Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID	DTD0034 Transporter Info
Gene Name	SLC18A2
Transporter Name	Vesicular amine transporter 2
Gene ID	6571
UniProt ID	Q05940

Epigenetic Regulations of This DT (EGR)
Methylation
Prostate cancer	11 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Hypermethylation of SLC18A2 in prostate cancer			[ 1 ]
Location	Promoter
Epigenetic Type	Methylation	Experiment Method	HumanMethylation450 BeadChip
Related Molecular Changes	Down regulation of SLC18A2	Experiment Method	Microarrays
Studied Phenotype	Prostate cancer [ ICD-11: 2C82]
Experimental Material	Patient tissue samples
Additional Notes	SLC18A2 promoter Hypermethylation is highly cancerspecific, and that SLC18A2 mRNA and protein levels are significantly decreased in prostate cancer.
Epigenetic Phenomenon 2	Hypermethylation of SLC18A2 in prostate cancer			[ 1 ]
Location	Promoter
Epigenetic Type	Methylation	Experiment Method	HumanMethylation450 BeadChip
Related Molecular Changes	Down regulation of SLC18A2	Experiment Method	Western Blot
Studied Phenotype	Prostate cancer [ ICD-11: 2C82]
Experimental Material	Patient tissue samples
Additional Notes	SLC18A2 promoter Hypermethylation is highly cancerspecific, and that SLC18A2 mRNA and protein levels are significantly decreased in prostate cancer.
Epigenetic Phenomenon 3	Methylation of SLC18A2 in prostate cancer			[ 12 ]
Location	5'UTR (cg01790523)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.91E+00	Statistic Test	p-value: 2.79E-02; Z-score: -2.20E+00
Methylation in Case	3.48E-01 (Median)	Methylation in Control	6.65E-01 (Median)
Studied Phenotype	Prostate cancer [ ICD-11: 2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC18A2 in prostate cancer			[ 12 ]
Location	5'UTR (cg05919690)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.03E+00	Statistic Test	p-value: 3.16E-02; Z-score: -1.56E+00
Methylation in Case	8.00E-01 (Median)	Methylation in Control	8.25E-01 (Median)
Studied Phenotype	Prostate cancer [ ICD-11: 2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC18A2 in prostate cancer			[ 12 ]
Location	TSS1500 (cg26062856)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.13E+00	Statistic Test	p-value: 4.93E-02; Z-score: 5.88E+00
Methylation in Case	8.25E-01 (Median)	Methylation in Control	7.29E-01 (Median)
Studied Phenotype	Prostate cancer [ ICD-11: 2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC18A2 in prostate cancer			[ 12 ]
Location	TSS200 (cg22928082)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 2.05E+00	Statistic Test	p-value: 4.52E-04; Z-score: 7.67E+00
Methylation in Case	7.33E-01 (Median)	Methylation in Control	3.58E-01 (Median)
Studied Phenotype	Prostate cancer [ ICD-11: 2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC18A2 in prostate cancer			[ 12 ]
Location	TSS200 (cg18158438)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.83E+00	Statistic Test	p-value: 3.25E-02; Z-score: 2.53E+00
Methylation in Case	5.97E-01 (Median)	Methylation in Control	3.26E-01 (Median)
Studied Phenotype	Prostate cancer [ ICD-11: 2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of SLC18A2 in prostate cancer			[ 12 ]
Location	Body (cg19807207)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.05E+00	Statistic Test	p-value: 2.81E-02; Z-score: 1.76E+00
Methylation in Case	9.01E-01 (Median)	Methylation in Control	8.58E-01 (Median)
Studied Phenotype	Prostate cancer [ ICD-11: 2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 9	Methylation of SLC18A2 in prostate cancer			[ 12 ]
Location	Body (cg15829073)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.07E+00	Statistic Test	p-value: 4.36E-02; Z-score: 1.60E+00
Methylation in Case	9.04E-01 (Median)	Methylation in Control	8.49E-01 (Median)
Studied Phenotype	Prostate cancer [ ICD-11: 2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 10	Methylation of SLC18A2 in prostate cancer			[ 12 ]
Location	3'UTR (cg13605398)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 4.95E+00	Statistic Test	p-value: 3.96E-02; Z-score: 1.29E+01
Methylation in Case	4.97E-01 (Median)	Methylation in Control	1.00E-01 (Median)
Studied Phenotype	Prostate cancer [ ICD-11: 2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 11	Hypermethylation of SLC18A2 in prostate cancer			[ 17 ]
Location	Promoter (cg00498305)
Epigenetic Type	Methylation	Experiment Method	HumanMethylation450 BeadChip
Studied Phenotype	Prostate cancer [ ICD-11: 2C82]
Experimental Material	Patient tissue samples
Additional Notes	A novel four-gene (AOX1xGSTP1xHAPLN3xSLC18A2) epigenetic field effect signature with over 30% sensitivity for PC at 100% fixed specificity.
Atypical teratoid rhabdoid tumor	6 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC18A2 in atypical teratoid rhabdoid tumor			[ 2 ]
Location	5'UTR (cg00512279)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.08E+00	Statistic Test	p-value: 5.20E-09; Z-score: -1.42E+00
Methylation in Case	8.44E-01 (Median)	Methylation in Control	9.07E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC18A2 in atypical teratoid rhabdoid tumor			[ 2 ]
Location	5'UTR (cg08521987)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -2.68E+00	Statistic Test	p-value: 1.38E-07; Z-score: -1.64E+00
Methylation in Case	1.49E-01 (Median)	Methylation in Control	4.00E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC18A2 in atypical teratoid rhabdoid tumor			[ 2 ]
Location	5'UTR (cg19721867)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.33E+00	Statistic Test	p-value: 3.35E-06; Z-score: 1.54E+00
Methylation in Case	7.28E-01 (Median)	Methylation in Control	5.47E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC18A2 in atypical teratoid rhabdoid tumor			[ 2 ]
Location	Body (cg01043119)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.11E+00	Statistic Test	p-value: 4.53E-05; Z-score: 1.28E+00
Methylation in Case	9.09E-01 (Median)	Methylation in Control	8.17E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC18A2 in atypical teratoid rhabdoid tumor			[ 2 ]
Location	Body (cg10245915)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.03E+00	Statistic Test	p-value: 1.43E-02; Z-score: 3.55E-01
Methylation in Case	8.82E-01 (Median)	Methylation in Control	8.59E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC18A2 in atypical teratoid rhabdoid tumor			[ 2 ]
Location	3'UTR (cg14995160)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.26E+00	Statistic Test	p-value: 5.64E-11; Z-score: -2.04E+00
Methylation in Case	6.97E-01 (Median)	Methylation in Control	8.76E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Bladder cancer	11 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC18A2 in bladder cancer			[ 3 ]
Location	5'UTR (cg00512279)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.35E+00	Statistic Test	p-value: 1.91E-03; Z-score: 5.16E+00
Methylation in Case	1.75E-01 (Median)	Methylation in Control	1.30E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC18A2 in bladder cancer			[ 3 ]
Location	5'UTR (cg08521987)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.74E+00	Statistic Test	p-value: 2.91E-03; Z-score: 3.00E+00
Methylation in Case	1.05E-01 (Median)	Methylation in Control	6.02E-02 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC18A2 in bladder cancer			[ 3 ]
Location	5'UTR (cg19721867)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.42E+00	Statistic Test	p-value: 7.40E-03; Z-score: 3.03E+00
Methylation in Case	1.53E-02 (Median)	Methylation in Control	1.07E-02 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC18A2 in bladder cancer			[ 3 ]
Location	TSS1500 (cg15806304)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.16E+00	Statistic Test	p-value: 1.98E-02; Z-score: 2.75E+00
Methylation in Case	4.87E-01 (Median)	Methylation in Control	4.19E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC18A2 in bladder cancer			[ 3 ]
Location	TSS200 (cg15173134)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.61E+00	Statistic Test	p-value: 3.51E-03; Z-score: 1.82E+00
Methylation in Case	1.20E-01 (Median)	Methylation in Control	7.49E-02 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC18A2 in bladder cancer			[ 3 ]
Location	Body (cg15520443)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -4.26E+00	Statistic Test	p-value: 2.78E-08; Z-score: -7.77E+00
Methylation in Case	9.29E-02 (Median)	Methylation in Control	3.95E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC18A2 in bladder cancer			[ 3 ]
Location	Body (cg10245915)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.24E+00	Statistic Test	p-value: 4.41E-04; Z-score: -4.92E+00
Methylation in Case	8.75E-02 (Median)	Methylation in Control	1.08E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of SLC18A2 in bladder cancer			[ 3 ]
Location	Body (cg01043119)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.30E+00	Statistic Test	p-value: 5.98E-04; Z-score: -2.56E+00
Methylation in Case	6.31E-02 (Median)	Methylation in Control	8.21E-02 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 9	Methylation of SLC18A2 in bladder cancer			[ 3 ]
Location	Body (cg20102878)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.02E+00	Statistic Test	p-value: 1.45E-02; Z-score: -7.98E-01
Methylation in Case	8.17E-01 (Median)	Methylation in Control	8.30E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 10	Methylation of SLC18A2 in bladder cancer			[ 3 ]
Location	Body (cg26583753)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.01E+00	Statistic Test	p-value: 2.20E-02; Z-score: -5.57E-01
Methylation in Case	8.51E-01 (Median)	Methylation in Control	8.62E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 11	Methylation of SLC18A2 in bladder cancer			[ 3 ]
Location	Body (cg19617377)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.20E+00	Statistic Test	p-value: 3.23E-02; Z-score: -1.38E+00
Methylation in Case	7.73E-02 (Median)	Methylation in Control	9.27E-02 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Breast cancer	13 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC18A2 in breast cancer			[ 4 ]
Location	5'UTR (cg00512279)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.44E+00	Statistic Test	p-value: 5.34E-10; Z-score: 2.14E+00
Methylation in Case	1.65E-01 (Median)	Methylation in Control	1.14E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC18A2 in breast cancer			[ 4 ]
Location	5'UTR (cg08521987)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.99E+00	Statistic Test	p-value: 2.10E-09; Z-score: 2.10E+00
Methylation in Case	1.32E-01 (Median)	Methylation in Control	6.62E-02 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC18A2 in breast cancer			[ 4 ]
Location	5'UTR (cg19721867)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.41E+00	Statistic Test	p-value: 1.92E-04; Z-score: 3.45E-01
Methylation in Case	1.88E-02 (Median)	Methylation in Control	1.34E-02 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC18A2 in breast cancer			[ 4 ]
Location	TSS1500 (cg15806304)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.18E+00	Statistic Test	p-value: 1.71E-09; Z-score: 1.82E+00
Methylation in Case	6.19E-01 (Median)	Methylation in Control	5.25E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC18A2 in breast cancer			[ 4 ]
Location	TSS1500 (cg00498305)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.34E+00	Statistic Test	p-value: 8.88E-09; Z-score: 2.10E+00
Methylation in Case	3.77E-01 (Median)	Methylation in Control	2.83E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC18A2 in breast cancer			[ 4 ]
Location	TSS1500 (cg13980799)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.30E+00	Statistic Test	p-value: 2.25E-08; Z-score: 2.42E+00
Methylation in Case	5.29E-01 (Median)	Methylation in Control	4.08E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC18A2 in breast cancer			[ 4 ]
Location	TSS200 (cg15173134)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 2.52E+00	Statistic Test	p-value: 5.87E-10; Z-score: 2.35E+00
Methylation in Case	2.80E-01 (Median)	Methylation in Control	1.11E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of SLC18A2 in breast cancer			[ 4 ]
Location	Body (cg15225091)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.40E+00	Statistic Test	p-value: 4.75E-08; Z-score: -1.64E+00
Methylation in Case	3.01E-01 (Median)	Methylation in Control	4.21E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 9	Methylation of SLC18A2 in breast cancer			[ 4 ]
Location	Body (cg15520443)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -2.25E+00	Statistic Test	p-value: 2.11E-06; Z-score: -2.00E+00
Methylation in Case	1.32E-01 (Median)	Methylation in Control	2.98E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 10	Methylation of SLC18A2 in breast cancer			[ 4 ]
Location	Body (cg20102878)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.02E+00	Statistic Test	p-value: 9.03E-05; Z-score: -4.75E-01
Methylation in Case	8.19E-01 (Median)	Methylation in Control	8.33E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 11	Methylation of SLC18A2 in breast cancer			[ 4 ]
Location	Body (cg01043119)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.38E+00	Statistic Test	p-value: 6.22E-04; Z-score: -8.55E-01
Methylation in Case	7.77E-02 (Median)	Methylation in Control	1.07E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 12	Methylation of SLC18A2 in breast cancer			[ 4 ]
Location	Body (cg16099210)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.13E+00	Statistic Test	p-value: 2.73E-02; Z-score: 2.37E-01
Methylation in Case	4.05E-02 (Median)	Methylation in Control	3.58E-02 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 13	Methylation of SLC18A2 in breast cancer			[ 4 ]
Location	3'UTR (cg14995160)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.03E+00	Statistic Test	p-value: 2.72E-03; Z-score: -5.93E-01
Methylation in Case	7.75E-01 (Median)	Methylation in Control	7.99E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Renal cell carcinoma	10 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC18A2 in clear cell renal cell carcinoma			[ 5 ]
Location	5'UTR (cg08521987)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.32E+00	Statistic Test	p-value: 3.93E-04; Z-score: 8.39E-01
Methylation in Case	3.33E-02 (Median)	Methylation in Control	2.53E-02 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC18A2 in clear cell renal cell carcinoma			[ 5 ]
Location	5'UTR (cg00512279)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.17E+00	Statistic Test	p-value: 5.22E-04; Z-score: 5.51E-01
Methylation in Case	1.23E-01 (Median)	Methylation in Control	1.05E-01 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC18A2 in clear cell renal cell carcinoma			[ 5 ]
Location	5'UTR (cg19721867)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.08E+00	Statistic Test	p-value: 1.08E-02; Z-score: 5.31E-01
Methylation in Case	1.78E-02 (Median)	Methylation in Control	1.64E-02 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC18A2 in clear cell renal cell carcinoma			[ 5 ]
Location	TSS1500 (cg15806304)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.17E+00	Statistic Test	p-value: 7.46E-06; Z-score: 2.35E+00
Methylation in Case	6.54E-01 (Median)	Methylation in Control	5.57E-01 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC18A2 in clear cell renal cell carcinoma			[ 5 ]
Location	TSS1500 (cg13980799)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.45E+00	Statistic Test	p-value: 1.12E-03; Z-score: 2.21E+00
Methylation in Case	5.58E-01 (Median)	Methylation in Control	3.85E-01 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC18A2 in clear cell renal cell carcinoma			[ 5 ]
Location	TSS1500 (cg00498305)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.23E+00	Statistic Test	p-value: 2.83E-03; Z-score: 1.10E+00
Methylation in Case	2.99E-01 (Median)	Methylation in Control	2.43E-01 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC18A2 in clear cell renal cell carcinoma			[ 5 ]
Location	TSS200 (cg15173134)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.15E+00	Statistic Test	p-value: 2.30E-02; Z-score: 1.95E-01
Methylation in Case	5.20E-02 (Median)	Methylation in Control	4.53E-02 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of SLC18A2 in clear cell renal cell carcinoma			[ 5 ]
Location	Body (cg10245915)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.22E+00	Statistic Test	p-value: 1.12E-02; Z-score: -7.55E-01
Methylation in Case	8.80E-02 (Median)	Methylation in Control	1.08E-01 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 9	Methylation of SLC18A2 in clear cell renal cell carcinoma			[ 5 ]
Location	Body (cg19617377)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.00E+00	Statistic Test	p-value: 1.42E-02; Z-score: -1.10E-02
Methylation in Case	3.64E-02 (Median)	Methylation in Control	3.65E-02 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 10	Methylation of SLC18A2 in clear cell renal cell carcinoma			[ 5 ]
Location	Body (cg16099210)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.04E+00	Statistic Test	p-value: 3.99E-02; Z-score: -1.08E-01
Methylation in Case	2.75E-02 (Median)	Methylation in Control	2.85E-02 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Colorectal cancer	14 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC18A2 in colorectal cancer			[ 6 ]
Location	5'UTR (cg08521987)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 3.43E+00	Statistic Test	p-value: 4.59E-15; Z-score: 9.06E+00
Methylation in Case	6.31E-01 (Median)	Methylation in Control	1.84E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC18A2 in colorectal cancer			[ 6 ]
Location	5'UTR (cg19721867)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.41E+01	Statistic Test	p-value: 2.72E-13; Z-score: 2.84E+01
Methylation in Case	2.98E-01 (Median)	Methylation in Control	2.12E-02 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC18A2 in colorectal cancer			[ 6 ]
Location	5'UTR (cg00512279)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 2.15E+00	Statistic Test	p-value: 6.62E-13; Z-score: 5.65E+00
Methylation in Case	5.79E-01 (Median)	Methylation in Control	2.70E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC18A2 in colorectal cancer			[ 6 ]
Location	TSS1500 (cg13980799)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.23E+00	Statistic Test	p-value: 8.59E-07; Z-score: 1.88E+00
Methylation in Case	7.15E-01 (Median)	Methylation in Control	5.83E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC18A2 in colorectal cancer			[ 6 ]
Location	TSS1500 (cg00498305)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.28E+00	Statistic Test	p-value: 8.62E-07; Z-score: 1.74E+00
Methylation in Case	4.96E-01 (Median)	Methylation in Control	3.88E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC18A2 in colorectal cancer			[ 6 ]
Location	TSS200 (cg15173134)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 6.90E+00	Statistic Test	p-value: 1.02E-15; Z-score: 9.97E+00
Methylation in Case	5.63E-01 (Median)	Methylation in Control	8.17E-02 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC18A2 in colorectal cancer			[ 6 ]
Location	Body (cg01043119)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 2.70E+00	Statistic Test	p-value: 7.94E-13; Z-score: 7.87E+00
Methylation in Case	5.00E-01 (Median)	Methylation in Control	1.85E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of SLC18A2 in colorectal cancer			[ 6 ]
Location	Body (cg16099210)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 6.42E+00	Statistic Test	p-value: 4.07E-12; Z-score: 1.60E+01
Methylation in Case	2.64E-01 (Median)	Methylation in Control	4.11E-02 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 9	Methylation of SLC18A2 in colorectal cancer			[ 6 ]
Location	Body (cg15520443)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -2.29E+00	Statistic Test	p-value: 9.49E-12; Z-score: -2.75E+00
Methylation in Case	2.26E-01 (Median)	Methylation in Control	5.17E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 10	Methylation of SLC18A2 in colorectal cancer			[ 6 ]
Location	Body (cg19617377)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 2.26E+00	Statistic Test	p-value: 2.48E-11; Z-score: 8.40E+00
Methylation in Case	2.89E-01 (Median)	Methylation in Control	1.28E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 11	Methylation of SLC18A2 in colorectal cancer			[ 6 ]
Location	Body (cg10245915)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.99E+00	Statistic Test	p-value: 5.50E-11; Z-score: 5.51E+00
Methylation in Case	3.93E-01 (Median)	Methylation in Control	1.97E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 12	Methylation of SLC18A2 in colorectal cancer			[ 6 ]
Location	Body (cg15225091)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.31E+00	Statistic Test	p-value: 3.62E-06; Z-score: 2.52E+00
Methylation in Case	6.74E-01 (Median)	Methylation in Control	5.13E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 13	Methylation of SLC18A2 in colorectal cancer			[ 6 ]
Location	Body (cg20102878)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.01E+00	Statistic Test	p-value: 1.90E-03; Z-score: -9.63E-01
Methylation in Case	9.29E-01 (Median)	Methylation in Control	9.39E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 14	Methylation of SLC18A2 in colorectal cancer			[ 6 ]
Location	3'UTR (cg14995160)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.03E+00	Statistic Test	p-value: 2.61E-03; Z-score: -8.11E-01
Methylation in Case	8.55E-01 (Median)	Methylation in Control	8.79E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Hepatocellular carcinoma	18 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC18A2 in hepatocellular carcinoma			[ 7 ]
Location	5'UTR (cg00512279)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.60E+00	Statistic Test	p-value: 1.05E-07; Z-score: 2.92E+00
Methylation in Case	2.73E-01 (Median)	Methylation in Control	1.70E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC18A2 in hepatocellular carcinoma			[ 7 ]
Location	5'UTR (cg08521987)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.48E+00	Statistic Test	p-value: 1.59E-06; Z-score: 2.04E+00
Methylation in Case	1.54E-01 (Median)	Methylation in Control	1.04E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC18A2 in hepatocellular carcinoma			[ 7 ]
Location	TSS1500 (cg11826452)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.18E+00	Statistic Test	p-value: 2.64E-13; Z-score: -2.16E+00
Methylation in Case	6.03E-01 (Median)	Methylation in Control	7.13E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC18A2 in hepatocellular carcinoma			[ 7 ]
Location	TSS1500 (cg19024632)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.46E+00	Statistic Test	p-value: 1.43E-10; Z-score: 2.03E+00
Methylation in Case	3.97E-01 (Median)	Methylation in Control	2.71E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC18A2 in hepatocellular carcinoma			[ 7 ]
Location	TSS200 (cg15173134)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.11E+00	Statistic Test	p-value: 1.09E-03; Z-score: 1.74E-01
Methylation in Case	7.69E-02 (Median)	Methylation in Control	6.93E-02 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC18A2 in hepatocellular carcinoma			[ 7 ]
Location	Body (cg08701543)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.62E+00	Statistic Test	p-value: 9.74E-20; Z-score: -4.09E+00
Methylation in Case	3.96E-01 (Median)	Methylation in Control	6.41E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC18A2 in hepatocellular carcinoma			[ 7 ]
Location	Body (cg19000612)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.49E+00	Statistic Test	p-value: 9.29E-18; Z-score: -5.51E+00
Methylation in Case	5.71E-01 (Median)	Methylation in Control	8.52E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of SLC18A2 in hepatocellular carcinoma			[ 7 ]
Location	Body (cg17493839)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.54E+00	Statistic Test	p-value: 4.62E-17; Z-score: -2.18E+01
Methylation in Case	6.28E-01 (Median)	Methylation in Control	9.66E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 9	Methylation of SLC18A2 in hepatocellular carcinoma			[ 7 ]
Location	Body (cg20122943)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 4.61E+00	Statistic Test	p-value: 5.61E-16; Z-score: 1.19E+01
Methylation in Case	3.54E-01 (Median)	Methylation in Control	7.67E-02 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 10	Methylation of SLC18A2 in hepatocellular carcinoma			[ 7 ]
Location	Body (cg23880589)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.59E+00	Statistic Test	p-value: 2.33E-13; Z-score: 3.53E+00
Methylation in Case	4.80E-01 (Median)	Methylation in Control	3.02E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 11	Methylation of SLC18A2 in hepatocellular carcinoma			[ 7 ]
Location	Body (cg15520443)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -2.01E+00	Statistic Test	p-value: 2.89E-09; Z-score: -1.98E+00
Methylation in Case	1.18E-01 (Median)	Methylation in Control	2.38E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 12	Methylation of SLC18A2 in hepatocellular carcinoma			[ 7 ]
Location	Body (cg16099210)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 2.03E+00	Statistic Test	p-value: 5.62E-08; Z-score: 3.21E+00
Methylation in Case	1.33E-01 (Median)	Methylation in Control	6.52E-02 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 13	Methylation of SLC18A2 in hepatocellular carcinoma			[ 7 ]
Location	Body (cg10245915)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.41E+00	Statistic Test	p-value: 1.28E-06; Z-score: 2.54E+00
Methylation in Case	1.89E-01 (Median)	Methylation in Control	1.34E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 14	Methylation of SLC18A2 in hepatocellular carcinoma			[ 7 ]
Location	Body (cg15225091)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.28E+00	Statistic Test	p-value: 4.41E-05; Z-score: 1.65E+00
Methylation in Case	3.28E-01 (Median)	Methylation in Control	2.55E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 15	Methylation of SLC18A2 in hepatocellular carcinoma			[ 7 ]
Location	Body (cg01043119)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.18E+00	Statistic Test	p-value: 2.29E-04; Z-score: 9.10E-01
Methylation in Case	1.18E-01 (Median)	Methylation in Control	1.01E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 16	Methylation of SLC18A2 in hepatocellular carcinoma			[ 7 ]
Location	Body (cg19617377)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.07E+00	Statistic Test	p-value: 5.37E-03; Z-score: 4.12E-01
Methylation in Case	8.86E-02 (Median)	Methylation in Control	8.30E-02 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 17	Methylation of SLC18A2 in hepatocellular carcinoma			[ 7 ]
Location	3'UTR (cg10838500)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.65E+00	Statistic Test	p-value: 2.32E-19; Z-score: -4.12E+00
Methylation in Case	3.27E-01 (Median)	Methylation in Control	5.39E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 18	Methylation of SLC18A2 in hepatocellular carcinoma			[ 7 ]
Location	3'UTR (cg14995160)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.03E+00	Statistic Test	p-value: 3.08E-03; Z-score: -4.92E-01
Methylation in Case	7.59E-01 (Median)	Methylation in Control	7.83E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
HIV infection	13 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC18A2 in HIV infection			[ 8 ]
Location	5'UTR (cg00512279)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.46E+00	Statistic Test	p-value: 7.70E-05; Z-score: 1.62E+00
Methylation in Case	1.32E-01 (Median)	Methylation in Control	9.07E-02 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC18A2 in HIV infection			[ 8 ]
Location	5'UTR (cg08521987)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.67E+00	Statistic Test	p-value: 9.85E-05; Z-score: 1.21E+00
Methylation in Case	1.12E-01 (Median)	Methylation in Control	6.73E-02 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC18A2 in HIV infection			[ 8 ]
Location	5'UTR (cg19721867)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.90E+00	Statistic Test	p-value: 4.13E-03; Z-score: 1.70E+00
Methylation in Case	1.99E-02 (Median)	Methylation in Control	1.04E-02 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC18A2 in HIV infection			[ 8 ]
Location	TSS1500 (cg15806304)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.09E+00	Statistic Test	p-value: 1.54E-06; Z-score: 1.80E+00
Methylation in Case	7.77E-01 (Median)	Methylation in Control	7.11E-01 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC18A2 in HIV infection			[ 8 ]
Location	TSS1500 (cg00498305)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.13E+00	Statistic Test	p-value: 1.48E-02; Z-score: 1.22E+00
Methylation in Case	5.08E-01 (Median)	Methylation in Control	4.50E-01 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC18A2 in HIV infection			[ 8 ]
Location	TSS200 (cg15173134)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.67E+00	Statistic Test	p-value: 1.64E-03; Z-score: 2.07E+00
Methylation in Case	1.32E-01 (Median)	Methylation in Control	7.90E-02 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC18A2 in HIV infection			[ 8 ]
Location	Body (cg10245915)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.29E+00	Statistic Test	p-value: 2.00E-04; Z-score: 1.21E+00
Methylation in Case	9.86E-02 (Median)	Methylation in Control	7.64E-02 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of SLC18A2 in HIV infection			[ 8 ]
Location	Body (cg15225091)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.37E+00	Statistic Test	p-value: 6.82E-04; Z-score: 1.35E+00
Methylation in Case	2.41E-01 (Median)	Methylation in Control	1.75E-01 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 9	Methylation of SLC18A2 in HIV infection			[ 8 ]
Location	Body (cg19617377)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.16E+00	Statistic Test	p-value: 7.16E-04; Z-score: 8.22E-01
Methylation in Case	8.41E-02 (Median)	Methylation in Control	7.26E-02 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 10	Methylation of SLC18A2 in HIV infection			[ 8 ]
Location	Body (cg16099210)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.65E+00	Statistic Test	p-value: 1.04E-03; Z-score: 1.01E+00
Methylation in Case	4.38E-02 (Median)	Methylation in Control	2.66E-02 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 11	Methylation of SLC18A2 in HIV infection			[ 8 ]
Location	Body (cg01043119)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.13E+00	Statistic Test	p-value: 4.69E-03; Z-score: 4.13E-01
Methylation in Case	7.90E-02 (Median)	Methylation in Control	6.99E-02 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 12	Methylation of SLC18A2 in HIV infection			[ 8 ]
Location	Body (cg15520443)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.58E+00	Statistic Test	p-value: 1.25E-02; Z-score: 1.01E+00
Methylation in Case	6.92E-02 (Median)	Methylation in Control	4.37E-02 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 13	Methylation of SLC18A2 in HIV infection			[ 8 ]
Location	3'UTR (cg14995160)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.03E+00	Statistic Test	p-value: 1.40E-02; Z-score: 4.17E-01
Methylation in Case	7.41E-01 (Median)	Methylation in Control	7.17E-01 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Lung adenocarcinoma	10 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC18A2 in lung adenocarcinoma			[ 9 ]
Location	5'UTR (cg08521987)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 2.46E+00	Statistic Test	p-value: 6.15E-03; Z-score: 7.97E+00
Methylation in Case	3.34E-01 (Median)	Methylation in Control	1.36E-01 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC18A2 in lung adenocarcinoma			[ 9 ]
Location	5'UTR (cg00512279)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.79E+00	Statistic Test	p-value: 7.85E-03; Z-score: 4.34E+00
Methylation in Case	2.88E-01 (Median)	Methylation in Control	1.61E-01 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC18A2 in lung adenocarcinoma			[ 9 ]
Location	5'UTR (cg19721867)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 2.54E+00	Statistic Test	p-value: 1.84E-02; Z-score: 9.58E+00
Methylation in Case	1.00E-01 (Median)	Methylation in Control	3.93E-02 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC18A2 in lung adenocarcinoma			[ 9 ]
Location	TSS1500 (cg15806304)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.25E+00	Statistic Test	p-value: 1.31E-04; Z-score: 3.92E+00
Methylation in Case	6.41E-01 (Median)	Methylation in Control	5.13E-01 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC18A2 in lung adenocarcinoma			[ 9 ]
Location	TSS1500 (cg00498305)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.40E+00	Statistic Test	p-value: 8.41E-04; Z-score: 4.29E+00
Methylation in Case	4.43E-01 (Median)	Methylation in Control	3.17E-01 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC18A2 in lung adenocarcinoma			[ 9 ]
Location	TSS1500 (cg13980799)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.40E+00	Statistic Test	p-value: 2.79E-03; Z-score: 2.88E+00
Methylation in Case	6.15E-01 (Median)	Methylation in Control	4.38E-01 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC18A2 in lung adenocarcinoma			[ 9 ]
Location	TSS200 (cg15173134)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 2.60E+00	Statistic Test	p-value: 2.60E-03; Z-score: 8.38E+00
Methylation in Case	4.13E-01 (Median)	Methylation in Control	1.59E-01 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of SLC18A2 in lung adenocarcinoma			[ 9 ]
Location	Body (cg15225091)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.37E+00	Statistic Test	p-value: 4.74E-03; Z-score: 2.58E+00
Methylation in Case	3.69E-01 (Median)	Methylation in Control	2.68E-01 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 9	Methylation of SLC18A2 in lung adenocarcinoma			[ 9 ]
Location	Body (cg16099210)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 2.41E+00	Statistic Test	p-value: 1.78E-02; Z-score: 4.66E+00
Methylation in Case	1.37E-01 (Median)	Methylation in Control	5.71E-02 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 10	Methylation of SLC18A2 in lung adenocarcinoma			[ 9 ]
Location	Body (cg10245915)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.28E+00	Statistic Test	p-value: 3.83E-02; Z-score: 2.40E+00
Methylation in Case	1.64E-01 (Median)	Methylation in Control	1.28E-01 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Pancretic ductal adenocarcinoma	8 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC18A2 in pancretic ductal adenocarcinoma			[ 10 ]
Location	5'UTR (cg18003231)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.10E+00	Statistic Test	p-value: 6.19E-07; Z-score: -1.52E+00
Methylation in Case	8.05E-01 (Median)	Methylation in Control	8.85E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC18A2 in pancretic ductal adenocarcinoma			[ 10 ]
Location	TSS1500 (cg02915746)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.26E+00	Statistic Test	p-value: 2.70E-12; Z-score: 1.29E+00
Methylation in Case	7.61E-02 (Median)	Methylation in Control	6.06E-02 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC18A2 in pancretic ductal adenocarcinoma			[ 10 ]
Location	TSS1500 (cg05907949)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.01E+00	Statistic Test	p-value: 3.05E-02; Z-score: -3.74E-02
Methylation in Case	1.17E-01 (Median)	Methylation in Control	1.17E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC18A2 in pancretic ductal adenocarcinoma			[ 10 ]
Location	TSS200 (cg00292986)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.12E+00	Statistic Test	p-value: 1.07E-02; Z-score: -2.25E-01
Methylation in Case	8.42E-02 (Median)	Methylation in Control	9.43E-02 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC18A2 in pancretic ductal adenocarcinoma			[ 10 ]
Location	1stExon (cg11915641)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.35E+00	Statistic Test	p-value: 2.49E-05; Z-score: -8.69E-01
Methylation in Case	1.15E-01 (Median)	Methylation in Control	1.54E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC18A2 in pancretic ductal adenocarcinoma			[ 10 ]
Location	1stExon (cg06662991)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.19E+00	Statistic Test	p-value: 3.31E-04; Z-score: -8.48E-01
Methylation in Case	9.98E-02 (Median)	Methylation in Control	1.19E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC18A2 in pancretic ductal adenocarcinoma			[ 10 ]
Location	Body (cg24529484)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.43E+00	Statistic Test	p-value: 4.45E-02; Z-score: -1.33E+00
Methylation in Case	1.76E-01 (Median)	Methylation in Control	2.51E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of SLC18A2 in pancretic ductal adenocarcinoma			[ 10 ]
Location	3'UTR (cg00321824)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.09E+00	Statistic Test	p-value: 2.83E-06; Z-score: 1.68E+00
Methylation in Case	8.09E-01 (Median)	Methylation in Control	7.40E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Papillary thyroid cancer	5 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC18A2 in papillary thyroid cancer			[ 11 ]
Location	5'UTR (cg19721867)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.11E+00	Statistic Test	p-value: 1.29E-02; Z-score: 6.35E-01
Methylation in Case	4.87E-02 (Median)	Methylation in Control	4.40E-02 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC18A2 in papillary thyroid cancer			[ 11 ]
Location	TSS1500 (cg15806304)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.14E+00	Statistic Test	p-value: 2.75E-03; Z-score: 9.61E-01
Methylation in Case	4.70E-01 (Median)	Methylation in Control	4.11E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC18A2 in papillary thyroid cancer			[ 11 ]
Location	Body (cg20102878)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.01E+00	Statistic Test	p-value: 5.81E-04; Z-score: -7.54E-01
Methylation in Case	8.87E-01 (Median)	Methylation in Control	8.99E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC18A2 in papillary thyroid cancer			[ 11 ]
Location	Body (cg10245915)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.05E+00	Statistic Test	p-value: 3.23E-02; Z-score: 2.58E-01
Methylation in Case	9.67E-02 (Median)	Methylation in Control	9.17E-02 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC18A2 in papillary thyroid cancer			[ 11 ]
Location	Body (cg19617377)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.05E+00	Statistic Test	p-value: 3.75E-02; Z-score: 2.83E-01
Methylation in Case	6.87E-02 (Median)	Methylation in Control	6.57E-02 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Systemic lupus erythematosus	2 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC18A2 in systemic lupus erythematosus			[ 13 ]
Location	5'UTR (cg19721867)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.05E+00	Statistic Test	p-value: 3.96E-02; Z-score: -4.99E-02
Methylation in Case	1.36E-02 (Median)	Methylation in Control	1.43E-02 (Median)
Studied Phenotype	Systemic lupus erythematosus [ ICD-11: 4A40.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC18A2 in systemic lupus erythematosus			[ 13 ]
Location	Body (cg19617377)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.02E+00	Statistic Test	p-value: 4.16E-02; Z-score: -7.02E-02
Methylation in Case	9.25E-02 (Median)	Methylation in Control	9.45E-02 (Median)
Studied Phenotype	Systemic lupus erythematosus [ ICD-11: 4A40.0]
Experimental Material	Patient tissue samples
Colon cancer	9 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC18A2 in colon adenocarcinoma			[ 14 ]
Location	TSS1500 (cg13202751)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.16E+00	Statistic Test	p-value: 9.23E-05; Z-score: 1.39E+00
Methylation in Case	5.85E-01 (Median)	Methylation in Control	5.05E-01 (Median)
Studied Phenotype	Colon cancer [ ICD-11: 2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC18A2 in colon adenocarcinoma			[ 14 ]
Location	TSS1500 (cg09177518)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.44E+00	Statistic Test	p-value: 2.06E-04; Z-score: 1.95E+00
Methylation in Case	3.67E-01 (Median)	Methylation in Control	2.54E-01 (Median)
Studied Phenotype	Colon cancer [ ICD-11: 2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC18A2 in colon adenocarcinoma			[ 14 ]
Location	TSS1500 (cg26153885)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.05E+00	Statistic Test	p-value: 1.69E-03; Z-score: -1.50E+00
Methylation in Case	7.73E-01 (Median)	Methylation in Control	8.16E-01 (Median)
Studied Phenotype	Colon cancer [ ICD-11: 2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC18A2 in colon adenocarcinoma			[ 14 ]
Location	TSS1500 (cg08072251)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.38E+00	Statistic Test	p-value: 2.12E-03; Z-score: 1.85E+00
Methylation in Case	1.25E-01 (Median)	Methylation in Control	9.05E-02 (Median)
Studied Phenotype	Colon cancer [ ICD-11: 2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC18A2 in colon adenocarcinoma			[ 14 ]
Location	Body (cg23274660)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.60E+00	Statistic Test	p-value: 5.67E-06; Z-score: -1.47E+00
Methylation in Case	1.79E-01 (Median)	Methylation in Control	2.86E-01 (Median)
Studied Phenotype	Colon cancer [ ICD-11: 2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC18A2 in colon adenocarcinoma			[ 14 ]
Location	Body (cg08362628)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.14E+00	Statistic Test	p-value: 1.19E-04; Z-score: -2.85E+00
Methylation in Case	7.15E-01 (Median)	Methylation in Control	8.12E-01 (Median)
Studied Phenotype	Colon cancer [ ICD-11: 2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC18A2 in colon adenocarcinoma			[ 14 ]
Location	Body (cg06070755)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.05E+00	Statistic Test	p-value: 1.64E-03; Z-score: -2.19E+00
Methylation in Case	8.45E-01 (Median)	Methylation in Control	8.86E-01 (Median)
Studied Phenotype	Colon cancer [ ICD-11: 2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of SLC18A2 in colon adenocarcinoma			[ 14 ]
Location	Body (cg10091752)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.19E+00	Statistic Test	p-value: 3.41E-03; Z-score: -9.05E-01
Methylation in Case	2.81E-01 (Median)	Methylation in Control	3.33E-01 (Median)
Studied Phenotype	Colon cancer [ ICD-11: 2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 9	Methylation of SLC18A2 in colon adenocarcinoma			[ 14 ]
Location	3'UTR (cg03234405)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.11E+00	Statistic Test	p-value: 4.60E-04; Z-score: -3.04E+00
Methylation in Case	7.47E-01 (Median)	Methylation in Control	8.29E-01 (Median)
Studied Phenotype	Colon cancer [ ICD-11: 2B90]
Experimental Material	Patient tissue samples
Depression	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC18A2 in depression			[ 15 ]
Location	Body (cg10245915)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.08E+00	Statistic Test	p-value: 5.26E-03; Z-score: 6.15E-01
Methylation in Case	6.86E-02 (Median)	Methylation in Control	6.33E-02 (Median)
Studied Phenotype	Depression [ ICD-11: 6A8Z]
Experimental Material	Patient tissue samples
Panic disorder	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC18A2 in panic disorder			[ 16 ]
Location	Body (cg15225091)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -9.28E-01	Statistic Test	p-value: 2.59E-02; Z-score: -3.94E-01
Methylation in Case	-3.22E+00 (Median)	Methylation in Control	-2.99E+00 (Median)
Studied Phenotype	Panic disorder [ ICD-11: 6B01]
Experimental Material	Patient tissue samples
microRNA
Unclear Phenotype	3 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	miR-431 directly targets SLC18A2			[ 18 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-431	miRNA Mature ID	miR-431-5p
miRNA Sequence	UGUCUUGCAGGCCGUCAUGCA
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 2	miR-4639 directly targets SLC18A2			[ 18 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-4639	miRNA Mature ID	miR-4639-5p
miRNA Sequence	UUGCUAAGUAGGCUGAGAUUGA
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 3	miR-6507 directly targets SLC18A2			[ 18 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-6507	miRNA Mature ID	miR-6507-5p
miRNA Sequence	GAAGAAUAGGAGGGACUUUGU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)

References
1	Large-scale evaluation of SLC18A2 in prostate cancer reveals diagnostic and prognostic biomarker potential at three molecular levels. Mol Oncol. 2016 Jun;10(6):825-37.
2	Atypical Teratoid/Rhabdoid Tumors Are Comprised of Three Epigenetic Subgroups with Distinct Enhancer Landscapes. Cancer Cell. 2016 Mar 14;29(3):379-393.
3	DNA Methylation Dynamics in Urological Tumors.
4	Genome-wide Scan for Methylation Profiles in Breast Cancer
5	A CpG-methylation-based assay to predict survival in clear cell renal cell carcinoma. Nat Commun. 2015 Oct 30;6:8699.
6	Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
7	Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
8	HIV-1 Infection Accelerates Age According to the Epigenetic Clock. J Infect Dis. 2015 Nov 15;212(10):1563-73.
9	DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
10	Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
11	Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
12	Reducing the risk of false discovery enabling identification of biologically significant genome-wide methylation status using the HumanMethylation450 array. BMC Genomics. 2014 Jan 22;15:51.
13	Genome-wide DNA methylation analysis of systemic lupus erythematosus reveals persistent hypomethylation of interferon genes and compositional changes to CD4+ T-cell populations. PLoS Genet. 2013;9(8):e1003678.
14	Genome-scale analysis of DNA methylation in colorectal cancer using Infinium HumanMethylation450 BeadChips. Epigenetics. 2013 Sep;8(9):921-34.
15	DNA methylation and inflammation marker profiles associated with a history of depression. Hum Mol Genet. 2018 Aug 15;27(16):2840-2850.
16	DNA Methylation signatures in panic disorder. Transl Psychiatry. 2017 Dec 18;7(12):1287.
17	Heterogeneous patterns of DNA methylation-based field effects in histologically normal prostate tissue from cancer patients. Sci Rep. 2017 Jan 13;7:40636.
18	Genome-wide identification of microRNA targets in human ES cells reveals a role for miR-302 in modulating BMP response. Genes Dev. 2011 Oct 15;25(20):2173-86.

If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.

Detail Information of Epigenetic Regulations

Visitor Map

Correspondence