Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID DTD0012 Transporter Info
Gene Name ABCC3
Transporter Name Multidrug resistance-associated protein 3
Gene ID
8714
UniProt ID
O15438
Epigenetic Regulations of This DT (EGR)

Methylation

  Ischemic stroke

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Hypermethylation of ABCC3 in ischemic stroke [ 1 ]

Location

 Promoter

Epigenetic Type

 Methylation Experiment Method Bisulfite pyrosequencing

Related Molecular Changes

 Down regulation of ABCC3 Experiment Method RT-qPCR

Studied Phenotype

 Ischemic stroke [ ICD-11: 8B11]

Experimental Material

 Chinese patient tissue samples

Additional Notes

 The ABCC3 promoter methylation status in 87 clinical samples from patients correlated inversely with the expression of ABCC3 (R = - 0.854, P < 0.001).

  Atypical teratoid rhabdoid tumor

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of ABCC3 in atypical teratoid rhabdoid tumor [ 2 ]

Location

 Body (cg04433051)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.13E+00 Statistic Test p-value: 7.58E-04; Z-score: -5.83E-01

Methylation in Case

 4.95E-01 (Median) Methylation in Control 5.57E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of ABCC3 in atypical teratoid rhabdoid tumor [ 2 ]

Location

 3'UTR (cg14592673)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.42E+00 Statistic Test p-value: 4.54E-11; Z-score: -1.64E+00

Methylation in Case

 4.37E-01 (Median) Methylation in Control 6.20E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Bladder cancer

            3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of ABCC3 in bladder cancer [ 3 ]

Location

 Body (cg04433051)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 2.46E+00 Statistic Test p-value: 1.95E-08; Z-score: 8.30E+00

Methylation in Case

 4.96E-01 (Median) Methylation in Control 2.01E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of ABCC3 in bladder cancer [ 3 ]

Location

 Body (cg18312989)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.08E+00 Statistic Test p-value: 3.05E-02; Z-score: 2.04E+00

Methylation in Case

 5.35E-01 (Median) Methylation in Control 4.94E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of ABCC3 in bladder cancer [ 3 ]

Location

 3'UTR (cg14592673)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -3.13E+00 Statistic Test p-value: 7.89E-13; Z-score: -1.21E+01

Methylation in Case

 2.17E-01 (Median) Methylation in Control 6.82E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Colorectal cancer

            3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of ABCC3 in colorectal cancer [ 4 ]

Location

 Body (cg18426477)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.26E+00 Statistic Test p-value: 3.14E-08; Z-score: -2.14E+00

Methylation in Case

 5.59E-01 (Median) Methylation in Control 7.06E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of ABCC3 in colorectal cancer [ 4 ]

Location

 Body (cg18312989)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.06E+00 Statistic Test p-value: 3.06E-03; Z-score: -6.74E-01

Methylation in Case

 7.07E-01 (Median) Methylation in Control 7.48E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Hepatocellular carcinoma

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of ABCC3 in hepatocellular carcinoma [ 5 ]

Location

 Body (cg04433051)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.31E+00 Statistic Test p-value: 5.88E-05; Z-score: 1.73E+00

Methylation in Case

 5.09E-01 (Median) Methylation in Control 3.88E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of ABCC3 in hepatocellular carcinoma [ 5 ]

Location

 Body (cg18312989)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.09E+00 Statistic Test p-value: 4.43E-03; Z-score: -9.28E-01

Methylation in Case

 5.35E-01 (Median) Methylation in Control 5.84E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  HIV infection

            5 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of ABCC3 in HIV infection [ 6 ]

Location

 Body (cg18312989)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.12E+00 Statistic Test p-value: 5.64E-05; Z-score: -1.94E+00

Methylation in Case

 6.65E-01 (Median) Methylation in Control 7.42E-01 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of ABCC3 in HIV infection [ 6 ]

Location

 Body (cg18426477)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.04E+00 Statistic Test p-value: 8.88E-04; Z-score: -1.01E+00

Methylation in Case

 8.21E-01 (Median) Methylation in Control 8.53E-01 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of ABCC3 in HIV infection [ 6 ]

Location

 Body (cg19734752)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.01E+00 Statistic Test p-value: 1.36E-02; Z-score: 4.88E-01

Methylation in Case

 8.82E-01 (Median) Methylation in Control 8.73E-01 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of ABCC3 in HIV infection [ 6 ]

Location

 Body (cg04433051)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.09E+00 Statistic Test p-value: 2.00E-02; Z-score: 7.45E-01

Methylation in Case

 1.81E-01 (Median) Methylation in Control 1.66E-01 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of ABCC3 in HIV infection [ 6 ]

Location

 3'UTR (cg14592673)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.02E+00 Statistic Test p-value: 4.00E-02; Z-score: -4.87E-01

Methylation in Case

 8.01E-01 (Median) Methylation in Control 8.18E-01 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Panic disorder

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of ABCC3 in panic disorder [ 7 ]

Location

 Body (cg18312989)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.16E+00 Statistic Test p-value: 4.66E-03; Z-score: 5.04E-01

Methylation in Case

 1.42E+00 (Median) Methylation in Control 1.22E+00 (Median)

Studied Phenotype

 Panic disorder [ ICD-11: 6B01]

Experimental Material

 Patient tissue samples

  Papillary thyroid cancer

            3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of ABCC3 in papillary thyroid cancer [ 8 ]

Location

 Body (cg19734752)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.19E+00 Statistic Test p-value: 6.96E-13; Z-score: -3.05E+00

Methylation in Case

 6.72E-01 (Median) Methylation in Control 7.99E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of ABCC3 in papillary thyroid cancer [ 8 ]

Location

 Body (cg04433051)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.24E+00 Statistic Test p-value: 9.38E-10; Z-score: 2.19E+00

Methylation in Case

 5.71E-01 (Median) Methylation in Control 4.59E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of ABCC3 in papillary thyroid cancer [ 8 ]

Location

 3'UTR (cg14592673)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.09E+00 Statistic Test p-value: 6.76E-10; Z-score: -1.71E+00

Methylation in Case

 7.18E-01 (Median) Methylation in Control 7.79E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Prostate cancer

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of ABCC3 in prostate cancer [ 9 ]

Location

 Body (cg13117272)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.43E+00 Statistic Test p-value: 1.10E-02; Z-score: -2.30E+00

Methylation in Case

 4.12E-01 (Median) Methylation in Control 5.90E-01 (Median)

Studied Phenotype

 Prostate cancer [ ICD-11: 2C82]

Experimental Material

 Patient tissue samples

  Breast cancer

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of ABCC3 in breast cancer [ 10 ]

Location

 3'UTR (cg14592673)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.36E+00 Statistic Test p-value: 1.02E-13; Z-score: -2.58E+00

Methylation in Case

 4.63E-01 (Median) Methylation in Control 6.31E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Pituitary adenoma

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Moderate hypermethylation of ABCC3 in pituitary adenoma than that in healthy individual

Studied Phenotype

 Pituitary adenoma [ICD-11:2F37]

The Methylation Level of Disease Section Compare with the Healthy Individual

 p-value: 2.10E-08; Fold-change: 0.231740155; Z-score: 4.004544973
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue
Download DT methylation data in the tissue of healthy individual

  Anaplastic pilocytic astrocytoma

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Significant hypomethylation of ABCC3 in anaplastic pilocytic astrocytoma than that in healthy individual

Studied Phenotype

 Anaplastic pilocytic astrocytoma [ICD-11:2A00.0Y]

The Methylation Level of Disease Section Compare with the Healthy Individual

 p-value: 7.34E-07; Fold-change: -0.385017536; Z-score: -1.321676045
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue
Download DT methylation data in the tissue of healthy individual

microRNA

  Glioma

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 miR-9* regulates ABCC3 expression [ 11 ]

Epigenetic Type

 microRNA Experiment Method Luciferase reporter assay

Related Molecular Changes

 Down regulation of ABCC3 Experiment Method RT-qPCR

miRNA Stemloop ID

 miR-9* miRNA Mature ID Unclear

miRNA Target Type

 Indirect(ID4; miR-9*; SOX2; ABCC3)

Studied Phenotype

 Glioma [ ICD-11: 2A00.0]

Experimental Material

 Multiple cell lines of human

Additional Notes

 ID4-miR-9*-SOX2-ABCC3/ABCC6 regulatory pathway is recapitulated in glioma stem cells derived from patients with glioma.

  Unclear Phenotype

            5 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 miR-124 directly targets ABCC3 [ 12 ]

Epigenetic Type

 microRNA Experiment Method Microarray

miRNA Stemloop ID

 miR-124 miRNA Mature ID miR-124-3p

miRNA Sequence

 UAAGGCACGCGGUGAAUGCCAA

miRNA Target Type

 Direct

Experimental Material

 Human cervical cancer cell line (Hela)

  Epigenetic Phenomenon 2

 miR-192 directly targets ABCC3 [ 13 ]

Epigenetic Type

 microRNA Experiment Method Microarray

miRNA Stemloop ID

 miR-192 miRNA Mature ID miR-192-5p

miRNA Sequence

 CUGACCUAUGAAUUGACAGCC

miRNA Target Type

 Direct

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 miR-197 directly targets ABCC3 [ 13 ]

Epigenetic Type

 microRNA Experiment Method Microarray

miRNA Stemloop ID

 miR-197 miRNA Mature ID miR-197-3p

miRNA Sequence

 UUCACCACCUUCUCCACCCAGC

miRNA Target Type

 Direct

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 miR-335 directly targets ABCC3 [ 14 ]

Epigenetic Type

 microRNA Experiment Method Microarray

miRNA Stemloop ID

 miR-335 miRNA Mature ID miR-335-5p

miRNA Sequence

 UCAAGAGCAAUAACGAAAAAUGU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 5

 miR-665 directly targets ABCB7 [ 15 ]

Epigenetic Type

 microRNA Experiment Method miRNA Microarray Analysis

miRNA Stemloop ID

 miR-665 miRNA Mature ID miR-665

miRNA Sequence

 ACCAGGAGGCUGAGGCCCCU

miRNA Target Type

 Direct

Experimental Material

 RAW 264.7 cells
References
1 The association of ABCC3 promoter methylation with clopidogrel response in Chinese ischemic stroke patients. Pharmazie. 2014 Oct;69(10):764-8.
2 Atypical Teratoid/Rhabdoid Tumors Are Comprised of Three Epigenetic Subgroups with Distinct Enhancer Landscapes. Cancer Cell. 2016 Mar 14;29(3):379-393.
3 DNA Methylation Dynamics in Urological Tumors.
4 Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
5 Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
6 HIV-1 Infection Accelerates Age According to the Epigenetic Clock. J Infect Dis. 2015 Nov 15;212(10):1563-73.
7 DNA Methylation signatures in panic disorder. Transl Psychiatry. 2017 Dec 18;7(12):1287.
8 Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
9 Reducing the risk of false discovery enabling identification of biologically significant genome-wide methylation status using the HumanMethylation450 array. BMC Genomics. 2014 Jan 22;15:51.
10 Genome-wide Scan for Methylation Profiles in Breast Cancer
11 ID4 imparts chemoresistance and cancer stemness to glioma cells by derepressing miR-9*-mediated suppression of SOX2. Cancer Res. 2011 May 1;71(9):3410-21.
12 The impact of microRNAs on protein output. Nature. 2008 Sep 4;455(7209):64-71.
13 A limited set of human MicroRNA is deregulated in follicular thyroid carcinoma. J Clin Endocrinol Metab. 2006 Sep;91(9):3584-91.
14 Endogenous human microRNAs that suppress breast cancer metastasis. Nature. 2008 Jan 10;451(7175):147-52.
15 Microbiota modulate host gene expression via microRNAs. PLoS One. 2011 Apr 29;6(4):e19293.

If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.