Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID	DTD0024 Transporter Info
Gene Name	SLC22A6
Transporter Name	Organic anion transporter 1
Gene ID	9356
UniProt ID	Q4U2R8

Epigenetic Regulations of This DT (EGR)
Methylation
Human liver tissue	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Hypermethylation of SLC22A6 in liver (compare with the kidney)			[ 1 ]
Location	Promoter
Epigenetic Type	Methylation	Experiment Method	Bisulfite sequencing
Studied Phenotype	Human liver tissue
Experimental Material	Model organism in vivo (mouse)
Additional Notes	The difference in the Oat1 DNA methylation status was prevalent downstream of TSS
Obesity	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Moderate hypermethylation of SLC22A6 in obesity than that in healthy individual
Studied Phenotype	Obesity [ICD-11:5B81]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 2.07E-26; Fold-change: 0.223447431; Z-score: 2.248783573
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Pituitary adenoma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Moderate hypermethylation of SLC22A6 in pituitary adenoma than that in healthy individual
Studied Phenotype	Pituitary adenoma [ICD-11:2F37]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 1.13E-06; Fold-change: 0.230924359; Z-score: 3.71323454
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Chordoma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Moderate hypomethylation of SLC22A6 in chordoma than that in healthy individual
Studied Phenotype	Chordoma [ICD-11:5A61.0]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 0.015775976; Fold-change: -0.217429142; Z-score: -1.500117997
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Low grade glioma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Moderate hypomethylation of SLC22A6 in low grade glioma than that in healthy individual
Studied Phenotype	Low grade glioma [ICD-11:2A00.0Z]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 2.12E-10; Fold-change: -0.267869757; Z-score: -1.041582094
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Vestibular melanotic schwannoma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Moderate hypomethylation of SLC22A6 in vestibular melanotic schwannoma than that in healthy individual
Studied Phenotype	Vestibular melanotic schwannoma [ICD-11:2A02.3]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 0.00012997; Fold-change: -0.28213484; Z-score: -3.910702299
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue adjacent to the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data of patients in the normal section of the tissue adjacent to the disease section Download DT methylation data in the tissue of healthy individual
Atypical teratoid rhabdoid tumour	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Significant hypermethylation of SLC22A6 in atypical teratoid rhabdoid tumour than that in healthy individual
Studied Phenotype	Atypical teratoid rhabdoid tumour [ICD-11:2A00.1Y]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 1.28E-09; Fold-change: 0.43405891; Z-score: 1.462439442
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Craniopharyngioma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Significant hypermethylation of SLC22A6 in craniopharyngioma than that in healthy individual
Studied Phenotype	Craniopharyngioma [ICD-11:2F9A]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 3.40E-10; Fold-change: 0.559224681; Z-score: 1.905553775
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Esthesioneuroblastoma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Significant hypermethylation of SLC22A6 in esthesioneuroblastoma than that in healthy individual
Studied Phenotype	Esthesioneuroblastoma [ICD-11:2D50.1]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 3.11E-05; Fold-change: 0.317063824; Z-score: 1.110203008
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Peripheral neuroectodermal tumour	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Significant hypermethylation of SLC22A6 in peripheral neuroectodermal tumour than that in healthy individual
Studied Phenotype	Peripheral neuroectodermal tumour [ICD-11:2B52]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 1.06E-08; Fold-change: 0.565050017; Z-score: 1.996868202
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Brain neuroblastoma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Significant hypomethylation of SLC22A6 in brain neuroblastoma than that in healthy individual
Studied Phenotype	Brain neuroblastoma [ICD-11:2A00.11]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 9.53E-09; Fold-change: -0.373332146; Z-score: -1.311851131
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Diffuse midline glioma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Significant hypomethylation of SLC22A6 in diffuse midline glioma than that in healthy individual
Studied Phenotype	Diffuse midline glioma [ICD-11:2A00.0Z]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 3.17E-27; Fold-change: -0.439755509; Z-score: -1.637957977
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Malignant astrocytoma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Significant hypomethylation of SLC22A6 in malignant astrocytoma than that in healthy individual
Studied Phenotype	Malignant astrocytoma [ICD-11:2A00.12]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 2.37E-19; Fold-change: -0.38992361; Z-score: -1.516668522
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Melanoma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Significant hypomethylation of SLC22A6 in melanoma than that in healthy individual
Studied Phenotype	Melanoma [ICD-11:2C30]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 0.000268197; Fold-change: -0.357672847; Z-score: -1.640634512
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Multilayered rosettes embryonal tumour	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Significant hypomethylation of SLC22A6 in multilayered rosettes embryonal tumour than that in healthy individual
Studied Phenotype	Multilayered rosettes embryonal tumour [ICD-11:2A00.1]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 1.64E-25; Fold-change: -0.676007268; Z-score: -4.228897135
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Posterior fossa ependymoma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Significant hypomethylation of SLC22A6 in posterior fossa ependymoma than that in healthy individual
Studied Phenotype	Posterior fossa ependymoma [ICD-11:2D50.2]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 7.09E-49; Fold-change: -0.501966366; Z-score: -2.038858655
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
microRNA
Unclear Phenotype	33 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	miR-1236 directly targets SLC22A6			[ 2 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-1236	miRNA Mature ID	miR-1236-3p
miRNA Sequence	CCUCUUCCCCUUGUCUCUCCAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 2	miR-1238 directly targets SLC22A6			[ 2 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-1238	miRNA Mature ID	miR-1238-3p
miRNA Sequence	CUUCCUCGUCUGUCUGCCCC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 3	miR-1470 directly targets SLC22A6			[ 2 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-1470	miRNA Mature ID	miR-1470
miRNA Sequence	GCCCUCCGCCCGUGCACCCCG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 4	miR-147a directly targets SLC22A6			[ 2 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-147a	miRNA Mature ID	miR-147a
miRNA Sequence	GUGUGUGGAAAUGCUUCUGC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 5	miR-204 directly targets SLC22A6			[ 2 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-204	miRNA Mature ID	miR-204-5p
miRNA Sequence	UUCCCUUUGUCAUCCUAUGCCU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 6	miR-211 directly targets SLC22A6			[ 2 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-211	miRNA Mature ID	miR-211-5p
miRNA Sequence	UUCCCUUUGUCAUCCUUCGCCU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 7	miR-2909 directly targets SLC22A6			[ 2 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-2909	miRNA Mature ID	miR-2909
miRNA Sequence	GUUAGGGCCAACAUCUCUUGG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 8	miR-296 directly targets SLC22A6			[ 2 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-296	miRNA Mature ID	miR-296-3p
miRNA Sequence	GAGGGUUGGGUGGAGGCUCUCC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 9	miR-3911 directly targets SLC22A6			[ 2 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-3911	miRNA Mature ID	miR-3911
miRNA Sequence	UGUGUGGAUCCUGGAGGAGGCA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 10	miR-4287 directly targets SLC22A6			[ 2 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4287	miRNA Mature ID	miR-4287
miRNA Sequence	UCUCCCUUGAGGGCACUUU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 11	miR-4667 directly targets SLC22A6			[ 2 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4667	miRNA Mature ID	miR-4667-3p
miRNA Sequence	UCCCUCCUUCUGUCCCCACAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 12	miR-4685 directly targets SLC22A6			[ 2 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4685	miRNA Mature ID	miR-4685-3p
miRNA Sequence	UCUCCCUUCCUGCCCUGGCUAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 13	miR-4691 directly targets SLC22A6			[ 2 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4691	miRNA Mature ID	miR-4691-5p
miRNA Sequence	GUCCUCCAGGCCAUGAGCUGCGG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 14	miR-5193 directly targets SLC22A6			[ 2 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-5193	miRNA Mature ID	miR-5193
miRNA Sequence	UCCUCCUCUACCUCAUCCCAGU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 15	miR-581 directly targets SLC22A6			[ 2 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-581	miRNA Mature ID	miR-581
miRNA Sequence	UCUUGUGUUCUCUAGAUCAGU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 16	miR-642a directly targets SLC22A6			[ 2 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-642a	miRNA Mature ID	miR-642a-5p
miRNA Sequence	GUCCCUCUCCAAAUGUGUCUUG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 17	miR-644a directly targets SLC22A6			[ 2 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-644a	miRNA Mature ID	miR-644a
miRNA Sequence	AGUGUGGCUUUCUUAGAGC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 18	miR-659 directly targets SLC22A6			[ 2 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-659	miRNA Mature ID	miR-659-5p
miRNA Sequence	AGGACCUUCCCUGAACCAAGGA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 19	miR-660 directly targets SLC22A6			[ 2 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-660	miRNA Mature ID	miR-660-3p
miRNA Sequence	ACCUCCUGUGUGCAUGGAUUA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 20	miR-670 directly targets SLC22A6			[ 2 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-670	miRNA Mature ID	miR-670-3p
miRNA Sequence	UUUCCUCAUAUUCAUUCAGGA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 21	miR-6734 directly targets SLC22A6			[ 2 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6734	miRNA Mature ID	miR-6734-3p
miRNA Sequence	CCCUUCCCUCACUCUUCUCUCAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 22	miR-6748 directly targets SLC22A6			[ 2 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6748	miRNA Mature ID	miR-6748-5p
miRNA Sequence	UGUGGGUGGGAAGGACUGGAUU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 23	miR-6749 directly targets SLC22A6			[ 2 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6749	miRNA Mature ID	miR-6749-3p
miRNA Sequence	CUCCUCCCCUGCCUGGCCCAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 24	miR-6759 directly targets SLC22A6			[ 2 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6759	miRNA Mature ID	miR-6759-5p
miRNA Sequence	UUGUGGGUGGGCAGAAGUCUGU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 25	miR-6780a directly targets SLC22A6			[ 2 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6780a	miRNA Mature ID	miR-6780a-3p
miRNA Sequence	CUCCUCUGUUUUCUUUCCUAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 26	miR-6792 directly targets SLC22A6			[ 2 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6792	miRNA Mature ID	miR-6792-3p
miRNA Sequence	CUCCUCCACAGCCCCUGCUCAU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 27	miR-6793 directly targets SLC22A6			[ 2 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6793	miRNA Mature ID	miR-6793-5p
miRNA Sequence	UGUGGGUUCUGGGUUGGGGUGA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 28	miR-6818 directly targets SLC22A6			[ 2 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6818	miRNA Mature ID	miR-6818-5p
miRNA Sequence	UUGUGUGAGUACAGAGAGCAUC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 29	miR-6832 directly targets SLC22A6			[ 2 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6832	miRNA Mature ID	miR-6832-3p
miRNA Sequence	ACCCUUUUUCUCUUUCCCAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 30	miR-6881 directly targets SLC22A6			[ 2 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6881	miRNA Mature ID	miR-6881-3p
miRNA Sequence	AUCCUCUUUCGUCCUUCCCACU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 31	miR-7111 directly targets SLC22A6			[ 2 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-7111	miRNA Mature ID	miR-7111-3p
miRNA Sequence	AUCCUCUCUUCCCUCCUCCCAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 32	miR-8065 directly targets SLC22A6			[ 2 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-8065	miRNA Mature ID	miR-8065
miRNA Sequence	UGUAGGAACAGUUGAAUUUUGGCU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 33	miR-877 directly targets SLC22A6			[ 2 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-877	miRNA Mature ID	miR-877-3p
miRNA Sequence	UCCUCUUCUCCCUCCUCCCAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human

References
1	Regulation of tissue-specific expression of renal organic anion transporters by hepatocyte nuclear factor 1 / and DNA methylation. J Pharmacol Exp Ther. 2012 Mar;340(3):648-55.
2	Remodeling of Ago2-mRNA interactions upon cellular stress reflects miRNA complementarity and correlates with altered translation rates. Genes Dev. 2013 Jul 15;27(14):1624-32.

If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.

Detail Information of Epigenetic Regulations

Visitor Map

Correspondence