Detail Information of Epigenetic Regulations
General Information of Drug Transporter (DT) | |||||
---|---|---|---|---|---|
DT ID | DTD0017 Transporter Info | ||||
Gene Name | ABCC6 | ||||
Transporter Name | Multidrug resistance-associated protein 6 | ||||
Gene ID | |||||
UniProt ID | |||||
Epigenetic Regulations of This DT (EGR) | |||||
---|---|---|---|---|---|
Methylation |
|||||
Pancretic ductal adenocarcinoma |
2 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon 1 |
Methylation of ABCC6 in pancretic ductal adenocarcinoma | [ 1 ] | |||
Location |
TSS1500 (cg03233656) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: -1.37E+00 | Statistic Test | p-value: 1.00E-02; Z-score: -1.09E+00 | ||
Methylation in Case |
2.84E-01 (Median) | Methylation in Control | 3.88E-01 (Median) | ||
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon 2 |
Methylation of ABCC6 in pancretic ductal adenocarcinoma | [ 1 ] | |||
Location |
Body (cg19040266) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: -1.61E+00 | Statistic Test | p-value: 1.41E-13; Z-score: -2.53E+00 | ||
Methylation in Case |
3.77E-01 (Median) | Methylation in Control | 6.06E-01 (Median) | ||
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
Experimental Material |
Patient tissue samples | ||||
Atypical teratoid rhabdoid tumor |
3 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon 1 |
Methylation of ABCC6 in atypical teratoid rhabdoid tumor | [ 2 ] | |||
Location |
Body (cg01136471) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: -1.15E+00 | Statistic Test | p-value: 4.77E-05; Z-score: -1.23E+00 | ||
Methylation in Case |
7.43E-01 (Median) | Methylation in Control | 8.57E-01 (Median) | ||
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon 2 |
Methylation of ABCC6 in atypical teratoid rhabdoid tumor | [ 2 ] | |||
Location |
Body (cg07965331) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: -1.12E+00 | Statistic Test | p-value: 5.09E-03; Z-score: -6.38E-01 | ||
Methylation in Case |
7.29E-01 (Median) | Methylation in Control | 8.16E-01 (Median) | ||
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon 3 |
Methylation of ABCC6 in atypical teratoid rhabdoid tumor | [ 2 ] | |||
Location |
3'UTR (cg10024478) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: 1.37E+00 | Statistic Test | p-value: 1.51E-12; Z-score: 2.00E+00 | ||
Methylation in Case |
7.77E-01 (Median) | Methylation in Control | 5.67E-01 (Median) | ||
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
Experimental Material |
Patient tissue samples | ||||
Bladder cancer |
4 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon 1 |
Methylation of ABCC6 in bladder cancer | [ 3 ] | |||
Location |
Body (cg01136471) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: -1.52E+00 | Statistic Test | p-value: 3.74E-11; Z-score: -2.02E+01 | ||
Methylation in Case |
5.33E-01 (Median) | Methylation in Control | 8.12E-01 (Median) | ||
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon 2 |
Methylation of ABCC6 in bladder cancer | [ 3 ] | |||
Location |
Body (cg07965331) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: -1.59E+00 | Statistic Test | p-value: 3.79E-09; Z-score: -1.17E+01 | ||
Methylation in Case |
4.02E-01 (Median) | Methylation in Control | 6.41E-01 (Median) | ||
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon 3 |
Methylation of ABCC6 in bladder cancer | [ 3 ] | |||
Location |
3'UTR (cg10024478) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: -1.53E+00 | Statistic Test | p-value: 6.66E-06; Z-score: -5.52E+00 | ||
Methylation in Case |
2.80E-01 (Median) | Methylation in Control | 4.28E-01 (Median) | ||
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon 4 |
Hypermethylation of ABCC6 in bladder cancer | [ 9 ] | |||
Location |
Promoter | ||||
Epigenetic Type |
Methylation | Experiment Method | Methylation-specific PCR | ||
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
Frequency |
48 (36%) out of the 132 studied tumor sample | ||||
Experimental Material |
Patient tissue samples | ||||
Additional Notes |
ABCC6 is freqyently hypermethylated in bladder cancer (p<0.05). | ||||
Breast cancer |
2 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon 1 |
Methylation of ABCC6 in breast cancer | [ 4 ] | |||
Location |
Body (cg07965331) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: -1.10E+00 | Statistic Test | p-value: 1.10E-06; Z-score: -1.18E+00 | ||
Methylation in Case |
5.33E-01 (Median) | Methylation in Control | 5.84E-01 (Median) | ||
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon 2 |
Methylation of ABCC6 in breast cancer | [ 4 ] | |||
Location |
3'UTR (cg10024478) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: -1.04E+00 | Statistic Test | p-value: 2.65E-02; Z-score: -3.65E-01 | ||
Methylation in Case |
4.60E-01 (Median) | Methylation in Control | 4.77E-01 (Median) | ||
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
Experimental Material |
Patient tissue samples | ||||
Colorectal cancer |
3 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon 1 |
Methylation of ABCC6 in colorectal cancer | [ 5 ] | |||
Location |
Body (cg01136471) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: -1.02E+00 | Statistic Test | p-value: 5.46E-05; Z-score: -1.22E+00 | ||
Methylation in Case |
8.94E-01 (Median) | Methylation in Control | 9.10E-01 (Median) | ||
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon 2 |
Methylation of ABCC6 in colorectal cancer | [ 5 ] | |||
Location |
Body (cg07965331) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 1.12E-02; Z-score: -3.38E-01 | ||
Methylation in Case |
8.34E-01 (Median) | Methylation in Control | 8.45E-01 (Median) | ||
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
Experimental Material |
Patient tissue samples | ||||
Hepatocellular carcinoma |
3 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon 1 |
Methylation of ABCC6 in hepatocellular carcinoma | [ 6 ] | |||
Location |
Body (cg07965331) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: 1.06E+00 | Statistic Test | p-value: 1.50E-05; Z-score: 7.81E-01 | ||
Methylation in Case |
6.77E-01 (Median) | Methylation in Control | 6.36E-01 (Median) | ||
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon 2 |
Methylation of ABCC6 in hepatocellular carcinoma | [ 6 ] | |||
Location |
Body (cg01136471) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: 1.16E+00 | Statistic Test | p-value: 7.02E-05; Z-score: 1.30E+00 | ||
Methylation in Case |
7.44E-01 (Median) | Methylation in Control | 6.40E-01 (Median) | ||
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon 3 |
Methylation of ABCC6 in hepatocellular carcinoma | [ 6 ] | |||
Location |
3'UTR (cg10024478) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: -1.09E+00 | Statistic Test | p-value: 4.31E-02; Z-score: -5.39E-01 | ||
Methylation in Case |
3.87E-01 (Median) | Methylation in Control | 4.24E-01 (Median) | ||
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
Experimental Material |
Patient tissue samples | ||||
HIV infection |
2 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon 1 |
Methylation of ABCC6 in HIV infection | [ 7 ] | |||
Location |
Body (cg01136471) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: 1.03E+00 | Statistic Test | p-value: 2.69E-07; Z-score: 9.02E-01 | ||
Methylation in Case |
8.54E-01 (Median) | Methylation in Control | 8.31E-01 (Median) | ||
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon 2 |
Methylation of ABCC6 in HIV infection | [ 7 ] | |||
Location |
Body (cg07965331) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: -1.07E+00 | Statistic Test | p-value: 8.86E-05; Z-score: -1.50E+00 | ||
Methylation in Case |
7.57E-01 (Median) | Methylation in Control | 8.09E-01 (Median) | ||
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
Experimental Material |
Patient tissue samples | ||||
Papillary thyroid cancer |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon 1 |
Methylation of ABCC6 in papillary thyroid cancer | [ 8 ] | |||
Location |
3'UTR (cg10024478) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: 1.09E+00 | Statistic Test | p-value: 4.22E-02; Z-score: 7.49E-01 | ||
Methylation in Case |
6.34E-01 (Median) | Methylation in Control | 5.79E-01 (Median) | ||
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
Experimental Material |
Patient tissue samples | ||||
Renal pelvic tumors |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon 1 |
Hypermethylation of ABCC6 in renal pelvic tumors | [ 10 ] | |||
Location |
Promoter | ||||
Epigenetic Type |
Methylation | Experiment Method | Methylation-specific PCR | ||
Studied Phenotype |
Renal pelvic tumors [ ICD-11: 2C91.Z] | ||||
Experimental Material |
Patient tissue samples | ||||
Additional Notes |
Methylation was present significantly more frequently in renal pelvic tumors, particularly with a higher rate of methylated ABCC6 (p <?0.05). | ||||
Lymphoma |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon 1 |
Moderate hypomethylation of ABCC6 in lymphoma than that in healthy individual | ||||
Studied Phenotype |
Lymphoma [ICD-11:2B30] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value: 7.71E-06; Fold-change: -0.218160073; Z-score: -1.475285522 | ||||
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
![]() |
![]() |
||||
Multilayered rosettes embryonal tumour |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon 1 |
Moderate hypomethylation of ABCC6 in multilayered rosettes embryonal tumour than that in healthy individual | ||||
Studied Phenotype |
Multilayered rosettes embryonal tumour [ICD-11:2A00.1] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value: 2.50E-08; Fold-change: -0.200845615; Z-score: -1.912904636 | ||||
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
![]() |
![]() |
||||
Prostate cancer metastasis |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon 1 |
Significant hypomethylation of ABCC6 in prostate cancer metastasis than that in healthy individual | ||||
Studied Phenotype |
Prostate cancer metastasis [ICD-11:2.00E+06] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value: 0.006796751; Fold-change: -0.320508093; Z-score: -17.68550282 | ||||
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
![]() |
![]() |
||||
microRNA |
|||||
Unclear Phenotype |
52 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon 1 |
miR-1275 directly targets ABCC6 | [ 11 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-1275 | miRNA Mature ID | miR-1275 | ||
miRNA Sequence |
GUGGGGGAGAGGCUGUC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 2 |
miR-15a directly targets ABCC6 | [ 11 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-15a | miRNA Mature ID | miR-15a-5p | ||
miRNA Sequence |
UAGCAGCACAUAAUGGUUUGUG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 3 |
miR-15b directly targets ABCC6 | [ 11 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-15b | miRNA Mature ID | miR-15b-5p | ||
miRNA Sequence |
UAGCAGCACAUCAUGGUUUACA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 4 |
miR-16 directly targets ABCC6 | [ 11 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-16 | miRNA Mature ID | miR-16-5p | ||
miRNA Sequence |
UAGCAGCACGUAAAUAUUGGCG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 5 |
miR-195 directly targets ABCC6 | [ 11 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-195 | miRNA Mature ID | miR-195-5p | ||
miRNA Sequence |
UAGCAGCACAGAAAUAUUGGC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 6 |
miR-214 directly targets ABCC6 | [ 11 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-214 | miRNA Mature ID | miR-214-3p | ||
miRNA Sequence |
ACAGCAGGCACAGACAGGCAGU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 7 |
miR-3191 directly targets ABCC6 | [ 11 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-3191 | miRNA Mature ID | miR-3191-5p | ||
miRNA Sequence |
CUCUCUGGCCGUCUACCUUCCA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 8 |
miR-326 directly targets ABCC6 | [ 11 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-326 | miRNA Mature ID | miR-326 | ||
miRNA Sequence |
CCUCUGGGCCCUUCCUCCAG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 9 |
miR-329 directly targets ABCC6 | [ 12 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-329 | miRNA Mature ID | miR-329-3p | ||
miRNA Sequence |
AACACACCUGGUUAACCUCUUU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 10 |
miR-330 directly targets ABCC6 | [ 11 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-330 | miRNA Mature ID | miR-330-5p | ||
miRNA Sequence |
UCUCUGGGCCUGUGUCUUAGGC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 11 |
miR-3619 directly targets ABCC6 | [ 11 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-3619 | miRNA Mature ID | miR-3619-5p | ||
miRNA Sequence |
UCAGCAGGCAGGCUGGUGCAGC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 12 |
miR-362 directly targets ABCC6 | [ 12 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-362 | miRNA Mature ID | miR-362-3p | ||
miRNA Sequence |
AACACACCUAUUCAAGGAUUCA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 13 |
miR-3941 directly targets ABCC6 | [ 12 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-3941 | miRNA Mature ID | miR-3941 | ||
miRNA Sequence |
UUACACACAACUGAGGAUCAUA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 14 |
miR-424 directly targets ABCC6 | [ 11 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-424 | miRNA Mature ID | miR-424-5p | ||
miRNA Sequence |
CAGCAGCAAUUCAUGUUUUGAA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 15 |
miR-4299 directly targets ABCC6 | [ 11 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-4299 | miRNA Mature ID | miR-4299 | ||
miRNA Sequence |
GCUGGUGACAUGAGAGGC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 16 |
miR-4434 directly targets ABCC6 | [ 13 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-4434 | miRNA Mature ID | miR-4434 | ||
miRNA Sequence |
AGGAGAAGUAAAGUAGAA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon 17 |
miR-4447 directly targets ABCC6 | [ 11 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-4447 | miRNA Mature ID | miR-4447 | ||
miRNA Sequence |
GGUGGGGGCUGUUGUUU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 18 |
miR-4456 directly targets ABCC6 | [ 11 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-4456 | miRNA Mature ID | miR-4456 | ||
miRNA Sequence |
CCUGGUGGCUUCCUUUU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 19 |
miR-4472 directly targets ABCC6 | [ 11 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-4472 | miRNA Mature ID | miR-4472 | ||
miRNA Sequence |
GGUGGGGGGUGUUGUUUU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 20 |
miR-4516 directly targets ABCC6 | [ 13 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-4516 | miRNA Mature ID | miR-4516 | ||
miRNA Sequence |
GGGAGAAGGGUCGGGGC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon 21 |
miR-4525 directly targets ABCC6 | [ 11 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-4525 | miRNA Mature ID | miR-4525 | ||
miRNA Sequence |
GGGGGGAUGUGCAUGCUGGUU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 22 |
miR-4531 directly targets ABCC6 | [ 13 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-4531 | miRNA Mature ID | miR-4531 | ||
miRNA Sequence |
AUGGAGAAGGCUUCUGA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon 23 |
miR-4665 directly targets ABCC6 | [ 11 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-4665 | miRNA Mature ID | miR-4665-5p | ||
miRNA Sequence |
CUGGGGGACGCGUGAGCGCGAGC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 24 |
miR-4723 directly targets ABCC6 | [ 11 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-4723 | miRNA Mature ID | miR-4723-5p | ||
miRNA Sequence |
UGGGGGAGCCAUGAGAUAAGAGCA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 25 |
miR-4739 directly targets ABCC6 | [ 11 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-4739 | miRNA Mature ID | miR-4739 | ||
miRNA Sequence |
AAGGGAGGAGGAGCGGAGGGGCCCU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 26 |
miR-4773 directly targets ABCC6 | [ 14 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-4773 | miRNA Mature ID | miR-4773 | ||
miRNA Sequence |
CAGAACAGGAGCAUAGAAAGGC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 27 |
miR-497 directly targets ABCC6 | [ 11 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-497 | miRNA Mature ID | miR-497-5p | ||
miRNA Sequence |
CAGCAGCACACUGUGGUUUGU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 28 |
miR-5010 directly targets ABCC6 | [ 11 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-5010 | miRNA Mature ID | miR-5010-5p | ||
miRNA Sequence |
AGGGGGAUGGCAGAGCAAAAUU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 29 |
miR-518c directly targets ABCC6 | [ 11 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-518c | miRNA Mature ID | miR-518c-5p | ||
miRNA Sequence |
UCUCUGGAGGGAAGCACUUUCUG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 30 |
miR-541 directly targets ABCC6 | [ 11 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-541 | miRNA Mature ID | miR-541-3p | ||
miRNA Sequence |
UGGUGGGCACAGAAUCUGGACU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 31 |
miR-548q directly targets ABCC6 | [ 11 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-548q | miRNA Mature ID | miR-548q | ||
miRNA Sequence |
GCUGGUGCAAAAGUAAUGGCGG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 32 |
miR-5698 directly targets ABCC6 | [ 11 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-5698 | miRNA Mature ID | miR-5698 | ||
miRNA Sequence |
UGGGGGAGUGCAGUGAUUGUGG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 33 |
miR-5703 directly targets ABCC6 | [ 13 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-5703 | miRNA Mature ID | miR-5703 | ||
miRNA Sequence |
AGGAGAAGUCGGGAAGGU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon 34 |
miR-603 directly targets ABCC6 | [ 12 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-603 | miRNA Mature ID | miR-603 | ||
miRNA Sequence |
CACACACUGCAAUUACUUUUGC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 35 |
miR-6081 directly targets ABCC6 | [ 11 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-6081 | miRNA Mature ID | miR-6081 | ||
miRNA Sequence |
AGGAGCAGUGCCGGCCAAGGCGCC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 36 |
miR-6165 directly targets ABCC6 | [ 11 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-6165 | miRNA Mature ID | miR-6165 | ||
miRNA Sequence |
CAGCAGGAGGUGAGGGGAG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 37 |
miR-625 directly targets ABCC6 | [ 11 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-625 | miRNA Mature ID | miR-625-5p | ||
miRNA Sequence |
AGGGGGAAAGUUCUAUAGUCC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 38 |
miR-654 directly targets ABCC6 | [ 11 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-654 | miRNA Mature ID | miR-654-5p | ||
miRNA Sequence |
UGGUGGGCCGCAGAACAUGUGC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 39 |
miR-6764 directly targets ABCC6 | [ 11 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-6764 | miRNA Mature ID | miR-6764-3p | ||
miRNA Sequence |
UCUCUGGUCUUUCCUUGACAG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 40 |
miR-6769a directly targets ABCC6 | [ 11 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-6769a | miRNA Mature ID | miR-6769a-5p | ||
miRNA Sequence |
AGGUGGGUAUGGAGGAGCCCU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 41 |
miR-6769b directly targets ABCC6 | [ 11 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-6769b | miRNA Mature ID | miR-6769b-5p | ||
miRNA Sequence |
UGGUGGGUGGGGAGGAGAAGUGC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 42 |
miR-6824 directly targets ABCC6 | [ 11 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-6824 | miRNA Mature ID | miR-6824-3p | ||
miRNA Sequence |
UCUCUGGUCUUGCCACCCCAG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 43 |
miR-6825 directly targets ABCC6 | [ 11 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-6825 | miRNA Mature ID | miR-6825-5p | ||
miRNA Sequence |
UGGGGAGGUGUGGAGUCAGCAU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 44 |
miR-6838 directly targets ABCC6 | [ 11 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-6838 | miRNA Mature ID | miR-6838-5p | ||
miRNA Sequence |
AAGCAGCAGUGGCAAGACUCCU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 45 |
miR-6870 directly targets ABCC6 | [ 11 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-6870 | miRNA Mature ID | miR-6870-5p | ||
miRNA Sequence |
UGGGGGAGAUGGGGGUUGA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 46 |
miR-7106 directly targets ABCC6 | [ 11 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-7106 | miRNA Mature ID | miR-7106-5p | ||
miRNA Sequence |
UGGGAGGAGGGGAUCUUGGG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 47 |
miR-7111 directly targets ABCC6 | [ 11 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-7111 | miRNA Mature ID | miR-7111-5p | ||
miRNA Sequence |
UGGGGGAGGAAGGACAGGCCAU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 48 |
miR-761 directly targets ABCC6 | [ 11 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-761 | miRNA Mature ID | miR-761 | ||
miRNA Sequence |
GCAGCAGGGUGAAACUGACACA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 49 |
miR-765 directly targets ABCC6 | [ 11 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-765 | miRNA Mature ID | miR-765 | ||
miRNA Sequence |
UGGAGGAGAAGGAAGGUGAUG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 50 |
miR-7978 directly targets ABCC6 | [ 11 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-7978 | miRNA Mature ID | miR-7978 | ||
miRNA Sequence |
UCUGGUGUAUAGCGUUGCUCA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 51 |
miR-8485 directly targets ABCC6 | [ 13 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-8485 | miRNA Mature ID | miR-8485 | ||
miRNA Sequence |
CACACACACACACACACGUAU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon 52 |
miR-92a-2 directly targets ABCC6 | [ 11 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-92a-2 | miRNA Mature ID | miR-92a-2-5p | ||
miRNA Sequence |
GGGUGGGGAUUUGUUGCAUUAC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.