value: 3.54E-04; Z-score: -1.05E+00
Methylation in Case	1.21E-01 (Median)	Methylation in Control	1.72E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC22A3 in hepatocellular carcinoma			[ 9 ]
Location	TSS1500 (cg22117918)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.33E+00	Statistic Test	p-value: 2.10E-03; Z-score: -9.30E-01
Methylation in Case	1.18E-01 (Median)	Methylation in Control	1.57E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC22A3 in hepatocellular carcinoma			[ 9 ]
Location	TSS200 (cg17364114)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -2.08E+00	Statistic Test	p-value: 4.44E-04; Z-score: -5.64E-01
Methylation in Case	2.35E-02 (Median)	Methylation in Control	4.91E-02 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC22A3 in hepatocellular carcinoma			[ 9 ]
Location	1stExon (cg07237939)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.43E+00	Statistic Test	p-value: 1.91E-04; Z-score: -5.09E-01
Methylation in Case	3.13E-02 (Median)	Methylation in Control	4.48E-02 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC22A3 in hepatocellular carcinoma			[ 9 ]
Location	Body (cg00706648)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.25E+00	Statistic Test	p-value: 8.10E-25; Z-score: -7.57E+00
Methylation in Case	6.38E-01 (Median)	Methylation in Control	7.97E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC22A3 in hepatocellular carcinoma			[ 9 ]
Location	Body (cg14387909)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.69E+00	Statistic Test	p-value: 8.57E-17; Z-score: -7.87E+00
Methylation in Case	5.26E-01 (Median)	Methylation in Control	8.87E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of SLC22A3 in hepatocellular carcinoma			[ 9 ]
Location	Body (cg03912954)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 2.41E+00	Statistic Test	p-value: 5.76E-16; Z-score: 5.00E+00
Methylation in Case	2.70E-01 (Median)	Methylation in Control	1.12E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 9	Methylation of SLC22A3 in hepatocellular carcinoma			[ 9 ]
Location	Body (cg09226986)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.05E+00	Statistic Test	p-value: 1.32E-08; Z-score: 9.32E-01
Methylation in Case	8.31E-01 (Median)	Methylation in Control	7.89E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 10	Methylation of SLC22A3 in hepatocellular carcinoma			[ 9 ]
Location	Body (cg15020894)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.28E+00	Statistic Test	p-value: 3.42E-08; Z-score: -1.85E+00
Methylation in Case	3.56E-01 (Median)	Methylation in Control	4.56E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 11	Methylation of SLC22A3 in hepatocellular carcinoma			[ 9 ]
Location	Body (cg11696576)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.28E+00	Statistic Test	p-value: 3.62E-08; Z-score: -1.35E+00
Methylation in Case	4.35E-01 (Median)	Methylation in Control	5.57E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 12	Methylation of SLC22A3 in hepatocellular carcinoma			[ 9 ]
Location	Body (cg13280882)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.13E+00	Statistic Test	p-value: 3.47E-07; Z-score: -1.29E+00
Methylation in Case	7.15E-01 (Median)	Methylation in Control	8.09E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 13	Methylation of SLC22A3 in hepatocellular carcinoma			[ 9 ]
Location	Body (cg06295784)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.23E+00	Statistic Test	p-value: 1.53E-05; Z-score: -1.07E+00
Methylation in Case	4.25E-01 (Median)	Methylation in Control	5.22E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 14	Methylation of SLC22A3 in hepatocellular carcinoma			[ 9 ]
Location	Body (cg08303612)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.23E+00	Statistic Test	p-value: 2.82E-05; Z-score: -7.84E-01
Methylation in Case	6.81E-02 (Median)	Methylation in Control	8.34E-02 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 15	Methylation of SLC22A3 in hepatocellular carcinoma			[ 9 ]
Location	Body (cg02042585)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.04E+00	Statistic Test	p-value: 7.03E-05; Z-score: 6.58E-01
Methylation in Case	8.12E-01 (Median)	Methylation in Control	7.78E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 16	Methylation of SLC22A3 in hepatocellular carcinoma			[ 9 ]
Location	Body (cg07349212)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.17E+00	Statistic Test	p-value: 6.88E-04; Z-score: -7.22E-01
Methylation in Case	5.95E-02 (Median)	Methylation in Control	6.94E-02 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 17	Methylation of SLC22A3 in hepatocellular carcinoma			[ 9 ]
Location	Body (cg17768600)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.04E+00	Statistic Test	p-value: 1.02E-02; Z-score: 4.12E-01
Methylation in Case	7.32E-01 (Median)	Methylation in Control	7.05E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 18	Methylation of SLC22A3 in hepatocellular carcinoma			[ 9 ]
Location	Body (cg18126027)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.01E+00	Statistic Test	p-value: 4.86E-02; Z-score: -1.42E-01
Methylation in Case	8.64E-01 (Median)	Methylation in Control	8.69E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
HIV infection	11 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC22A3 in HIV infection			[ 10 ]
Location	TSS1500 (cg07883823)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.59E+00	Statistic Test	p-value: 2.26E-06; Z-score: 2.66E+00
Methylation in Case	2.44E-01 (Median)	Methylation in Control	1.54E-01 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC22A3 in HIV infection			[ 10 ]
Location	TSS1500 (cg22117918)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.29E+00	Statistic Test	p-value: 1.39E-05; Z-score: 1.68E+00
Methylation in Case	2.15E-01 (Median)	Methylation in Control	1.66E-01 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC22A3 in HIV infection			[ 10 ]
Location	TSS200 (cg17364114)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 6.68E+00	Statistic Test	p-value: 1.28E-03; Z-score: 2.10E+00
Methylation in Case	1.05E-01 (Median)	Methylation in Control	1.57E-02 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC22A3 in HIV infection			[ 10 ]
Location	1stExon (cg07237939)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 2.79E+00	Statistic Test	p-value: 1.88E-04; Z-score: 2.08E+00
Methylation in Case	5.40E-02 (Median)	Methylation in Control	1.93E-02 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC22A3 in HIV infection			[ 10 ]
Location	Body (cg04794858)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.04E+00	Statistic Test	p-value: 1.40E-04; Z-score: -1.04E+00
Methylation in Case	8.88E-01 (Median)	Methylation in Control	9.20E-01 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC22A3 in HIV infection			[ 10 ]
Location	Body (cg15020894)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.13E+00	Statistic Test	p-value: 2.20E-04; Z-score: -1.03E+00
Methylation in Case	4.67E-01 (Median)	Methylation in Control	5.26E-01 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC22A3 in HIV infection			[ 10 ]
Location	Body (cg08303612)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.29E+00	Statistic Test	p-value: 5.28E-04; Z-score: 1.21E+00
Methylation in Case	1.06E-01 (Median)	Methylation in Control	8.20E-02 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of SLC22A3 in HIV infection			[ 10 ]
Location	Body (cg15363979)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.02E+00	Statistic Test	p-value: 6.38E-04; Z-score: 1.19E+00
Methylation in Case	9.41E-01 (Median)	Methylation in Control	9.21E-01 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 9	Methylation of SLC22A3 in HIV infection			[ 10 ]
Location	Body (cg23898998)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.04E+00	Statistic Test	p-value: 8.23E-04; Z-score: -8.32E-01
Methylation in Case	8.10E-01 (Median)	Methylation in Control	8.44E-01 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 10	Methylation of SLC22A3 in HIV infection			[ 10 ]
Location	Body (cg07349212)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.09E+00	Statistic Test	p-value: 1.27E-02; Z-score: 4.39E-01
Methylation in Case	7.00E-02 (Median)	Methylation in Control	6.43E-02 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 11	Methylation of SLC22A3 in HIV infection			[ 10 ]
Location	Body (cg06295784)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.02E+00	Statistic Test	p-value: 1.88E-02; Z-score: 4.69E-01
Methylation in Case	7.91E-01 (Median)	Methylation in Control	7.73E-01 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Lung adenocarcinoma	5 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC22A3 in lung adenocarcinoma			[ 11 ]
Location	TSS1500 (cg22117918)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.49E+00	Statistic Test	p-value: 6.40E-03; Z-score: 2.54E+00
Methylation in Case	3.18E-01 (Median)	Methylation in Control	2.14E-01 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC22A3 in lung adenocarcinoma			[ 11 ]
Location	TSS1500 (cg07883823)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.39E+00	Statistic Test	p-value: 7.87E-03; Z-score: 1.91E+00
Methylation in Case	3.37E-01 (Median)	Methylation in Control	2.42E-01 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC22A3 in lung adenocarcinoma			[ 11 ]
Location	TSS200 (cg17364114)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 3.83E+00	Statistic Test	p-value: 4.07E-04; Z-score: 7.16E+00
Methylation in Case	3.25E-01 (Median)	Methylation in Control	8.50E-02 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC22A3 in lung adenocarcinoma			[ 11 ]
Location	1stExon (cg07237939)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 3.07E+00	Statistic Test	p-value: 1.25E-03; Z-score: 6.50E+00
Methylation in Case	2.05E-01 (Median)	Methylation in Control	6.68E-02 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC22A3 in lung adenocarcinoma			[ 11 ]
Location	Body (cg08303612)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.37E+00	Statistic Test	p-value: 1.66E-02; Z-score: 2.49E+00
Methylation in Case	1.68E-01 (Median)	Methylation in Control	1.23E-01 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Papillary thyroid cancer	8 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC22A3 in papillary thyroid cancer			[ 12 ]
Location	TSS1500 (cg21110739)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.02E+00	Statistic Test	p-value: 2.00E-05; Z-score: -1.25E+00
Methylation in Case	8.76E-01 (Median)	Methylation in Control	8.96E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC22A3 in papillary thyroid cancer			[ 12 ]
Location	TSS1500 (cg22117918)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.09E+00	Statistic Test	p-value: 3.61E-04; Z-score: 5.18E-01
Methylation in Case	1.90E-01 (Median)	Methylation in Control	1.74E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC22A3 in papillary thyroid cancer			[ 12 ]
Location	TSS1500 (cg07883823)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.10E+00	Statistic Test	p-value: 2.36E-03; Z-score: 5.50E-01
Methylation in Case	2.21E-01 (Median)	Methylation in Control	2.00E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC22A3 in papillary thyroid cancer			[ 12 ]
Location	Body (cg04794858)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.02E+00	Statistic Test	p-value: 2.01E-04; Z-score: -7.11E-01
Methylation in Case	8.89E-01 (Median)	Methylation in Control	9.04E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC22A3 in papillary thyroid cancer			[ 12 ]
Location	Body (cg13280882)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.01E+00	Statistic Test	p-value: 6.45E-04; Z-score: -8.51E-01
Methylation in Case	9.40E-01 (Median)	Methylation in Control	9.51E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC22A3 in papillary thyroid cancer			[ 12 ]
Location	Body (cg15363979)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.01E+00	Statistic Test	p-value: 2.75E-03; Z-score: -4.56E-01
Methylation in Case	8.89E-01 (Median)	Methylation in Control	8.95E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC22A3 in papillary thyroid cancer			[ 12 ]
Location	Body (cg06295784)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.01E+00	Statistic Test	p-value: 1.39E-02; Z-score: -3.89E-01
Methylation in Case	8.43E-01 (Median)	Methylation in Control	8.54E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of SLC22A3 in papillary thyroid cancer			[ 12 ]
Location	Body (cg18126027)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.02E+00	Statistic Test	p-value: 2.68E-02; Z-score: -8.29E-01
Methylation in Case	8.96E-01 (Median)	Methylation in Control	9.15E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Colon cancer	6 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC22A3 in colon adenocarcinoma			[ 14 ]
Location	TSS200 (cg13028471)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.20E+00	Statistic Test	p-value: 3.50E-03; Z-score: -3.04E-01
Methylation in Case	6.58E-02 (Median)	Methylation in Control	7.87E-02 (Median)
Studied Phenotype	Colon cancer [ ICD-11: 2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC22A3 in colon adenocarcinoma			[ 14 ]
Location	Body (cg04186249)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.31E+00	Statistic Test	p-value: 1.73E-06; Z-score: -4.75E+00
Methylation in Case	5.55E-01 (Median)	Methylation in Control	7.26E-01 (Median)
Studied Phenotype	Colon cancer [ ICD-11: 2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC22A3 in colon adenocarcinoma			[ 14 ]
Location	Body (cg05275995)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.07E+00	Statistic Test	p-value: 1.97E-03; Z-score: -1.88E+00
Methylation in Case	7.43E-01 (Median)	Methylation in Control	7.98E-01 (Median)
Studied Phenotype	Colon cancer [ ICD-11: 2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC22A3 in colon adenocarcinoma			[ 14 ]
Location	Body (cg16523422)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.14E+00	Statistic Test	p-value: 2.60E-03; Z-score: -2.01E+00
Methylation in Case	6.40E-01 (Median)	Methylation in Control	7.29E-01 (Median)
Studied Phenotype	Colon cancer [ ICD-11: 2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC22A3 in colon adenocarcinoma			[ 14 ]
Location	Body (cg13071812)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.12E+00	Statistic Test	p-value: 3.57E-03; Z-score: -6.98E-01
Methylation in Case	1.49E-01 (Median)	Methylation in Control	1.67E-01 (Median)
Studied Phenotype	Colon cancer [ ICD-11: 2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC22A3 in colon adenocarcinoma			[ 14 ]
Location	3'UTR (cg20678043)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.29E+00	Statistic Test	p-value: 4.17E-05; Z-score: -3.56E+00
Methylation in Case	5.67E-01 (Median)	Methylation in Control	7.30E-01 (Median)
Studied Phenotype	Colon cancer [ ICD-11: 2B90]
Experimental Material	Patient tissue samples
Atypical teratoid rhabdoid tumor	12 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC22A3 in atypical teratoid rhabdoid tumor			[ 15 ]
Location	1stExon (cg07237939)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.42E+00	Statistic Test	p-value: 2.39E-21; Z-score: -3.90E+00
Methylation in Case	5.59E-01 (Median)	Methylation in Control	7.93E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC22A3 in atypical teratoid rhabdoid tumor			[ 15 ]
Location	Body (cg01923312)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.19E+00	Statistic Test	p-value: 1.03E-04; Z-score: -8.99E-01
Methylation in Case	6.58E-01 (Median)	Methylation in Control	7.86E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC22A3 in atypical teratoid rhabdoid tumor			[ 15 ]
Location	Body (cg02042585)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.07E+00	Statistic Test	p-value: 1.11E-04; Z-score: -9.25E-01
Methylation in Case	7.57E-01 (Median)	Methylation in Control	8.11E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC22A3 in atypical teratoid rhabdoid tumor			[ 15 ]
Location	Body (cg04794858)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.08E+00	Statistic Test	p-value: 9.54E-04; Z-score: 7.88E-01
Methylation in Case	8.89E-01 (Median)	Methylation in Control	8.20E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC22A3 in atypical teratoid rhabdoid tumor			[ 15 ]
Location	Body (cg06295784)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.02E+00	Statistic Test	p-value: 2.27E-03; Z-score: 6.78E-01
Methylation in Case	9.31E-01 (Median)	Methylation in Control	9.09E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC22A3 in atypical teratoid rhabdoid tumor			[ 15 ]
Location	Body (cg07349212)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.07E+00	Statistic Test	p-value: 3.84E-03; Z-score: -6.99E-01
Methylation in Case	7.37E-01 (Median)	Methylation in Control	7.90E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC22A3 in atypical teratoid rhabdoid tumor			[ 15 ]
Location	Body (cg08303612)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.17E+00	Statistic Test	p-value: 5.74E-03; Z-score: 4.06E-01
Methylation in Case	1.43E-01 (Median)	Methylation in Control	1.22E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of SLC22A3 in atypical teratoid rhabdoid tumor			[ 15 ]
Location	Body (cg09226986)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.01E+00	Statistic Test	p-value: 9.57E-03; Z-score: -4.48E-01
Methylation in Case	9.19E-01 (Median)	Methylation in Control	9.27E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 9	Methylation of SLC22A3 in atypical teratoid rhabdoid tumor			[ 15 ]
Location	Body (cg11696576)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.05E+00	Statistic Test	p-value: 2.46E-02; Z-score: -4.55E-01
Methylation in Case	7.03E-01 (Median)	Methylation in Control	7.40E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 10	Methylation of SLC22A3 in atypical teratoid rhabdoid tumor			[ 15 ]
Location	Body (cg13280882)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.00E+00	Statistic Test	p-value: 3.38E-02; Z-score: -1.20E-01
Methylation in Case	9.68E-01 (Median)	Methylation in Control	9.72E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 11	Methylation of SLC22A3 in atypical teratoid rhabdoid tumor			[ 15 ]
Location	Body (cg14255768)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.07E+00	Statistic Test	p-value: 4.39E-02; Z-score: 5.86E-01
Methylation in Case	8.00E-01 (Median)	Methylation in Control	7.47E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 12	Methylation of SLC22A3 in atypical teratoid rhabdoid tumor			[ 15 ]
Location	3'UTR (cg00321824)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.28E+00	Statistic Test	p-value: 9.49E-16; Z-score: -2.45E+00
Methylation in Case	5.95E-01 (Median)	Methylation in Control	7.62E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Panic disorder	2 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC22A3 in panic disorder			[ 16 ]
Location	Body (cg18126027)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.18E+00	Statistic Test	p-value: 6.78E-03; Z-score: 7.21E-01
Methylation in Case	1.71E+00 (Median)	Methylation in Control	1.45E+00 (Median)
Studied Phenotype	Panic disorder [ ICD-11: 6B01]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC22A3 in panic disorder			[ 16 ]
Location	Body (cg01923312)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -5.04E-01	Statistic Test	p-value: 2.49E-02; Z-score: -3.16E-01
Methylation in Case	-2.68E-01 (Median)	Methylation in Control	-1.35E-01 (Median)
Studied Phenotype	Panic disorder [ ICD-11: 6B01]
Experimental Material	Patient tissue samples
Systemic lupus erythematosus	5 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC22A3 in systemic lupus erythematosus			[ 17 ]
Location	Body (cg14255768)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.01E+00	Statistic Test	p-value: 6.48E-04; Z-score: -1.39E-01
Methylation in Case	5.99E-01 (Median)	Methylation in Control	6.07E-01 (Median)
Studied Phenotype	Systemic lupus erythematosus [ ICD-11: 4A40.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC22A3 in systemic lupus erythematosus			[ 17 ]
Location	Body (cg15363979)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.00E+00	Statistic Test	p-value: 2.56E-02; Z-score: -1.17E-01
Methylation in Case	9.10E-01 (Median)	Methylation in Control	9.12E-01 (Median)
Studied Phenotype	Systemic lupus erythematosus [ ICD-11: 4A40.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC22A3 in systemic lupus erythematosus			[ 17 ]
Location	Body (cg04794858)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.01E+00	Statistic Test	p-value: 2.59E-02; Z-score: -2.29E-01
Methylation in Case	8.66E-01 (Median)	Methylation in Control	8.75E-01 (Median)
Studied Phenotype	Systemic lupus erythematosus [ ICD-11: 4A40.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC22A3 in systemic lupus erythematosus			[ 17 ]
Location	Body (cg23898998)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.01E+00	Statistic Test	p-value: 3.27E-02; Z-score: -1.47E-01
Methylation in Case	7.86E-01 (Median)	Methylation in Control	7.95E-01 (Median)
Studied Phenotype	Systemic lupus erythematosus [ ICD-11: 4A40.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC22A3 in systemic lupus erythematosus			[ 17 ]
Location	Body (cg19149031)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.00E+00	Statistic Test	p-value: 4.01E-02; Z-score: 6.60E-02
Methylation in Case	8.69E-01 (Median)	Methylation in Control	8.65E-01 (Median)
Studied Phenotype	Systemic lupus erythematosus [ ICD-11: 4A40.0]
Experimental Material	Patient tissue samples
microRNA
Coronary artery disease	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	miR-147a downregulates SLC22A3 expression in coronary artery disease			[ 18 ]
Epigenetic Type	microRNA	Experiment Method	Luciferase reporter assay
Related Molecular Changes	Down regulation of SLC22A3	Experiment Method	RT-qPCR
miRNA Stemloop ID	miR-147a	miRNA Mature ID	Unclear
miRNA Target Type	Direct
Studied Phenotype	Coronary artery disease [ ICD-11: BA6Z]
Experimental Material	Multiple cell lines of human
Additional Notes	The rs3088442 G allele might suppress miR-147a binding to the 3'-UTR region of SLC22A3, resulting in altered SLC22A3 and LPA gene expression.
Unclear Phenotype	24 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	miR-124 directly targets SLC22A3			[ 19 ]
Epigenetic Type	microRNA	Experiment Method	Microarray
miRNA Stemloop ID	miR-124	miRNA Mature ID	miR-124-3p
miRNA Sequence	UAAGGCACGCGGUGAAUGCCAA
miRNA Target Type	Direct
Experimental Material	Human cervical cancer cell line (Hela)
Epigenetic Phenomenon 2	miR-1272 directly targets SLC22A3			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-1272	miRNA Mature ID	miR-1272
miRNA Sequence	GAUGAUGAUGGCAGCAAAUUCUGAAA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 3	miR-130b directly targets SLC22A3			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-130b	miRNA Mature ID	miR-130b-5p
miRNA Sequence	ACUCUUUCCCUGUUGCACUAC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 4	miR-1322 directly targets SLC22A3			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-1322	miRNA Mature ID	miR-1322
miRNA Sequence	GAUGAUGCUGCUGAUGCUG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 5	miR-147a directly targets SLC22A3			[ 18 ]
Epigenetic Type	microRNA	Experiment Method	Luciferase reporter assay
miRNA Stemloop ID	miR-147a	miRNA Mature ID	miR-147a
miRNA Sequence	GUGUGUGGAAAUGCUUCUGC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 6	miR-148b directly targets SLC22A3			[ 21 ]
Epigenetic Type	microRNA	Experiment Method	Microarray
miRNA Stemloop ID	miR-148b	miRNA Mature ID	miR-148b-3p
miRNA Sequence	UCAGUGCAUCACAGAACUUUGU
miRNA Target Type	Direct
Experimental Material	Human cervical cancer cell line (Hela)
Epigenetic Phenomenon 7	miR-23a directly targets SLC22A3			[ 22 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-23a	miRNA Mature ID	miR-23a-5p
miRNA Sequence	GGGGUUCCUGGGGAUGGGAUUU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 8	miR-23b directly targets SLC22A3			[ 22 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-23b	miRNA Mature ID	miR-23b-5p
miRNA Sequence	UGGGUUCCUGGCAUGCUGAUUU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 9	miR-3940 directly targets SLC22A3			[ 22 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-3940	miRNA Mature ID	miR-3940-5p
miRNA Sequence	GUGGGUUGGGGCGGGCUCUG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 10	miR-4291 directly targets SLC22A3			[ 22 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4291	miRNA Mature ID	miR-4291
miRNA Sequence	UUCAGCAGGAACAGCU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 11	miR-4330 directly targets SLC22A3			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4330	miRNA Mature ID	miR-4330
miRNA Sequence	CCUCAGAUCAGAGCCUUGC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 12	miR-4494 directly targets SLC22A3			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4494	miRNA Mature ID	miR-4494
miRNA Sequence	CCAGACUGUGGCUGACCAGAGG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 13	miR-4507 directly targets SLC22A3			[ 22 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4507	miRNA Mature ID	miR-4507
miRNA Sequence	CUGGGUUGGGCUGGGCUGGG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 14	miR-452 directly targets SLC22A3			[ 22 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-452	miRNA Mature ID	miR-452-3p
miRNA Sequence	CUCAUCUGCAAAGAAGUAAGUG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 15	miR-4639 directly targets SLC22A3			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4639	miRNA Mature ID	miR-4639-3p
miRNA Sequence	UCACUCUCACCUUGCUUUGC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 16	miR-4753 directly targets SLC22A3			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4753	miRNA Mature ID	miR-4753-3p
miRNA Sequence	UUCUCUUUCUUUAGCCUUGUGU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 17	miR-499b directly targets SLC22A3			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-499b	miRNA Mature ID	miR-499b-5p
miRNA Sequence	ACAGACUUGCUGUGAUGUUCA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 18	miR-515 directly targets SLC22A3			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-515	miRNA Mature ID	miR-515-5p
miRNA Sequence	UUCUCCAAAAGAAAGCACUUUCUG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 19	miR-519d directly targets SLC22A3			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-519d	miRNA Mature ID	miR-519d-5p
miRNA Sequence	CCUCCAAAGGGAAGCGCUUUCUGUU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 20	miR-519e directly targets SLC22A3			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-519e	miRNA Mature ID	miR-519e-5p
miRNA Sequence	UUCUCCAAAAGGGAGCACUUUC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 21	miR-545 directly targets SLC22A3			[ 22 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-545	miRNA Mature ID	miR-545-3p
miRNA Sequence	UCAGCAAACAUUUAUUGUGUGC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 22	miR-5695 directly targets SLC22A3			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-5695	miRNA Mature ID	miR-5695
miRNA Sequence	ACUCCAAGAAGAAUCUAGACAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 23	miR-6839 directly targets SLC22A3			[ 22 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6839	miRNA Mature ID	miR-6839-3p
miRNA Sequence	UUGGGUUUUCUCUUCAAUCCAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 24	miR-9 directly targets SLC22A3			[ 21 ]
Epigenetic Type	microRNA	Experiment Method	Microarray
miRNA Stemloop ID	miR-9	miRNA Mature ID	miR-9-5p
miRNA Sequence	UCUUUGGUUAUCUAGCUGUAUGA
miRNA Target Type	Direct
Experimental Material	Human cervical cancer cell line (Hela)

References
1	Genetic and epigenetic regulation of the organic cation transporter 3, SLC22A3. Pharmacogenomics J. 2013 Apr;13(2):110-20.
2	Diabetes medication associates with DNA methylation of metformin transporter genes in the human liver. Clin Epigenetics. 2017 Sep 21;9:102.
3	Epigenetic alterations of a novel antioxidant gene SLC22A3 predispose susceptible individuals to increased risk of esophageal cancer. Int J Biol Sci. 2018 Sep 7;14(12):1658-1668.
4	Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
5	DNA Methylation Dynamics in Urological Tumors.
6	Genome-wide Scan for Methylation Profiles in Breast Cancer
7	A CpG-methylation-based assay to predict survival in clear cell renal cell carcinoma. Nat Commun. 2015 Oct 30;6:8699.
8	Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
9	Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
10	HIV-1 Infection Accelerates Age According to the Epigenetic Clock. J Infect Dis. 2015 Nov 15;212(10):1563-73.
11	DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
12	Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
13	Reducing the risk of false discovery enabling identification of biologically significant genome-wide methylation status using the HumanMethylation450 array. BMC Genomics. 2014 Jan 22;15:51.
14	Genome-scale analysis of DNA methylation in colorectal cancer using Infinium HumanMethylation450 BeadChips. Epigenetics. 2013 Sep;8(9):921-34.
15	Atypical Teratoid/Rhabdoid Tumors Are Comprised of Three Epigenetic Subgroups with Distinct Enhancer Landscapes. Cancer Cell. 2016 Mar 14;29(3):379-393.
16	DNA Methylation signatures in panic disorder. Transl Psychiatry. 2017 Dec 18;7(12):1287.
17	Genome-wide DNA methylation analysis of systemic lupus erythematosus reveals persistent hypomethylation of interferon genes and compositional changes to CD4+ T-cell populations. PLoS Genet. 2013;9(8):e1003678.
18	Functional Variant in the SLC22A3-LPAL2-LPA Gene Cluster Contributes to the Severity of Coronary Artery Disease. Arterioscler Thromb Vasc Biol. 2016 Sep;36(9):1989-96.
19	The impact of microRNAs on protein output. Nature. 2008 Sep 4;455(7209):64-71.
20	Argonaute HITS-CLIP decodes microRNA-mRNA interaction maps. Nature. 2009 Jul 23;460(7254):479-86.
21	MicroRNA targeting specificity in mammals: determinants beyond seed pairing. Mol Cell. 2007 Jul 6;27(1):91-105.
22	Remodeling of Ago2-mRNA interactions upon cellular stress reflects miRNA complementarity and correlates with altered translation rates. Genes Dev. 2013 Jul 15;27(14):1624-32.

If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.

Detail Information of Epigenetic Regulations

Visitor Map

Correspondence