Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID DTD0030 Transporter Info
Gene Name SLCO1B3
Transporter Name Organic anion transporting polypeptide 1B3
Gene ID
28234
UniProt ID
Q9NPD5
Epigenetic Regulations of This DT (EGR)

Methylation

  Embryonic kidney cells

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Hypermethylation of SLCO1B3 in HEK293 cells [ 1 ]

Location

 3CpG sites (-734,+70,+73 bp)

Epigenetic Type

 Methylation Experiment Method Bisulfite sequencing

Related Molecular Changes

 Down regulation of SLCO1B3 Experiment Method RT-qPCR

Studied Phenotype

 Embryonic kidney cells

Experimental Material

 Human embryonic kidney cell line (HEK293)

Additional Notes

 CpG dinucleotides located at -423 and -331 were relatively hypomethylated in HEK293 cells, which indicate that Hypermethylation of other CpG dinucleotides, especially those located at +70 and +73 that are closer to the TSS, is sufficient to suppress the transcription of OATP1B3.

  Hepatocellular carcinoma

            7 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Hypermethylation of SLCO1B3 in hepatocellular carcinoma [ 1 ]

Location

 5CpG sites (-734,-423,-331,+70,+73 bp)

Epigenetic Type

 Methylation Experiment Method Bisulfite sequencing

Related Molecular Changes

 Down regulation of SLCO1B3 Experiment Method RT-qPCR

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Human liver hepatocellular carcinoma cell line (HepG2)

Additional Notes

 mRNA expression of OATP1B3 is stimulated by the treatment with DNA methylation inhibitor in OATP1B3-negative HepG2 cells.

  Epigenetic Phenomenon 2

 Methylation of SLCO1B3 in hepatocellular carcinoma [ 6 ]

Location

 5'UTR (cg06947614)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.10E+00 Statistic Test p-value: 6.21E-07; Z-score: -1.29E+00

Methylation in Case

 7.54E-01 (Median) Methylation in Control 8.29E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLCO1B3 in hepatocellular carcinoma [ 6 ]

Location

 5'UTR (cg04250181)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.10E+00 Statistic Test p-value: 5.13E-06; Z-score: -9.89E-01

Methylation in Case

 6.90E-01 (Median) Methylation in Control 7.57E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLCO1B3 in hepatocellular carcinoma [ 6 ]

Location

 TSS1500 (cg03355286)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.10E+00 Statistic Test p-value: 1.47E-06; Z-score: -9.69E-01

Methylation in Case

 6.09E-01 (Median) Methylation in Control 6.70E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLCO1B3 in hepatocellular carcinoma [ 6 ]

Location

 Body (cg17572313)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.11E+00 Statistic Test p-value: 2.55E-09; Z-score: -2.21E+00

Methylation in Case

 7.25E-01 (Median) Methylation in Control 8.02E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLCO1B3 in hepatocellular carcinoma [ 6 ]

Location

 Body (cg07396272)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.16E+00 Statistic Test p-value: 2.60E-09; Z-score: -1.94E+00

Methylation in Case

 6.99E-01 (Median) Methylation in Control 8.10E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 7

 Methylation of SLCO1B3 in hepatocellular carcinoma [ 6 ]

Location

 Body (cg03895880)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.06E+00 Statistic Test p-value: 1.61E-03; Z-score: -6.33E-01

Methylation in Case

 6.37E-01 (Median) Methylation in Control 6.76E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Atypical teratoid rhabdoid tumor

            4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLCO1B3 in atypical teratoid rhabdoid tumor [ 2 ]

Location

 5'UTR (cg04250181)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.07E+00 Statistic Test p-value: 2.84E-08; Z-score: -1.58E+00

Methylation in Case

 8.28E-01 (Median) Methylation in Control 8.83E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLCO1B3 in atypical teratoid rhabdoid tumor [ 2 ]

Location

 5'UTR (cg06947614)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.48E+00 Statistic Test p-value: 7.44E-08; Z-score: -1.45E+00

Methylation in Case

 2.09E-01 (Median) Methylation in Control 3.11E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLCO1B3 in atypical teratoid rhabdoid tumor [ 2 ]

Location

 Body (cg03895880)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.11E+00 Statistic Test p-value: 4.67E-04; Z-score: 6.16E-01

Methylation in Case

 8.93E-01 (Median) Methylation in Control 8.07E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLCO1B3 in atypical teratoid rhabdoid tumor [ 2 ]

Location

 Body (cg07396272)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.77E+00 Statistic Test p-value: 3.90E-03; Z-score: -1.19E+00

Methylation in Case

 9.07E-02 (Median) Methylation in Control 1.60E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Bladder cancer

            6 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLCO1B3 in bladder cancer [ 3 ]

Location

 5'UTR (cg04250181)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.63E+00 Statistic Test p-value: 3.05E-07; Z-score: -5.81E+00

Methylation in Case

 5.07E-01 (Median) Methylation in Control 8.25E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLCO1B3 in bladder cancer [ 3 ]

Location

 5'UTR (cg06947614)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.16E+00 Statistic Test p-value: 3.18E-05; Z-score: -6.63E+00

Methylation in Case

 7.68E-01 (Median) Methylation in Control 8.90E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLCO1B3 in bladder cancer [ 3 ]

Location

 TSS1500 (cg03355286)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.10E+00 Statistic Test p-value: 8.37E-04; Z-score: -2.45E+00

Methylation in Case

 5.21E-01 (Median) Methylation in Control 5.74E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLCO1B3 in bladder cancer [ 3 ]

Location

 Body (cg03895880)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -2.61E+00 Statistic Test p-value: 3.19E-14; Z-score: -2.85E+01

Methylation in Case

 2.93E-01 (Median) Methylation in Control 7.64E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLCO1B3 in bladder cancer [ 3 ]

Location

 Body (cg07396272)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.60E+00 Statistic Test p-value: 1.46E-07; Z-score: -1.43E+01

Methylation in Case

 5.26E-01 (Median) Methylation in Control 8.40E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLCO1B3 in bladder cancer [ 3 ]

Location

 Body (cg17572313)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.41E+00 Statistic Test p-value: 5.43E-07; Z-score: -8.10E+00

Methylation in Case

 6.03E-01 (Median) Methylation in Control 8.48E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Breast cancer

            4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLCO1B3 in breast cancer [ 4 ]

Location

 5'UTR (cg04250181)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.19E+00 Statistic Test p-value: 8.37E-12; Z-score: -1.98E+00

Methylation in Case

 6.74E-01 (Median) Methylation in Control 8.03E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLCO1B3 in breast cancer [ 4 ]

Location

 5'UTR (cg06947614)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.05E+00 Statistic Test p-value: 1.19E-04; Z-score: -1.06E+00

Methylation in Case

 8.59E-01 (Median) Methylation in Control 8.99E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLCO1B3 in breast cancer [ 4 ]

Location

 Body (cg07396272)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.08E+00 Statistic Test p-value: 3.18E-08; Z-score: -1.04E+00

Methylation in Case

 7.31E-01 (Median) Methylation in Control 7.90E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLCO1B3 in breast cancer [ 4 ]

Location

 Body (cg17572313)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.07E+00 Statistic Test p-value: 1.87E-04; Z-score: -9.88E-01

Methylation in Case

 7.67E-01 (Median) Methylation in Control 8.20E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Colorectal cancer

            4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLCO1B3 in colorectal cancer [ 5 ]

Location

 5'UTR (cg04250181)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.03E+00 Statistic Test p-value: 4.59E-02; Z-score: -4.69E-01

Methylation in Case

 8.66E-01 (Median) Methylation in Control 8.95E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLCO1B3 in colorectal cancer [ 5 ]

Location

 Body (cg17572313)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.10E+00 Statistic Test p-value: 3.39E-09; Z-score: -2.21E+00

Methylation in Case

 8.45E-01 (Median) Methylation in Control 9.26E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLCO1B3 in colorectal cancer [ 5 ]

Location

 Body (cg03895880)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.05E+00 Statistic Test p-value: 1.43E-04; Z-score: -1.75E+00

Methylation in Case

 8.07E-01 (Median) Methylation in Control 8.48E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLCO1B3 in colorectal cancer [ 5 ]

Location

 Body (cg07396272)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.02E+00 Statistic Test p-value: 4.38E-02; Z-score: -4.49E-01

Methylation in Case

 8.98E-01 (Median) Methylation in Control 9.20E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  HIV infection

            3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLCO1B3 in HIV infection [ 7 ]

Location

 5'UTR (cg04250181)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.09E+00 Statistic Test p-value: 1.23E-04; Z-score: -1.37E+00

Methylation in Case

 7.10E-01 (Median) Methylation in Control 7.77E-01 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLCO1B3 in HIV infection [ 7 ]

Location

 5'UTR (cg06947614)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.01E+00 Statistic Test p-value: 2.03E-02; Z-score: 3.45E-01

Methylation in Case

 9.62E-01 (Median) Methylation in Control 9.55E-01 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLCO1B3 in HIV infection [ 7 ]

Location

 Body (cg03895880)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.07E+00 Statistic Test p-value: 3.81E-04; Z-score: -2.10E+00

Methylation in Case

 7.86E-01 (Median) Methylation in Control 8.39E-01 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Panic disorder

            3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLCO1B3 in panic disorder [ 8 ]

Location

 5'UTR (cg06947614)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -2.63E+00 Statistic Test p-value: 8.67E-03; Z-score: -6.23E-01

Methylation in Case

 2.11E-01 (Median) Methylation in Control 5.55E-01 (Median)

Studied Phenotype

 Panic disorder [ ICD-11: 6B01]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLCO1B3 in panic disorder [ 8 ]

Location

 5'UTR (cg04250181)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -4.49E-01 Statistic Test p-value: 2.30E-02; Z-score: -3.90E-01

Methylation in Case

 -4.72E-01 (Median) Methylation in Control -2.12E-01 (Median)

Studied Phenotype

 Panic disorder [ ICD-11: 6B01]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLCO1B3 in panic disorder [ 8 ]

Location

 Body (cg07396272)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -6.35E+00 Statistic Test p-value: 1.80E-06; Z-score: -7.40E-01

Methylation in Case

 6.31E-02 (Median) Methylation in Control 4.01E-01 (Median)

Studied Phenotype

 Panic disorder [ ICD-11: 6B01]

Experimental Material

 Patient tissue samples

  Papillary thyroid cancer

            4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLCO1B3 in papillary thyroid cancer [ 9 ]

Location

 5'UTR (cg04250181)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.09E+00 Statistic Test p-value: 4.89E-02; Z-score: -4.60E-01

Methylation in Case

 3.96E-01 (Median) Methylation in Control 4.31E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLCO1B3 in papillary thyroid cancer [ 9 ]

Location

 TSS1500 (cg03355286)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.03E+00 Statistic Test p-value: 4.60E-02; Z-score: -3.31E-01

Methylation in Case

 4.90E-01 (Median) Methylation in Control 5.03E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLCO1B3 in papillary thyroid cancer [ 9 ]

Location

 Body (cg17572313)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.01E+00 Statistic Test p-value: 1.33E-02; Z-score: -2.54E-01

Methylation in Case

 8.77E-01 (Median) Methylation in Control 8.84E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLCO1B3 in papillary thyroid cancer [ 9 ]

Location

 Body (cg03895880)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.02E+00 Statistic Test p-value: 1.80E-02; Z-score: -3.08E-01

Methylation in Case

 7.94E-01 (Median) Methylation in Control 8.08E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Pancretic ductal adenocarcinoma

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLCO1B3 in pancretic ductal adenocarcinoma [ 10 ]

Location

 TSS1500 (cg16298016)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.04E+00 Statistic Test p-value: 2.52E-06; Z-score: -9.47E-01

Methylation in Case

 8.30E-01 (Median) Methylation in Control 8.60E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLCO1B3 in pancretic ductal adenocarcinoma [ 10 ]

Location

 Body (cg25025399)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.03E+00 Statistic Test p-value: 9.84E-07; Z-score: -8.56E-01

Methylation in Case

 8.62E-01 (Median) Methylation in Control 8.85E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Systemic lupus erythematosus

            3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLCO1B3 in systemic lupus erythematosus [ 11 ]

Location

 TSS1500 (cg03355286)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.01E+00 Statistic Test p-value: 3.49E-02; Z-score: -1.70E-01

Methylation in Case

 6.43E-01 (Median) Methylation in Control 6.51E-01 (Median)

Studied Phenotype

 Systemic lupus erythematosus [ ICD-11: 4A40.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLCO1B3 in systemic lupus erythematosus [ 11 ]

Location

 Body (cg03895880)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.01E+00 Statistic Test p-value: 2.26E-02; Z-score: -1.38E-01

Methylation in Case

 8.21E-01 (Median) Methylation in Control 8.30E-01 (Median)

Studied Phenotype

 Systemic lupus erythematosus [ ICD-11: 4A40.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLCO1B3 in systemic lupus erythematosus [ 11 ]

Location

 Body (cg17572313)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.01E+00 Statistic Test p-value: 3.97E-02; Z-score: -1.83E-01

Methylation in Case

 8.92E-01 (Median) Methylation in Control 8.98E-01 (Median)

Studied Phenotype

 Systemic lupus erythematosus [ ICD-11: 4A40.0]

Experimental Material

 Patient tissue samples

  Prostate cancer

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLCO1B3 in prostate cancer [ 12 ]

Location

 TSS200 (cg04633600)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 3.04E+00 Statistic Test p-value: 4.71E-02; Z-score: 6.06E+00

Methylation in Case

 2.11E-01 (Median) Methylation in Control 6.94E-02 (Median)

Studied Phenotype

 Prostate cancer [ ICD-11: 2C82]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLCO1B3 in prostate cancer [ 12 ]

Location

 Body (cg08284598)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.14E+00 Statistic Test p-value: 1.73E-02; Z-score: 2.30E+00

Methylation in Case

 8.80E-01 (Median) Methylation in Control 7.75E-01 (Median)

Studied Phenotype

 Prostate cancer [ ICD-11: 2C82]

Experimental Material

 Patient tissue samples

microRNA

  Unclear Phenotype

          25 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 miR-1277 directly targets SLCO1B3 [ 13 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-1277 miRNA Mature ID miR-1277-5p

miRNA Sequence

 AAAUAUAUAUAUAUAUGUACGUAU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 2

 miR-142 directly targets SLCO1B3 [ 13 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-142 miRNA Mature ID miR-142-5p

miRNA Sequence

 CAUAAAGUAGAAAGCACUACU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 3

 miR-1470 directly targets SLCO1B3 [ 14 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-1470 miRNA Mature ID miR-1470

miRNA Sequence

 GCCCUCCGCCCGUGCACCCCG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 4

 miR-188 directly targets SLCO1B3 [ 14 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-188 miRNA Mature ID miR-188-3p

miRNA Sequence

 CUCCCACAUGCAGGGUUUGCA

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 5

 miR-190a directly targets SLCO1B3 [ 13 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-190a miRNA Mature ID miR-190a-3p

miRNA Sequence

 CUAUAUAUCAAACAUAUUCCU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 6

 miR-329 directly targets SLCO1B3 [ 13 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-329 miRNA Mature ID miR-329-3p

miRNA Sequence

 AACACACCUGGUUAACCUCUUU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 7

 miR-340 directly targets SLCO1B3 [ 13 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-340 miRNA Mature ID miR-340-5p

miRNA Sequence

 UUAUAAAGCAAUGAGACUGAUU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 8

 miR-362 directly targets SLCO1B3 [ 13 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-362 miRNA Mature ID miR-362-3p

miRNA Sequence

 AACACACCUAUUCAAGGAUUCA

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 9

 miR-3936 directly targets SLCO1B3 [ 14 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-3936 miRNA Mature ID miR-3936

miRNA Sequence

 UAAGGGGUGUAUGGCAGAUGCA

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 10

 miR-3941 directly targets SLCO1B3 [ 13 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-3941 miRNA Mature ID miR-3941

miRNA Sequence

 UUACACACAACUGAGGAUCAUA

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 11

 miR-4287 directly targets SLCO1B3 [ 14 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4287 miRNA Mature ID miR-4287

miRNA Sequence

 UCUCCCUUGAGGGCACUUU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 12

 miR-4457 directly targets SLCO1B3 [ 14 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4457 miRNA Mature ID miR-4457

miRNA Sequence

 UCACAAGGUAUUGACUGGCGUA

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 13

 miR-4469 directly targets SLCO1B3 [ 14 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4469 miRNA Mature ID miR-4469

miRNA Sequence

 GCUCCCUCUAGGGUCGCUCGGA

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 14

 miR-4639 directly targets SLCO1B3 [ 14 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4639 miRNA Mature ID miR-4639-3p

miRNA Sequence

 UCACUCUCACCUUGCUUUGC

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 15

 miR-4667 directly targets SLCO1B3 [ 14 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4667 miRNA Mature ID miR-4667-3p

miRNA Sequence

 UCCCUCCUUCUGUCCCCACAG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 16

 miR-4685 directly targets SLCO1B3 [ 14 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4685 miRNA Mature ID miR-4685-3p

miRNA Sequence

 UCUCCCUUCCUGCCCUGGCUAG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 17

 miR-4789 directly targets SLCO1B3 [ 13 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4789 miRNA Mature ID miR-4789-3p

miRNA Sequence

 CACACAUAGCAGGUGUAUAUA

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 18

 miR-4789 directly targets SLCO1B3 [ 13 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4789 miRNA Mature ID miR-4789-5p

miRNA Sequence

 GUAUACACCUGAUAUGUGUAUG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 19

 miR-5011 directly targets SLCO1B3 [ 13 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-5011 miRNA Mature ID miR-5011-5p

miRNA Sequence

 UAUAUAUACAGCCAUGCACUC

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 20

 miR-532 directly targets SLCO1B3 [ 14 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-532 miRNA Mature ID miR-532-3p

miRNA Sequence

 CCUCCCACACCCAAGGCUUGCA

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 21

 miR-5590 directly targets SLCO1B3 [ 13 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-5590 miRNA Mature ID miR-5590-3p

miRNA Sequence

 AAUAAAGUUCAUGUAUGGCAA

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 22

 miR-603 directly targets SLCO1B3 [ 13 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-603 miRNA Mature ID miR-603

miRNA Sequence

 CACACACUGCAAUUACUUUUGC

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 23

 miR-6867 directly targets SLCO1B3 [ 14 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6867 miRNA Mature ID miR-6867-3p

miRNA Sequence

 CUCUCCCUCUUUACCCACUAG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 24

 miR-7113 directly targets SLCO1B3 [ 14 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-7113 miRNA Mature ID miR-7113-3p

miRNA Sequence

 CCUCCCUGCCCGCCUCUCUGCAG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 25

 miR-8485 directly targets SLCO1B3 [ 13 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-8485 miRNA Mature ID miR-8485

miRNA Sequence

 CACACACACACACACACGUAU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Human liver tissue

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 miR-95 regulates SLCO1B3 expression [ 15 ]

Epigenetic Type

 microRNA Experiment Method Taqman OpenArray Human miRNA Panel

miRNA Stemloop ID

 miR-95 miRNA Mature ID miR-95-5p

miRNA Sequence

 UCAAUAAAUGUCUGUUGAAUU

miRNA Target Type

 Undirect

Studied Phenotype

 Human liver tissue

Experimental Material

 Patient tissue samples

Additional Notes

 The effects of rifampin on four uptake drug transporters SLCO1B3 were negatively correlated with the rifampin effects on miR-95 expression(r=-0.79, p=0.0048).
References
1 DNA methylation profiles of organic anion transporting polypeptide 1B3 in cancer cell lines. Pharm Res. 2010 Mar;27(3):510-6.
2 Atypical Teratoid/Rhabdoid Tumors Are Comprised of Three Epigenetic Subgroups with Distinct Enhancer Landscapes. Cancer Cell. 2016 Mar 14;29(3):379-393.
3 DNA Methylation Dynamics in Urological Tumors.
4 Genome-wide Scan for Methylation Profiles in Breast Cancer
5 Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
6 Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
7 HIV-1 Infection Accelerates Age According to the Epigenetic Clock. J Infect Dis. 2015 Nov 15;212(10):1563-73.
8 DNA Methylation signatures in panic disorder. Transl Psychiatry. 2017 Dec 18;7(12):1287.
9 Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
10 Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
11 Genome-wide DNA methylation analysis of systemic lupus erythematosus reveals persistent hypomethylation of interferon genes and compositional changes to CD4+ T-cell populations. PLoS Genet. 2013;9(8):e1003678.
12 Reducing the risk of false discovery enabling identification of biologically significant genome-wide methylation status using the HumanMethylation450 array. BMC Genomics. 2014 Jan 22;15:51.
13 A quantitative analysis of CLIP methods for identifying binding sites of RNA-binding proteins. Nat Methods. 2011 May 15;8(7):559-64.
14 Genome-wide identification of microRNA targets in human ES cells reveals a role for miR-302 in modulating BMP response. Genes Dev. 2011 Oct 15;25(20):2173-86.
15 Rifampin Regulation of Drug Transporters Gene Expression and the Association of MicroRNAs in Human Hepatocytes. Front Pharmacol. 2016 Apr 26;7:111.

If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.