Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID DTD0017 Transporter Info
Gene Name ABCC6
Transporter Name Multidrug resistance-associated protein 6
Gene ID
368
UniProt ID
O95255
Epigenetic Regulations of This DT (EGR)

Methylation

  Pancretic ductal adenocarcinoma

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of ABCC6 in pancretic ductal adenocarcinoma [ 1 ]

Location

 TSS1500 (cg03233656)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.37E+00 Statistic Test p-value: 1.00E-02; Z-score: -1.09E+00

Methylation in Case

 2.84E-01 (Median) Methylation in Control 3.88E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of ABCC6 in pancretic ductal adenocarcinoma [ 1 ]

Location

 Body (cg19040266)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.61E+00 Statistic Test p-value: 1.41E-13; Z-score: -2.53E+00

Methylation in Case

 3.77E-01 (Median) Methylation in Control 6.06E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Atypical teratoid rhabdoid tumor

            3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of ABCC6 in atypical teratoid rhabdoid tumor [ 2 ]

Location

 Body (cg01136471)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.15E+00 Statistic Test p-value: 4.77E-05; Z-score: -1.23E+00

Methylation in Case

 7.43E-01 (Median) Methylation in Control 8.57E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of ABCC6 in atypical teratoid rhabdoid tumor [ 2 ]

Location

 Body (cg07965331)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.12E+00 Statistic Test p-value: 5.09E-03; Z-score: -6.38E-01

Methylation in Case

 7.29E-01 (Median) Methylation in Control 8.16E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of ABCC6 in atypical teratoid rhabdoid tumor [ 2 ]

Location

 3'UTR (cg10024478)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.37E+00 Statistic Test p-value: 1.51E-12; Z-score: 2.00E+00

Methylation in Case

 7.77E-01 (Median) Methylation in Control 5.67E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Bladder cancer

            4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of ABCC6 in bladder cancer [ 3 ]

Location

 Body (cg01136471)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.52E+00 Statistic Test p-value: 3.74E-11; Z-score: -2.02E+01

Methylation in Case

 5.33E-01 (Median) Methylation in Control 8.12E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of ABCC6 in bladder cancer [ 3 ]

Location

 Body (cg07965331)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.59E+00 Statistic Test p-value: 3.79E-09; Z-score: -1.17E+01

Methylation in Case

 4.02E-01 (Median) Methylation in Control 6.41E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of ABCC6 in bladder cancer [ 3 ]

Location

 3'UTR (cg10024478)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.53E+00 Statistic Test p-value: 6.66E-06; Z-score: -5.52E+00

Methylation in Case

 2.80E-01 (Median) Methylation in Control 4.28E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Hypermethylation of ABCC6 in bladder cancer [ 9 ]

Location

 Promoter

Epigenetic Type

 Methylation Experiment Method Methylation-specific PCR

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Frequency

 48 (36%) out of the 132 studied tumor sample

Experimental Material

 Patient tissue samples

Additional Notes

 ABCC6 is freqyently hypermethylated in bladder cancer (p<0.05).

  Breast cancer

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of ABCC6 in breast cancer [ 4 ]

Location

 Body (cg07965331)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.10E+00 Statistic Test p-value: 1.10E-06; Z-score: -1.18E+00

Methylation in Case

 5.33E-01 (Median) Methylation in Control 5.84E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of ABCC6 in breast cancer [ 4 ]

Location

 3'UTR (cg10024478)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.04E+00 Statistic Test p-value: 2.65E-02; Z-score: -3.65E-01

Methylation in Case

 4.60E-01 (Median) Methylation in Control 4.77E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Colorectal cancer

            3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of ABCC6 in colorectal cancer [ 5 ]

Location

 Body (cg01136471)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.02E+00 Statistic Test p-value: 5.46E-05; Z-score: -1.22E+00

Methylation in Case

 8.94E-01 (Median) Methylation in Control 9.10E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of ABCC6 in colorectal cancer [ 5 ]

Location

 Body (cg07965331)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.01E+00 Statistic Test p-value: 1.12E-02; Z-score: -3.38E-01

Methylation in Case

 8.34E-01 (Median) Methylation in Control 8.45E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Hepatocellular carcinoma

            3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of ABCC6 in hepatocellular carcinoma [ 6 ]

Location

 Body (cg07965331)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.06E+00 Statistic Test p-value: 1.50E-05; Z-score: 7.81E-01

Methylation in Case

 6.77E-01 (Median) Methylation in Control 6.36E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of ABCC6 in hepatocellular carcinoma [ 6 ]

Location

 Body (cg01136471)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.16E+00 Statistic Test p-value: 7.02E-05; Z-score: 1.30E+00

Methylation in Case

 7.44E-01 (Median) Methylation in Control 6.40E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of ABCC6 in hepatocellular carcinoma [ 6 ]

Location

 3'UTR (cg10024478)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.09E+00 Statistic Test p-value: 4.31E-02; Z-score: -5.39E-01

Methylation in Case

 3.87E-01 (Median) Methylation in Control 4.24E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  HIV infection

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of ABCC6 in HIV infection [ 7 ]

Location

 Body (cg01136471)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.03E+00 Statistic Test p-value: 2.69E-07; Z-score: 9.02E-01

Methylation in Case

 8.54E-01 (Median) Methylation in Control 8.31E-01 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of ABCC6 in HIV infection [ 7 ]

Location

 Body (cg07965331)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.07E+00 Statistic Test p-value: 8.86E-05; Z-score: -1.50E+00

Methylation in Case

 7.57E-01 (Median) Methylation in Control 8.09E-01 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Papillary thyroid cancer

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of ABCC6 in papillary thyroid cancer [ 8 ]

Location

 3'UTR (cg10024478)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.09E+00 Statistic Test p-value: 4.22E-02; Z-score: 7.49E-01

Methylation in Case

 6.34E-01 (Median) Methylation in Control 5.79E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Renal pelvic tumors

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Hypermethylation of ABCC6 in renal pelvic tumors [ 10 ]

Location

 Promoter

Epigenetic Type

 Methylation Experiment Method Methylation-specific PCR

Studied Phenotype

 Renal pelvic tumors [ ICD-11: 2C91.Z]

Experimental Material

 Patient tissue samples

Additional Notes

 Methylation was present significantly more frequently in renal pelvic tumors, particularly with a higher rate of methylated ABCC6 (p <?0.05).

  Lymphoma

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Moderate hypomethylation of ABCC6 in lymphoma than that in healthy individual

Studied Phenotype

 Lymphoma [ICD-11:2B30]

The Methylation Level of Disease Section Compare with the Healthy Individual

 p-value: 7.71E-06; Fold-change: -0.218160073; Z-score: -1.475285522
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue
Download DT methylation data in the tissue of healthy individual

  Multilayered rosettes embryonal tumour

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Moderate hypomethylation of ABCC6 in multilayered rosettes embryonal tumour than that in healthy individual

Studied Phenotype

 Multilayered rosettes embryonal tumour [ICD-11:2A00.1]

The Methylation Level of Disease Section Compare with the Healthy Individual

 p-value: 2.50E-08; Fold-change: -0.200845615; Z-score: -1.912904636
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue
Download DT methylation data in the tissue of healthy individual

  Prostate cancer metastasis

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Significant hypomethylation of ABCC6 in prostate cancer metastasis than that in healthy individual

Studied Phenotype

 Prostate cancer metastasis [ICD-11:2.00E+06]

The Methylation Level of Disease Section Compare with the Healthy Individual

 p-value: 0.006796751; Fold-change: -0.320508093; Z-score: -17.68550282
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue
Download DT methylation data in the tissue of healthy individual

microRNA

  Unclear Phenotype

          52 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 miR-1275 directly targets ABCC6 [ 11 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-1275 miRNA Mature ID miR-1275

miRNA Sequence

 GUGGGGGAGAGGCUGUC

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 2

 miR-15a directly targets ABCC6 [ 11 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-15a miRNA Mature ID miR-15a-5p

miRNA Sequence

 UAGCAGCACAUAAUGGUUUGUG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 3

 miR-15b directly targets ABCC6 [ 11 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-15b miRNA Mature ID miR-15b-5p

miRNA Sequence

 UAGCAGCACAUCAUGGUUUACA

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 4

 miR-16 directly targets ABCC6 [ 11 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-16 miRNA Mature ID miR-16-5p

miRNA Sequence

 UAGCAGCACGUAAAUAUUGGCG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 5

 miR-195 directly targets ABCC6 [ 11 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-195 miRNA Mature ID miR-195-5p

miRNA Sequence

 UAGCAGCACAGAAAUAUUGGC

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 6

 miR-214 directly targets ABCC6 [ 11 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-214 miRNA Mature ID miR-214-3p

miRNA Sequence

 ACAGCAGGCACAGACAGGCAGU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 7

 miR-3191 directly targets ABCC6 [ 11 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-3191 miRNA Mature ID miR-3191-5p

miRNA Sequence

 CUCUCUGGCCGUCUACCUUCCA

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 8

 miR-326 directly targets ABCC6 [ 11 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-326 miRNA Mature ID miR-326

miRNA Sequence

 CCUCUGGGCCCUUCCUCCAG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 9

 miR-329 directly targets ABCC6 [ 12 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-329 miRNA Mature ID miR-329-3p

miRNA Sequence

 AACACACCUGGUUAACCUCUUU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 10

 miR-330 directly targets ABCC6 [ 11 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-330 miRNA Mature ID miR-330-5p

miRNA Sequence

 UCUCUGGGCCUGUGUCUUAGGC

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 11

 miR-3619 directly targets ABCC6 [ 11 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-3619 miRNA Mature ID miR-3619-5p

miRNA Sequence

 UCAGCAGGCAGGCUGGUGCAGC

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 12

 miR-362 directly targets ABCC6 [ 12 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-362 miRNA Mature ID miR-362-3p

miRNA Sequence

 AACACACCUAUUCAAGGAUUCA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 13

 miR-3941 directly targets ABCC6 [ 12 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-3941 miRNA Mature ID miR-3941

miRNA Sequence

 UUACACACAACUGAGGAUCAUA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 14

 miR-424 directly targets ABCC6 [ 11 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-424 miRNA Mature ID miR-424-5p

miRNA Sequence

 CAGCAGCAAUUCAUGUUUUGAA

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 15

 miR-4299 directly targets ABCC6 [ 11 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4299 miRNA Mature ID miR-4299

miRNA Sequence

 GCUGGUGACAUGAGAGGC

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 16

 miR-4434 directly targets ABCC6 [ 13 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4434 miRNA Mature ID miR-4434

miRNA Sequence

 AGGAGAAGUAAAGUAGAA

miRNA Target Type

 Direct

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 17

 miR-4447 directly targets ABCC6 [ 11 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4447 miRNA Mature ID miR-4447

miRNA Sequence

 GGUGGGGGCUGUUGUUU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 18

 miR-4456 directly targets ABCC6 [ 11 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4456 miRNA Mature ID miR-4456

miRNA Sequence

 CCUGGUGGCUUCCUUUU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 19

 miR-4472 directly targets ABCC6 [ 11 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4472 miRNA Mature ID miR-4472

miRNA Sequence

 GGUGGGGGGUGUUGUUUU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 20

 miR-4516 directly targets ABCC6 [ 13 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4516 miRNA Mature ID miR-4516

miRNA Sequence

 GGGAGAAGGGUCGGGGC

miRNA Target Type

 Direct

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 21

 miR-4525 directly targets ABCC6 [ 11 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4525 miRNA Mature ID miR-4525

miRNA Sequence

 GGGGGGAUGUGCAUGCUGGUU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 22

 miR-4531 directly targets ABCC6 [ 13 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4531 miRNA Mature ID miR-4531

miRNA Sequence

 AUGGAGAAGGCUUCUGA

miRNA Target Type

 Direct

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 23

 miR-4665 directly targets ABCC6 [ 11 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4665 miRNA Mature ID miR-4665-5p

miRNA Sequence

 CUGGGGGACGCGUGAGCGCGAGC

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 24

 miR-4723 directly targets ABCC6 [ 11 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4723 miRNA Mature ID miR-4723-5p

miRNA Sequence

 UGGGGGAGCCAUGAGAUAAGAGCA

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 25

 miR-4739 directly targets ABCC6 [ 11 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4739 miRNA Mature ID miR-4739

miRNA Sequence

 AAGGGAGGAGGAGCGGAGGGGCCCU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 26

 miR-4773 directly targets ABCC6 [ 14 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4773 miRNA Mature ID miR-4773

miRNA Sequence

 CAGAACAGGAGCAUAGAAAGGC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 27

 miR-497 directly targets ABCC6 [ 11 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-497 miRNA Mature ID miR-497-5p

miRNA Sequence

 CAGCAGCACACUGUGGUUUGU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 28

 miR-5010 directly targets ABCC6 [ 11 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-5010 miRNA Mature ID miR-5010-5p

miRNA Sequence

 AGGGGGAUGGCAGAGCAAAAUU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 29

 miR-518c directly targets ABCC6 [ 11 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-518c miRNA Mature ID miR-518c-5p

miRNA Sequence

 UCUCUGGAGGGAAGCACUUUCUG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 30

 miR-541 directly targets ABCC6 [ 11 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-541 miRNA Mature ID miR-541-3p

miRNA Sequence

 UGGUGGGCACAGAAUCUGGACU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 31

 miR-548q directly targets ABCC6 [ 11 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-548q miRNA Mature ID miR-548q

miRNA Sequence

 GCUGGUGCAAAAGUAAUGGCGG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 32

 miR-5698 directly targets ABCC6 [ 11 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-5698 miRNA Mature ID miR-5698

miRNA Sequence

 UGGGGGAGUGCAGUGAUUGUGG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 33

 miR-5703 directly targets ABCC6 [ 13 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-5703 miRNA Mature ID miR-5703

miRNA Sequence

 AGGAGAAGUCGGGAAGGU

miRNA Target Type

 Direct

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 34

 miR-603 directly targets ABCC6 [ 12 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-603 miRNA Mature ID miR-603

miRNA Sequence

 CACACACUGCAAUUACUUUUGC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 35

 miR-6081 directly targets ABCC6 [ 11 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6081 miRNA Mature ID miR-6081

miRNA Sequence

 AGGAGCAGUGCCGGCCAAGGCGCC

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 36

 miR-6165 directly targets ABCC6 [ 11 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6165 miRNA Mature ID miR-6165

miRNA Sequence

 CAGCAGGAGGUGAGGGGAG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 37

 miR-625 directly targets ABCC6 [ 11 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-625 miRNA Mature ID miR-625-5p

miRNA Sequence

 AGGGGGAAAGUUCUAUAGUCC

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 38

 miR-654 directly targets ABCC6 [ 11 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-654 miRNA Mature ID miR-654-5p

miRNA Sequence

 UGGUGGGCCGCAGAACAUGUGC

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 39

 miR-6764 directly targets ABCC6 [ 11 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6764 miRNA Mature ID miR-6764-3p

miRNA Sequence

 UCUCUGGUCUUUCCUUGACAG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 40

 miR-6769a directly targets ABCC6 [ 11 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6769a miRNA Mature ID miR-6769a-5p

miRNA Sequence

 AGGUGGGUAUGGAGGAGCCCU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 41

 miR-6769b directly targets ABCC6 [ 11 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6769b miRNA Mature ID miR-6769b-5p

miRNA Sequence

 UGGUGGGUGGGGAGGAGAAGUGC

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 42

 miR-6824 directly targets ABCC6 [ 11 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6824 miRNA Mature ID miR-6824-3p

miRNA Sequence

 UCUCUGGUCUUGCCACCCCAG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 43

 miR-6825 directly targets ABCC6 [ 11 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6825 miRNA Mature ID miR-6825-5p

miRNA Sequence

 UGGGGAGGUGUGGAGUCAGCAU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 44

 miR-6838 directly targets ABCC6 [ 11 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6838 miRNA Mature ID miR-6838-5p

miRNA Sequence

 AAGCAGCAGUGGCAAGACUCCU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 45

 miR-6870 directly targets ABCC6 [ 11 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6870 miRNA Mature ID miR-6870-5p

miRNA Sequence

 UGGGGGAGAUGGGGGUUGA

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 46

 miR-7106 directly targets ABCC6 [ 11 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-7106 miRNA Mature ID miR-7106-5p

miRNA Sequence

 UGGGAGGAGGGGAUCUUGGG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 47

 miR-7111 directly targets ABCC6 [ 11 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-7111 miRNA Mature ID miR-7111-5p

miRNA Sequence

 UGGGGGAGGAAGGACAGGCCAU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 48

 miR-761 directly targets ABCC6 [ 11 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-761 miRNA Mature ID miR-761

miRNA Sequence

 GCAGCAGGGUGAAACUGACACA

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 49

 miR-765 directly targets ABCC6 [ 11 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-765 miRNA Mature ID miR-765

miRNA Sequence

 UGGAGGAGAAGGAAGGUGAUG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 50

 miR-7978 directly targets ABCC6 [ 11 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-7978 miRNA Mature ID miR-7978

miRNA Sequence

 UCUGGUGUAUAGCGUUGCUCA

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 51

 miR-8485 directly targets ABCC6 [ 13 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-8485 miRNA Mature ID miR-8485

miRNA Sequence

 CACACACACACACACACGUAU

miRNA Target Type

 Direct

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 52

 miR-92a-2 directly targets ABCC6 [ 11 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-92a-2 miRNA Mature ID miR-92a-2-5p

miRNA Sequence

 GGGUGGGGAUUUGUUGCAUUAC

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)
References
1 Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
2 Atypical Teratoid/Rhabdoid Tumors Are Comprised of Three Epigenetic Subgroups with Distinct Enhancer Landscapes. Cancer Cell. 2016 Mar 14;29(3):379-393.
3 DNA Methylation Dynamics in Urological Tumors.
4 Genome-wide Scan for Methylation Profiles in Breast Cancer
5 Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
6 Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
7 HIV-1 Infection Accelerates Age According to the Epigenetic Clock. J Infect Dis. 2015 Nov 15;212(10):1563-73.
8 Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
9 A novel set of DNA methylation markers in urine sediments for sensitive/specific detection of bladder cancer. Clin Cancer Res. 2007 Dec 15;13(24):7296-304.
10 Comparison of clinicopathologic characteristics, epigenetic biomarkers and prognosis between renal pelvic and ureteral tumors in upper tract urothelial carcinoma. BMC Urol. 2018 Mar 27;18(1):22.
11 Transcriptome-wide identification of RNA-binding protein and microRNA target sites by PAR-CLIP. Cell. 2010 Apr 2;141(1):129-41.
12 Direct conversion of fibroblasts to neurons by reprogramming PTB-regulated microRNA circuits. Cell. 2013 Jan 17;152(1-2):82-96.
13 Argonaute CLIP Defines a Deregulated miR-122-Bound Transcriptome that Correlates with Patient Survival in Human Liver Cancer. Mol Cell. 2017 Aug 3;67(3):400-410.e7.
14 Remodeling of Ago2-mRNA interactions upon cellular stress reflects miRNA complementarity and correlates with altered translation rates. Genes Dev. 2013 Jul 15;27(14):1624-32.

If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.