Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID	DTD0025 Transporter Info
Gene Name	SLC22A8
Transporter Name	Organic anion transporter 3
Gene ID	9376
UniProt ID	Q8TCC7

Epigenetic Regulations of This DT (EGR)
Methylation
Hepatocellular carcinoma	10 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Hypermethylation of SLC22A8 in hepatocellular carcinoma			[ 1 ]
Location	Promoter (-308/+6 bp)
Epigenetic Type	Methylation	Experiment Method	Bisulfite sequencing
Related Molecular Changes	Down regulation of SLC22A8	Experiment Method	RT-qPCR
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Multiple cell lines of human
Additional Notes	DNA methylation is involved in the gene suppression of SLC22A8, and transcriptional activation of SLC22A8 by HNF1 and HNF1 requires concomitant DNA demethylation of the promoter.
Epigenetic Phenomenon 2	Methylation of SLC22A8 in hepatocellular carcinoma			[ 6 ]
Location	5'UTR (cg24011351)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.07E+00	Statistic Test	p-value: 1.44E-05; Z-score: -7.16E-01
Methylation in Case	7.26E-01 (Median)	Methylation in Control	7.74E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC22A8 in hepatocellular carcinoma			[ 6 ]
Location	5'UTR (cg06917325)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.08E+00	Statistic Test	p-value: 4.45E-04; Z-score: -1.07E+00
Methylation in Case	6.62E-01 (Median)	Methylation in Control	7.14E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC22A8 in hepatocellular carcinoma			[ 6 ]
Location	TSS200 (cg10068408)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.03E+00	Statistic Test	p-value: 1.52E-02; Z-score: -3.34E-01
Methylation in Case	6.40E-01 (Median)	Methylation in Control	6.62E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC22A8 in hepatocellular carcinoma			[ 6 ]
Location	Body (cg23091302)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.89E+00	Statistic Test	p-value: 3.81E-26; Z-score: -3.34E+00
Methylation in Case	2.64E-01 (Median)	Methylation in Control	4.99E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC22A8 in hepatocellular carcinoma			[ 6 ]
Location	Body (cg16526509)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.84E+00	Statistic Test	p-value: 1.79E-24; Z-score: -6.43E+00
Methylation in Case	4.25E-01 (Median)	Methylation in Control	7.82E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC22A8 in hepatocellular carcinoma			[ 6 ]
Location	Body (cg14565752)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.51E+00	Statistic Test	p-value: 2.80E-18; Z-score: -7.88E+00
Methylation in Case	5.09E-01 (Median)	Methylation in Control	7.67E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of SLC22A8 in hepatocellular carcinoma			[ 6 ]
Location	Body (cg17945323)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.24E+00	Statistic Test	p-value: 1.11E-06; Z-score: -1.06E+00
Methylation in Case	2.95E-01 (Median)	Methylation in Control	3.66E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 9	Methylation of SLC22A8 in hepatocellular carcinoma			[ 6 ]
Location	Body (cg04743638)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.00E+00	Statistic Test	p-value: 2.50E-02; Z-score: 1.02E-01
Methylation in Case	8.39E-01 (Median)	Methylation in Control	8.38E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 10	Methylation of SLC22A8 in hepatocellular carcinoma			[ 6 ]
Location	3'UTR (cg14191493)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.14E+00	Statistic Test	p-value: 2.74E-06; Z-score: -1.92E+00
Methylation in Case	6.30E-01 (Median)	Methylation in Control	7.20E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Atypical teratoid rhabdoid tumor	4 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC22A8 in atypical teratoid rhabdoid tumor			[ 2 ]
Location	5'UTR (cg06917325)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.15E+00	Statistic Test	p-value: 7.16E-08; Z-score: 1.20E+00
Methylation in Case	9.02E-01 (Median)	Methylation in Control	7.84E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC22A8 in atypical teratoid rhabdoid tumor			[ 2 ]
Location	5'UTR (cg24011351)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.24E+00	Statistic Test	p-value: 7.87E-06; Z-score: 1.16E+00
Methylation in Case	7.94E-01 (Median)	Methylation in Control	6.41E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC22A8 in atypical teratoid rhabdoid tumor			[ 2 ]
Location	Body (cg04743638)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -3.67E+00	Statistic Test	p-value: 9.37E-04; Z-score: -4.32E-01
Methylation in Case	3.72E-02 (Median)	Methylation in Control	1.37E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC22A8 in atypical teratoid rhabdoid tumor			[ 2 ]
Location	3'UTR (cg14191493)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.71E+00	Statistic Test	p-value: 2.91E-11; Z-score: 2.12E+00
Methylation in Case	6.58E-01 (Median)	Methylation in Control	3.85E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Bladder cancer	9 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC22A8 in bladder cancer			[ 3 ]
Location	5'UTR (cg06917325)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.52E+00	Statistic Test	p-value: 1.99E-08; Z-score: -6.86E+00
Methylation in Case	5.35E-01 (Median)	Methylation in Control	8.14E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC22A8 in bladder cancer			[ 3 ]
Location	5'UTR (cg24011351)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.37E+00	Statistic Test	p-value: 3.49E-08; Z-score: -1.17E+01
Methylation in Case	6.27E-01 (Median)	Methylation in Control	8.57E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC22A8 in bladder cancer			[ 3 ]
Location	TSS200 (cg08288703)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.56E+00	Statistic Test	p-value: 9.67E-05; Z-score: -3.46E+00
Methylation in Case	2.34E-01 (Median)	Methylation in Control	3.66E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC22A8 in bladder cancer			[ 3 ]
Location	TSS200 (cg10068408)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.19E+00	Statistic Test	p-value: 4.37E-03; Z-score: -2.10E+00
Methylation in Case	4.58E-01 (Median)	Methylation in Control	5.44E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC22A8 in bladder cancer			[ 3 ]
Location	Body (cg16146033)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -2.75E+00	Statistic Test	p-value: 2.61E-13; Z-score: -1.30E+01
Methylation in Case	1.71E-01 (Median)	Methylation in Control	4.70E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC22A8 in bladder cancer			[ 3 ]
Location	Body (cg15572436)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -2.41E+00	Statistic Test	p-value: 1.14E-09; Z-score: -9.46E+00
Methylation in Case	1.90E-01 (Median)	Methylation in Control	4.57E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC22A8 in bladder cancer			[ 3 ]
Location	Body (cg17945323)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -2.12E+00	Statistic Test	p-value: 3.06E-09; Z-score: -7.37E+00
Methylation in Case	2.85E-01 (Median)	Methylation in Control	6.04E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of SLC22A8 in bladder cancer			[ 3 ]
Location	Body (cg04743638)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.05E+00	Statistic Test	p-value: 1.58E-03; Z-score: -2.23E+00
Methylation in Case	7.70E-01 (Median)	Methylation in Control	8.08E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 9	Methylation of SLC22A8 in bladder cancer			[ 3 ]
Location	3'UTR (cg14191493)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.37E+00	Statistic Test	p-value: 4.70E-06; Z-score: -1.08E+01
Methylation in Case	5.47E-01 (Median)	Methylation in Control	7.52E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Breast cancer	12 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC22A8 in breast cancer			[ 4 ]
Location	5'UTR (cg06917325)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.18E+00	Statistic Test	p-value: 2.60E-15; Z-score: -2.64E+00
Methylation in Case	6.98E-01 (Median)	Methylation in Control	8.20E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC22A8 in breast cancer			[ 4 ]
Location	5'UTR (cg24011351)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.17E+00	Statistic Test	p-value: 4.92E-07; Z-score: -1.44E+00
Methylation in Case	7.13E-01 (Median)	Methylation in Control	8.37E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC22A8 in breast cancer			[ 4 ]
Location	TSS1500 (cg22275125)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.27E+00	Statistic Test	p-value: 2.73E-11; Z-score: 1.56E+00
Methylation in Case	7.68E-01 (Median)	Methylation in Control	6.06E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC22A8 in breast cancer			[ 4 ]
Location	TSS1500 (cg11200963)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.21E+00	Statistic Test	p-value: 2.81E-08; Z-score: 8.51E-01
Methylation in Case	6.38E-01 (Median)	Methylation in Control	5.26E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC22A8 in breast cancer			[ 4 ]
Location	TSS200 (cg22907415)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.05E+00	Statistic Test	p-value: 1.07E-04; Z-score: 7.54E-01
Methylation in Case	6.66E-01 (Median)	Methylation in Control	6.35E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC22A8 in breast cancer			[ 4 ]
Location	TSS200 (cg08288703)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.20E+00	Statistic Test	p-value: 7.41E-04; Z-score: -1.09E+00
Methylation in Case	4.52E-01 (Median)	Methylation in Control	5.42E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC22A8 in breast cancer			[ 4 ]
Location	TSS200 (cg10068408)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.05E+00	Statistic Test	p-value: 1.58E-02; Z-score: 6.36E-01
Methylation in Case	7.62E-01 (Median)	Methylation in Control	7.26E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of SLC22A8 in breast cancer			[ 4 ]
Location	Body (cg16146033)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.72E+00	Statistic Test	p-value: 3.73E-25; Z-score: -3.39E+00
Methylation in Case	2.11E-01 (Median)	Methylation in Control	3.64E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 9	Methylation of SLC22A8 in breast cancer			[ 4 ]
Location	Body (cg17945323)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.50E+00	Statistic Test	p-value: 3.09E-15; Z-score: -2.35E+00
Methylation in Case	3.83E-01 (Median)	Methylation in Control	5.75E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 10	Methylation of SLC22A8 in breast cancer			[ 4 ]
Location	Body (cg15572436)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.34E+00	Statistic Test	p-value: 5.12E-10; Z-score: -2.52E+00
Methylation in Case	3.44E-01 (Median)	Methylation in Control	4.61E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 11	Methylation of SLC22A8 in breast cancer			[ 4 ]
Location	Body (cg04743638)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.03E+00	Statistic Test	p-value: 3.30E-05; Z-score: -9.87E-01
Methylation in Case	8.13E-01 (Median)	Methylation in Control	8.34E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 12	Methylation of SLC22A8 in breast cancer			[ 4 ]
Location	3'UTR (cg14191493)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.06E+00	Statistic Test	p-value: 2.98E-04; Z-score: -9.83E-01
Methylation in Case	6.53E-01 (Median)	Methylation in Control	6.90E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Colorectal cancer	13 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC22A8 in colorectal cancer			[ 5 ]
Location	5'UTR (cg06917325)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.21E+00	Statistic Test	p-value: 2.48E-14; Z-score: -5.11E+00
Methylation in Case	7.25E-01 (Median)	Methylation in Control	8.75E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC22A8 in colorectal cancer			[ 5 ]
Location	5'UTR (cg24011351)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.05E+00	Statistic Test	p-value: 6.46E-07; Z-score: -1.66E+00
Methylation in Case	8.42E-01 (Median)	Methylation in Control	8.81E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC22A8 in colorectal cancer			[ 5 ]
Location	TSS1500 (cg21062347)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.17E+00	Statistic Test	p-value: 1.28E-08; Z-score: -1.53E+00
Methylation in Case	5.65E-01 (Median)	Methylation in Control	6.62E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC22A8 in colorectal cancer			[ 5 ]
Location	TSS200 (cg22907415)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.09E+00	Statistic Test	p-value: 3.51E-10; Z-score: -2.64E+00
Methylation in Case	7.40E-01 (Median)	Methylation in Control	8.05E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC22A8 in colorectal cancer			[ 5 ]
Location	TSS200 (cg08288703)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.32E+00	Statistic Test	p-value: 7.69E-10; Z-score: -2.48E+00
Methylation in Case	4.67E-01 (Median)	Methylation in Control	6.14E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC22A8 in colorectal cancer			[ 5 ]
Location	TSS200 (cg10068408)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.10E+00	Statistic Test	p-value: 1.58E-07; Z-score: -1.78E+00
Methylation in Case	7.21E-01 (Median)	Methylation in Control	7.90E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC22A8 in colorectal cancer			[ 5 ]
Location	TSS200 (cg18305416)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.07E+00	Statistic Test	p-value: 3.17E-06; Z-score: -1.06E+00
Methylation in Case	6.76E-01 (Median)	Methylation in Control	7.22E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of SLC22A8 in colorectal cancer			[ 5 ]
Location	Body (cg15572436)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.37E+00	Statistic Test	p-value: 6.52E-10; Z-score: -2.07E+00
Methylation in Case	4.62E-01 (Median)	Methylation in Control	6.33E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 9	Methylation of SLC22A8 in colorectal cancer			[ 5 ]
Location	Body (cg17945323)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.31E+00	Statistic Test	p-value: 4.79E-06; Z-score: -1.42E+00
Methylation in Case	4.71E-01 (Median)	Methylation in Control	6.16E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 10	Methylation of SLC22A8 in colorectal cancer			[ 5 ]
Location	Body (cg04743638)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.02E+00	Statistic Test	p-value: 4.24E-05; Z-score: -2.75E+00
Methylation in Case	9.07E-01 (Median)	Methylation in Control	9.29E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 11	Methylation of SLC22A8 in colorectal cancer			[ 5 ]
Location	Body (cg16146033)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.27E+00	Statistic Test	p-value: 6.89E-05; Z-score: -9.88E-01
Methylation in Case	3.64E-01 (Median)	Methylation in Control	4.61E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 12	Methylation of SLC22A8 in colorectal cancer			[ 5 ]
Location	3'UTR (cg14191493)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.09E+00	Statistic Test	p-value: 5.59E-07; Z-score: -3.37E+00
Methylation in Case	8.29E-01 (Median)	Methylation in Control	9.01E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
HIV infection	10 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC22A8 in HIV infection			[ 7 ]
Location	5'UTR (cg06917325)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.07E+00	Statistic Test	p-value: 9.37E-06; Z-score: -1.71E+00
Methylation in Case	7.85E-01 (Median)	Methylation in Control	8.41E-01 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC22A8 in HIV infection			[ 7 ]
Location	5'UTR (cg24011351)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.06E+00	Statistic Test	p-value: 3.68E-04; Z-score: -1.45E+00
Methylation in Case	8.15E-01 (Median)	Methylation in Control	8.66E-01 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC22A8 in HIV infection			[ 7 ]
Location	TSS1500 (cg11200963)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.04E+00	Statistic Test	p-value: 2.87E-03; Z-score: 5.43E-01
Methylation in Case	7.97E-01 (Median)	Methylation in Control	7.66E-01 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC22A8 in HIV infection			[ 7 ]
Location	TSS1500 (cg22275125)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.02E+00	Statistic Test	p-value: 2.60E-02; Z-score: 3.43E-01
Methylation in Case	9.21E-01 (Median)	Methylation in Control	9.07E-01 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC22A8 in HIV infection			[ 7 ]
Location	TSS200 (cg08288703)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.21E+00	Statistic Test	p-value: 1.86E-05; Z-score: -1.97E+00
Methylation in Case	4.99E-01 (Median)	Methylation in Control	6.06E-01 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC22A8 in HIV infection			[ 7 ]
Location	TSS200 (cg22907415)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.02E+00	Statistic Test	p-value: 2.93E-03; Z-score: 4.67E-01
Methylation in Case	7.48E-01 (Median)	Methylation in Control	7.36E-01 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC22A8 in HIV infection			[ 7 ]
Location	Body (cg17945323)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.20E+00	Statistic Test	p-value: 1.26E-03; Z-score: 1.02E+00
Methylation in Case	2.58E-01 (Median)	Methylation in Control	2.16E-01 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of SLC22A8 in HIV infection			[ 7 ]
Location	Body (cg04743638)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.01E+00	Statistic Test	p-value: 1.25E-02; Z-score: 3.96E-01
Methylation in Case	9.04E-01 (Median)	Methylation in Control	8.96E-01 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 9	Methylation of SLC22A8 in HIV infection			[ 7 ]
Location	Body (cg15572436)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.05E+00	Statistic Test	p-value: 2.38E-02; Z-score: 3.03E-01
Methylation in Case	1.45E-01 (Median)	Methylation in Control	1.38E-01 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 10	Methylation of SLC22A8 in HIV infection			[ 7 ]
Location	3'UTR (cg14191493)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.05E+00	Statistic Test	p-value: 8.15E-05; Z-score: -1.07E+00
Methylation in Case	7.90E-01 (Median)	Methylation in Control	8.31E-01 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Lung adenocarcinoma	10 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC22A8 in lung adenocarcinoma			[ 8 ]
Location	5'UTR (cg06917325)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.08E+00	Statistic Test	p-value: 6.61E-04; Z-score: -2.65E+00
Methylation in Case	7.20E-01 (Median)	Methylation in Control	7.77E-01 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC22A8 in lung adenocarcinoma			[ 8 ]
Location	TSS1500 (cg11200963)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.41E+00	Statistic Test	p-value: 7.74E-05; Z-score: 3.21E+00
Methylation in Case	5.75E-01 (Median)	Methylation in Control	4.07E-01 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC22A8 in lung adenocarcinoma			[ 8 ]
Location	TSS1500 (cg22275125)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.45E+00	Statistic Test	p-value: 1.02E-04; Z-score: 2.32E+00
Methylation in Case	6.65E-01 (Median)	Methylation in Control	4.57E-01 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC22A8 in lung adenocarcinoma			[ 8 ]
Location	TSS200 (cg10068408)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.22E+00	Statistic Test	p-value: 4.64E-04; Z-score: 1.95E+00
Methylation in Case	7.78E-01 (Median)	Methylation in Control	6.37E-01 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC22A8 in lung adenocarcinoma			[ 8 ]
Location	TSS200 (cg22907415)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.19E+00	Statistic Test	p-value: 5.23E-04; Z-score: 2.02E+00
Methylation in Case	6.64E-01 (Median)	Methylation in Control	5.59E-01 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC22A8 in lung adenocarcinoma			[ 8 ]
Location	TSS200 (cg18305416)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.28E+00	Statistic Test	p-value: 1.19E-03; Z-score: 2.77E+00
Methylation in Case	6.62E-01 (Median)	Methylation in Control	5.19E-01 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC22A8 in lung adenocarcinoma			[ 8 ]
Location	Body (cg15572436)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.39E+00	Statistic Test	p-value: 6.90E-04; Z-score: -2.28E+00
Methylation in Case	4.07E-01 (Median)	Methylation in Control	5.65E-01 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of SLC22A8 in lung adenocarcinoma			[ 8 ]
Location	Body (cg17945323)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.41E+00	Statistic Test	p-value: 1.26E-03; Z-score: -2.03E+00
Methylation in Case	4.86E-01 (Median)	Methylation in Control	6.85E-01 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 9	Methylation of SLC22A8 in lung adenocarcinoma			[ 8 ]
Location	Body (cg16146033)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.40E+00	Statistic Test	p-value: 4.02E-03; Z-score: -1.74E+00
Methylation in Case	4.06E-01 (Median)	Methylation in Control	5.68E-01 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 10	Methylation of SLC22A8 in lung adenocarcinoma			[ 8 ]
Location	3'UTR (cg14191493)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.10E+00	Statistic Test	p-value: 6.10E-05; Z-score: -6.10E+00
Methylation in Case	7.44E-01 (Median)	Methylation in Control	8.17E-01 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Pancretic ductal adenocarcinoma	13 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC22A8 in pancretic ductal adenocarcinoma			[ 9 ]
Location	5'UTR (cg25713185)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.24E+00	Statistic Test	p-value: 4.13E-02; Z-score: -3.96E-01
Methylation in Case	1.25E-01 (Median)	Methylation in Control	1.54E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC22A8 in pancretic ductal adenocarcinoma			[ 9 ]
Location	TSS1500 (cg10528482)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.19E+00	Statistic Test	p-value: 6.29E-08; Z-score: 1.60E+00
Methylation in Case	6.15E-01 (Median)	Methylation in Control	5.16E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC22A8 in pancretic ductal adenocarcinoma			[ 9 ]
Location	TSS1500 (cg18936757)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.01E+00	Statistic Test	p-value: 4.15E-02; Z-score: 2.09E-01
Methylation in Case	8.47E-01 (Median)	Methylation in Control	8.39E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC22A8 in pancretic ductal adenocarcinoma			[ 9 ]
Location	TSS200 (cg04574090)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.87E+00	Statistic Test	p-value: 1.11E-15; Z-score: -2.39E+00
Methylation in Case	1.58E-01 (Median)	Methylation in Control	2.95E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC22A8 in pancretic ductal adenocarcinoma			[ 9 ]
Location	TSS200 (cg25940728)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.15E+00	Statistic Test	p-value: 6.91E-06; Z-score: -6.64E-01
Methylation in Case	1.13E-01 (Median)	Methylation in Control	1.30E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC22A8 in pancretic ductal adenocarcinoma			[ 9 ]
Location	TSS200 (cg13849007)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.15E+00	Statistic Test	p-value: 4.56E-03; Z-score: 7.06E-01
Methylation in Case	3.39E-02 (Median)	Methylation in Control	2.96E-02 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC22A8 in pancretic ductal adenocarcinoma			[ 9 ]
Location	TSS200 (cg20382057)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.07E+00	Statistic Test	p-value: 2.85E-02; Z-score: -3.08E-01
Methylation in Case	8.17E-02 (Median)	Methylation in Control	8.77E-02 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of SLC22A8 in pancretic ductal adenocarcinoma			[ 9 ]
Location	TSS200 (cg20373747)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.12E+00	Statistic Test	p-value: 2.89E-02; Z-score: 1.06E+00
Methylation in Case	8.55E-01 (Median)	Methylation in Control	7.61E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 9	Methylation of SLC22A8 in pancretic ductal adenocarcinoma			[ 9 ]
Location	1stExon (cg03060468)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.16E+00	Statistic Test	p-value: 8.79E-07; Z-score: 1.56E+00
Methylation in Case	6.44E-01 (Median)	Methylation in Control	5.54E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 10	Methylation of SLC22A8 in pancretic ductal adenocarcinoma			[ 9 ]
Location	Body (cg11947423)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.09E+00	Statistic Test	p-value: 3.89E-05; Z-score: 8.65E-01
Methylation in Case	8.99E-01 (Median)	Methylation in Control	8.22E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 11	Methylation of SLC22A8 in pancretic ductal adenocarcinoma			[ 9 ]
Location	Body (cg05911082)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.02E+00	Statistic Test	p-value: 2.97E-02; Z-score: -3.51E-01
Methylation in Case	8.14E-01 (Median)	Methylation in Control	8.28E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 12	Methylation of SLC22A8 in pancretic ductal adenocarcinoma			[ 9 ]
Location	Body (cg00977408)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.01E+00	Statistic Test	p-value: 3.78E-02; Z-score: 4.16E-01
Methylation in Case	9.17E-01 (Median)	Methylation in Control	9.08E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 13	Methylation of SLC22A8 in pancretic ductal adenocarcinoma			[ 9 ]
Location	Body (cg23501962)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.06E+00	Statistic Test	p-value: 3.85E-02; Z-score: 4.11E-01
Methylation in Case	3.08E-01 (Median)	Methylation in Control	2.90E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Panic disorder	2 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC22A8 in panic disorder			[ 10 ]
Location	5'UTR (cg06917325)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.07E+00	Statistic Test	p-value: 1.23E-02; Z-score: 3.48E-01
Methylation in Case	2.53E+00 (Median)	Methylation in Control	2.36E+00 (Median)
Studied Phenotype	Panic disorder [ ICD-11: 6B01]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC22A8 in panic disorder			[ 10 ]
Location	3'UTR (cg14191493)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.04E+00	Statistic Test	p-value: 4.47E-02; Z-score: 1.84E-01
Methylation in Case	2.33E+00 (Median)	Methylation in Control	2.24E+00 (Median)
Studied Phenotype	Panic disorder [ ICD-11: 6B01]
Experimental Material	Patient tissue samples
Papillary thyroid cancer	9 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC22A8 in papillary thyroid cancer			[ 11 ]
Location	5'UTR (cg06917325)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.05E+00	Statistic Test	p-value: 1.48E-04; Z-score: -1.03E+00
Methylation in Case	8.02E-01 (Median)	Methylation in Control	8.41E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC22A8 in papillary thyroid cancer			[ 11 ]
Location	TSS1500 (cg22275125)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.10E+00	Statistic Test	p-value: 1.11E-05; Z-score: 1.30E+00
Methylation in Case	6.65E-01 (Median)	Methylation in Control	6.02E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC22A8 in papillary thyroid cancer			[ 11 ]
Location	TSS1500 (cg11200963)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.06E+00	Statistic Test	p-value: 2.01E-05; Z-score: 7.61E-01
Methylation in Case	5.74E-01 (Median)	Methylation in Control	5.44E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC22A8 in papillary thyroid cancer			[ 11 ]
Location	TSS200 (cg22907415)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.07E+00	Statistic Test	p-value: 7.79E-04; Z-score: 1.24E+00
Methylation in Case	6.47E-01 (Median)	Methylation in Control	6.07E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC22A8 in papillary thyroid cancer			[ 11 ]
Location	TSS200 (cg10068408)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.06E+00	Statistic Test	p-value: 9.33E-03; Z-score: 1.20E+00
Methylation in Case	7.68E-01 (Median)	Methylation in Control	7.23E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC22A8 in papillary thyroid cancer			[ 11 ]
Location	TSS200 (cg08288703)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.12E+00	Statistic Test	p-value: 3.52E-02; Z-score: -1.16E+00
Methylation in Case	4.48E-01 (Median)	Methylation in Control	5.02E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC22A8 in papillary thyroid cancer			[ 11 ]
Location	Body (cg17945323)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.26E+00	Statistic Test	p-value: 1.07E-07; Z-score: -1.50E+00
Methylation in Case	3.71E-01 (Median)	Methylation in Control	4.68E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of SLC22A8 in papillary thyroid cancer			[ 11 ]
Location	Body (cg16146033)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.18E+00	Statistic Test	p-value: 6.38E-07; Z-score: -1.23E+00
Methylation in Case	2.43E-01 (Median)	Methylation in Control	2.88E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 9	Methylation of SLC22A8 in papillary thyroid cancer			[ 11 ]
Location	Body (cg15572436)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.25E+00	Statistic Test	p-value: 3.33E-06; Z-score: -1.54E+00
Methylation in Case	2.79E-01 (Median)	Methylation in Control	3.48E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Prostate cancer	7 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC22A8 in prostate cancer			[ 12 ]
Location	5'UTR (cg13365761)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.44E+00	Statistic Test	p-value: 8.32E-03; Z-score: 4.40E+00
Methylation in Case	1.05E-01 (Median)	Methylation in Control	7.28E-02 (Median)
Studied Phenotype	Prostate cancer [ ICD-11: 2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC22A8 in prostate cancer			[ 12 ]
Location	1stExon (cg15974272)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.86E+00	Statistic Test	p-value: 8.38E-03; Z-score: -2.30E+00
Methylation in Case	1.28E-02 (Median)	Methylation in Control	2.39E-02 (Median)
Studied Phenotype	Prostate cancer [ ICD-11: 2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC22A8 in prostate cancer			[ 12 ]
Location	Body (cg20222568)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.10E+00	Statistic Test	p-value: 2.40E-03; Z-score: 3.91E+00
Methylation in Case	8.88E-01 (Median)	Methylation in Control	8.07E-01 (Median)
Studied Phenotype	Prostate cancer [ ICD-11: 2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC22A8 in prostate cancer			[ 12 ]
Location	Body (cg16856453)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.40E+00	Statistic Test	p-value: 1.97E-02; Z-score: 6.25E+00
Methylation in Case	5.72E-01 (Median)	Methylation in Control	4.09E-01 (Median)
Studied Phenotype	Prostate cancer [ ICD-11: 2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC22A8 in prostate cancer			[ 12 ]
Location	Body (cg14678680)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.05E+00	Statistic Test	p-value: 2.76E-02; Z-score: 2.43E+00
Methylation in Case	9.38E-01 (Median)	Methylation in Control	8.93E-01 (Median)
Studied Phenotype	Prostate cancer [ ICD-11: 2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC22A8 in prostate cancer			[ 12 ]
Location	Body (cg25196715)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.05E+00	Statistic Test	p-value: 4.57E-02; Z-score: 1.60E+00
Methylation in Case	9.50E-01 (Median)	Methylation in Control	9.07E-01 (Median)
Studied Phenotype	Prostate cancer [ ICD-11: 2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Significant hypermethylation of SLC22A8 in prostate cancer than that in healthy individual
Studied Phenotype	Prostate cancer [ICD-11:2C82]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 0.00156078; Fold-change: 0.305680536; Z-score: 1.664894029
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Depression	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC22A8 in depression			[ 13 ]
Location	Body (cg16146033)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.14E+00	Statistic Test	p-value: 2.33E-02; Z-score: 8.88E-01
Methylation in Case	9.16E-02 (Median)	Methylation in Control	8.01E-02 (Median)
Studied Phenotype	Depression [ ICD-11: 6A8Z]
Experimental Material	Patient tissue samples
Systemic lupus erythematosus	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC22A8 in systemic lupus erythematosus			[ 14 ]
Location	Body (cg15572436)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.06E+00	Statistic Test	p-value: 1.50E-02; Z-score: -2.83E-01
Methylation in Case	2.37E-01 (Median)	Methylation in Control	2.51E-01 (Median)
Studied Phenotype	Systemic lupus erythematosus [ ICD-11: 4A40.0]
Experimental Material	Patient tissue samples
Liver cancer	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Moderate/significant hypermethylation of SLC22A8 in liver cancer than that in healthy individual/adjacent tissue
Studied Phenotype	Liver cancer [ICD-11:2C12]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 0.000989153; Fold-change: -0.226805737; Z-score: -1.356218659
The Methylation Level of Disease Section Compare with the Adjacent Tissue	p-value: 3.33E-14; Fold-change: -0.306655802; Z-score: -7.99853252
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue adjacent to the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals DT methylation level in tissue other than the diseased tissue of patients
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data of patients in the normal section of the tissue adjacent to the disease section Download DT methylation data in the tissue of healthy individual Download DT methylation data in the tissue of the other disease section
Melanocytoma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Moderate hypermethylation of SLC22A8 in melanocytoma than that in healthy individual
Studied Phenotype	Melanocytoma [ICD-11:2F36.2]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 6.27E-07; Fold-change: 0.242572534; Z-score: 1.18549236
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Oligodendroglial tumour	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Moderate hypermethylation of SLC22A8 in oligodendroglial tumour than that in healthy individual
Studied Phenotype	Oligodendroglial tumour [ICD-11:2A00.Y1]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 0.000796448; Fold-change: 0.257569954; Z-score: 3.239578762
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Lymphoma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Significant hypomethylation of SLC22A8 in lymphoma than that in healthy individual
Studied Phenotype	Lymphoma [ICD-11:2B30]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 1.19E-09; Fold-change: -0.422303939; Z-score: -1.944921938
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Medulloblastoma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Significant hypomethylation of SLC22A8 in medulloblastoma than that in healthy individual
Studied Phenotype	Medulloblastoma [ICD-11:2A00.10]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 2.88E-54; Fold-change: -0.633993677; Z-score: -3.114368334
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Multilayered rosettes embryonal tumour	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Significant hypomethylation of SLC22A8 in multilayered rosettes embryonal tumour than that in healthy individual
Studied Phenotype	Multilayered rosettes embryonal tumour [ICD-11:2A00.1]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 3.06E-07; Fold-change: -0.306819939; Z-score: -1.565604534
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Obesity	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Significant hypomethylation of SLC22A8 in obesity than that in healthy individual
Studied Phenotype	Obesity [ICD-11:5B81]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 7.76E-12; Fold-change: -0.33744471; Z-score: -3.367030472
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
microRNA
Unclear Phenotype	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	miR-26b directly targets SLC22A8			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	Microarray
miRNA Stemloop ID	miR-26b	miRNA Mature ID	miR-26b-5p
miRNA Sequence	UUCAAGUAAUUCAGGAUAGGU
miRNA Target Type	Direct
Experimental Material	Human cervical cancer cell line (Hela)

References
1	Regulation of the expression of human organic anion transporter 3 by hepatocyte nuclear factor 1alpha/beta and DNA methylation. Mol Pharmacol. 2006 Sep;70(3):887-96.
2	Atypical Teratoid/Rhabdoid Tumors Are Comprised of Three Epigenetic Subgroups with Distinct Enhancer Landscapes. Cancer Cell. 2016 Mar 14;29(3):379-393.
3	DNA Methylation Dynamics in Urological Tumors.
4	Genome-wide Scan for Methylation Profiles in Breast Cancer
5	Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
6	Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
7	HIV-1 Infection Accelerates Age According to the Epigenetic Clock. J Infect Dis. 2015 Nov 15;212(10):1563-73.
8	DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
9	Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
10	DNA Methylation signatures in panic disorder. Transl Psychiatry. 2017 Dec 18;7(12):1287.
11	Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
12	Reducing the risk of false discovery enabling identification of biologically significant genome-wide methylation status using the HumanMethylation450 array. BMC Genomics. 2014 Jan 22;15:51.
13	DNA methylation and inflammation marker profiles associated with a history of depression. Hum Mol Genet. 2018 Aug 15;27(16):2840-2850.
14	Genome-wide DNA methylation analysis of systemic lupus erythematosus reveals persistent hypomethylation of interferon genes and compositional changes to CD4+ T-cell populations. PLoS Genet. 2013;9(8):e1003678.
15	MicroRNA target prediction by expression analysis of host genes. Genome Res. 2009 Mar;19(3):481-90.

If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.

Detail Information of Epigenetic Regulations

Visitor Map

Correspondence