Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID DTD0040 Transporter Info
Gene Name ABCA2
Transporter Name ATP-binding cassette sub-family A member 2
Gene ID
20
UniProt ID
Q9BZC7
Epigenetic Regulations of This DT (EGR)

Methylation

  Alzheimer's disease

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Hypermethylation of ABCA2 in alzheimer's disease [ 1 ]

Location

 cg13930557; cg03349123

Epigenetic Type

 Methylation Experiment Method Microarray

Studied Phenotype

 Alzheimer's disease [ ICD-11: 8A20]

Experimental Material

 Patient tissue samples

Additional Notes

 High methylation level of the CpG islands (cg13930557, cg03349123) was negatively and significantly associated with AD risk(p<0.034).

microRNA

  Unclear Phenotype

          12 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 miR-320b directly targets ABCA2 [ 2 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-320b miRNA Mature ID miR-320b

miRNA Sequence

 AAAAGCUGGGUUGAGAGGGCAA

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 2

 miR-320c directly targets ABCA2 [ 2 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-320c miRNA Mature ID miR-320c

miRNA Sequence

 AAAAGCUGGGUUGAGAGGGU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 3

 miR-320d directly targets ABCA2 [ 2 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-320d miRNA Mature ID miR-320d

miRNA Sequence

 AAAAGCUGGGUUGAGAGGA

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 4

 miR-320e directly targets ABCA2 [ 2 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-320e miRNA Mature ID miR-320e

miRNA Sequence

 AAAGCUGGGUUGAGAAGG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 5

 miR-4429 directly targets ABCA2 [ 2 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4429 miRNA Mature ID miR-4429

miRNA Sequence

 AAAAGCUGGGCUGAGAGGCG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 6

 miR-4644 directly targets ABCA2 [ 2 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4644 miRNA Mature ID miR-4644

miRNA Sequence

 UGGAGAGAGAAAAGAGACAGAAG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 7

 miR-4722 directly targets ABCA2 [ 2 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4722 miRNA Mature ID miR-4722-5p

miRNA Sequence

 GGCAGGAGGGCUGUGCCAGGUUG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 8

 miR-4768 directly targets ABCA2 [ 2 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4768 miRNA Mature ID miR-4768-3p

miRNA Sequence

 CCAGGAGAUCCAGAGAGAAU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 9

 miR-485 directly targets ABCA2 [ 3 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-485 miRNA Mature ID miR-485-5p

miRNA Sequence

 AGAGGCUGGCCGUGAUGAAUUC

miRNA Target Type

 Direct

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 10

 miR-6089 directly targets ABCA2 [ 2 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6089 miRNA Mature ID miR-6089

miRNA Sequence

 GGAGGCCGGGGUGGGGCGGGGCGG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 11

 miR-6721 directly targets ABCA2 [ 2 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6721 miRNA Mature ID miR-6721-5p

miRNA Sequence

 UGGGCAGGGGCUUAUUGUAGGAG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 12

 miR-7112 directly targets ABCA2 [ 2 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-7112 miRNA Mature ID miR-7112-5p

miRNA Sequence

 ACGGGCAGGGCAGUGCACCCUG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)
References
1 ATP Binding Cassette Subfamily A Member 2 (ABCA2) Expression and Methylation are Associated with Alzheimer's Disease. Med Sci Monit. 2017 Dec 10;23:5851-5861.
2 Insights into snoRNA biogenesis and processing from PAR-CLIP of snoRNA core proteins and small RNA sequencing. Genome Biol. 2013 May 26;14(5):R45.
3 Epigenetic regulation of the DLK1-MEG3 microRNA cluster in human type 2 diabetic islets. Cell Metab. 2014 Jan 7;19(1):135-45.

If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.