Detail Information of Epigenetic Regulations
| General Information of Drug Transporter (DT) | |||||
|---|---|---|---|---|---|
| DT ID | DTD0041 Transporter Info | ||||
| Gene Name | ABCA3 | ||||
| Transporter Name | ATP-binding cassette sub-family A member 3 | ||||
| Gene ID | |||||
| UniProt ID | |||||
| Epigenetic Regulations of This DT (EGR) | |||||
|---|---|---|---|---|---|
|
Methylation |
|||||
|
Atypical teratoid rhabdoid tumor |
43 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of ABCA3 in atypical teratoid rhabdoid tumor | [ 1 ] | |||
|
Location |
5'UTR (cg02543796) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.15E+00 | Statistic Test | p-value: 1.26E-08; Z-score: 1.37E+00 | ||
|
Methylation in Case |
8.93E-01 (Median) | Methylation in Control | 7.80E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of ABCA3 in atypical teratoid rhabdoid tumor | [ 1 ] | |||
|
Location |
5'UTR (cg04783228) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.15E+00 | Statistic Test | p-value: 3.78E-08; Z-score: -1.83E+00 | ||
|
Methylation in Case |
7.12E-01 (Median) | Methylation in Control | 8.16E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of ABCA3 in atypical teratoid rhabdoid tumor | [ 1 ] | |||
|
Location |
5'UTR (cg06250288) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.30E+00 | Statistic Test | p-value: 5.91E-08; Z-score: 1.40E+00 | ||
|
Methylation in Case |
9.12E-01 (Median) | Methylation in Control | 7.00E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of ABCA3 in atypical teratoid rhabdoid tumor | [ 1 ] | |||
|
Location |
5'UTR (cg08644341) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.15E+00 | Statistic Test | p-value: 1.47E-07; Z-score: 1.35E+00 | ||
|
Methylation in Case |
8.91E-01 (Median) | Methylation in Control | 7.74E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of ABCA3 in atypical teratoid rhabdoid tumor | [ 1 ] | |||
|
Location |
5'UTR (cg08900781) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.40E+00 | Statistic Test | p-value: 1.56E-07; Z-score: -1.38E+00 | ||
|
Methylation in Case |
3.56E-01 (Median) | Methylation in Control | 4.98E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 6 |
Methylation of ABCA3 in atypical teratoid rhabdoid tumor | [ 1 ] | |||
|
Location |
5'UTR (cg09722408) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.09E+00 | Statistic Test | p-value: 1.90E-07; Z-score: -1.09E+00 | ||
|
Methylation in Case |
6.61E-01 (Median) | Methylation in Control | 7.22E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 7 |
Methylation of ABCA3 in atypical teratoid rhabdoid tumor | [ 1 ] | |||
|
Location |
Body (cg00039478) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.08E+00 | Statistic Test | p-value: 1.50E-05; Z-score: 8.52E-01 | ||
|
Methylation in Case |
8.19E-01 (Median) | Methylation in Control | 7.56E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 8 |
Methylation of ABCA3 in atypical teratoid rhabdoid tumor | [ 1 ] | |||
|
Location |
Body (cg00644103) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.07E+00 | Statistic Test | p-value: 3.13E-05; Z-score: 8.11E-01 | ||
|
Methylation in Case |
8.74E-01 (Median) | Methylation in Control | 8.14E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 9 |
Methylation of ABCA3 in atypical teratoid rhabdoid tumor | [ 1 ] | |||
|
Location |
Body (cg00718541) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.34E+00 | Statistic Test | p-value: 3.50E-05; Z-score: 1.32E+00 | ||
|
Methylation in Case |
8.33E-01 (Median) | Methylation in Control | 6.23E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 10 |
Methylation of ABCA3 in atypical teratoid rhabdoid tumor | [ 1 ] | |||
|
Location |
Body (cg01278797) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.10E+00 | Statistic Test | p-value: 5.79E-05; Z-score: 5.52E-01 | ||
|
Methylation in Case |
9.17E-01 (Median) | Methylation in Control | 8.32E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 11 |
Methylation of ABCA3 in atypical teratoid rhabdoid tumor | [ 1 ] | |||
|
Location |
Body (cg01491428) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.02E+00 | Statistic Test | p-value: 7.00E-05; Z-score: -7.29E-01 | ||
|
Methylation in Case |
8.99E-01 (Median) | Methylation in Control | 9.16E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 12 |
Methylation of ABCA3 in atypical teratoid rhabdoid tumor | [ 1 ] | |||
|
Location |
Body (cg01550915) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.39E+00 | Statistic Test | p-value: 7.08E-05; Z-score: -1.23E+00 | ||
|
Methylation in Case |
4.30E-01 (Median) | Methylation in Control | 5.98E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 13 |
Methylation of ABCA3 in atypical teratoid rhabdoid tumor | [ 1 ] | |||
|
Location |
Body (cg02124920) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.10E+00 | Statistic Test | p-value: 1.19E-04; Z-score: 5.93E-01 | ||
|
Methylation in Case |
8.67E-01 (Median) | Methylation in Control | 7.88E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 14 |
Methylation of ABCA3 in atypical teratoid rhabdoid tumor | [ 1 ] | |||
|
Location |
Body (cg02257312) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.20E+00 | Statistic Test | p-value: 1.38E-04; Z-score: -7.90E-01 | ||
|
Methylation in Case |
4.76E-01 (Median) | Methylation in Control | 5.71E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 15 |
Methylation of ABCA3 in atypical teratoid rhabdoid tumor | [ 1 ] | |||
|
Location |
Body (cg02715407) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.61E+00 | Statistic Test | p-value: 2.23E-04; Z-score: -1.27E+00 | ||
|
Methylation in Case |
2.13E-01 (Median) | Methylation in Control | 3.42E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 16 |
Methylation of ABCA3 in atypical teratoid rhabdoid tumor | [ 1 ] | |||
|
Location |
Body (cg04058100) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.33E+00 | Statistic Test | p-value: 5.45E-04; Z-score: -7.47E-01 | ||
|
Methylation in Case |
3.09E-01 (Median) | Methylation in Control | 4.12E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 17 |
Methylation of ABCA3 in atypical teratoid rhabdoid tumor | [ 1 ] | |||
|
Location |
Body (cg04149930) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.08E+00 | Statistic Test | p-value: 5.72E-04; Z-score: -7.28E-01 | ||
|
Methylation in Case |
5.32E-01 (Median) | Methylation in Control | 5.74E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 18 |
Methylation of ABCA3 in atypical teratoid rhabdoid tumor | [ 1 ] | |||
|
Location |
Body (cg05093254) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.22E+00 | Statistic Test | p-value: 1.23E-03; Z-score: 8.82E-01 | ||
|
Methylation in Case |
5.90E-01 (Median) | Methylation in Control | 4.85E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 19 |
Methylation of ABCA3 in atypical teratoid rhabdoid tumor | [ 1 ] | |||
|
Location |
Body (cg05147509) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.74E+00 | Statistic Test | p-value: 1.30E-03; Z-score: -9.63E-01 | ||
|
Methylation in Case |
1.37E-01 (Median) | Methylation in Control | 2.39E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 20 |
Methylation of ABCA3 in atypical teratoid rhabdoid tumor | [ 1 ] | |||
|
Location |
Body (cg05218653) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.09E+00 | Statistic Test | p-value: 1.33E-03; Z-score: -8.69E-01 | ||
|
Methylation in Case |
7.05E-01 (Median) | Methylation in Control | 7.69E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 21 |
Methylation of ABCA3 in atypical teratoid rhabdoid tumor | [ 1 ] | |||
|
Location |
Body (cg05654361) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.25E+00 | Statistic Test | p-value: 1.59E-03; Z-score: 1.09E+00 | ||
|
Methylation in Case |
6.59E-01 (Median) | Methylation in Control | 5.28E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 22 |
Methylation of ABCA3 in atypical teratoid rhabdoid tumor | [ 1 ] | |||
|
Location |
Body (cg05814755) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.28E+00 | Statistic Test | p-value: 1.67E-03; Z-score: -8.79E-01 | ||
|
Methylation in Case |
4.71E-01 (Median) | Methylation in Control | 6.02E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 23 |
Methylation of ABCA3 in atypical teratoid rhabdoid tumor | [ 1 ] | |||
|
Location |
Body (cg05824333) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.03E+00 | Statistic Test | p-value: 1.69E-03; Z-score: -4.97E-01 | ||
|
Methylation in Case |
8.01E-01 (Median) | Methylation in Control | 8.27E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 24 |
Methylation of ABCA3 in atypical teratoid rhabdoid tumor | [ 1 ] | |||
|
Location |
Body (cg06780216) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.03E+00 | Statistic Test | p-value: 2.93E-03; Z-score: 5.24E-01 | ||
|
Methylation in Case |
8.85E-01 (Median) | Methylation in Control | 8.62E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 25 |
Methylation of ABCA3 in atypical teratoid rhabdoid tumor | [ 1 ] | |||
|
Location |
Body (cg06933862) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.27E+00 | Statistic Test | p-value: 3.09E-03; Z-score: -6.91E-01 | ||
|
Methylation in Case |
8.30E-02 (Median) | Methylation in Control | 1.06E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 26 |
Methylation of ABCA3 in atypical teratoid rhabdoid tumor | [ 1 ] | |||
|
Location |
Body (cg07301574) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.07E+00 | Statistic Test | p-value: 3.75E-03; Z-score: 5.79E-01 | ||
|
Methylation in Case |
8.65E-01 (Median) | Methylation in Control | 8.09E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 27 |
Methylation of ABCA3 in atypical teratoid rhabdoid tumor | [ 1 ] | |||
|
Location |
Body (cg07701514) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.20E+00 | Statistic Test | p-value: 4.81E-03; Z-score: 4.13E-01 | ||
|
Methylation in Case |
7.95E-02 (Median) | Methylation in Control | 6.63E-02 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 28 |
Methylation of ABCA3 in atypical teratoid rhabdoid tumor | [ 1 ] | |||
|
Location |
Body (cg07753939) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.12E+00 | Statistic Test | p-value: 4.96E-03; Z-score: 6.08E-01 | ||
|
Methylation in Case |
7.95E-01 (Median) | Methylation in Control | 7.12E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 29 |
Methylation of ABCA3 in atypical teratoid rhabdoid tumor | [ 1 ] | |||
|
Location |
Body (cg08131081) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.06E+00 | Statistic Test | p-value: 5.36E-03; Z-score: 3.09E-01 | ||
|
Methylation in Case |
1.03E-01 (Median) | Methylation in Control | 9.66E-02 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 30 |
Methylation of ABCA3 in atypical teratoid rhabdoid tumor | [ 1 ] | |||
|
Location |
Body (cg08322747) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.06E+00 | Statistic Test | p-value: 5.76E-03; Z-score: -5.07E-01 | ||
|
Methylation in Case |
8.17E-01 (Median) | Methylation in Control | 8.64E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 31 |
Methylation of ABCA3 in atypical teratoid rhabdoid tumor | [ 1 ] | |||
|
Location |
Body (cg08449748) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.12E+00 | Statistic Test | p-value: 6.57E-03; Z-score: 6.68E-01 | ||
|
Methylation in Case |
6.02E-01 (Median) | Methylation in Control | 5.36E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 32 |
Methylation of ABCA3 in atypical teratoid rhabdoid tumor | [ 1 ] | |||
|
Location |
Body (cg08490220) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.02E+00 | Statistic Test | p-value: 7.05E-03; Z-score: 3.22E-01 | ||
|
Methylation in Case |
8.64E-01 (Median) | Methylation in Control | 8.46E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 33 |
Methylation of ABCA3 in atypical teratoid rhabdoid tumor | [ 1 ] | |||
|
Location |
Body (cg09263316) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 9.73E-03; Z-score: -4.17E-01 | ||
|
Methylation in Case |
8.10E-01 (Median) | Methylation in Control | 8.22E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 34 |
Methylation of ABCA3 in atypical teratoid rhabdoid tumor | [ 1 ] | |||
|
Location |
Body (cg09481056) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.04E+00 | Statistic Test | p-value: 1.07E-02; Z-score: -6.16E-01 | ||
|
Methylation in Case |
8.12E-01 (Median) | Methylation in Control | 8.45E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 35 |
Methylation of ABCA3 in atypical teratoid rhabdoid tumor | [ 1 ] | |||
|
Location |
Body (cg09632163) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.04E+00 | Statistic Test | p-value: 1.13E-02; Z-score: 6.28E-01 | ||
|
Methylation in Case |
8.69E-01 (Median) | Methylation in Control | 8.37E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 36 |
Methylation of ABCA3 in atypical teratoid rhabdoid tumor | [ 1 ] | |||
|
Location |
Body (cg09681286) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.08E+00 | Statistic Test | p-value: 1.18E-02; Z-score: 6.92E-01 | ||
|
Methylation in Case |
7.87E-01 (Median) | Methylation in Control | 7.31E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 37 |
Methylation of ABCA3 in atypical teratoid rhabdoid tumor | [ 1 ] | |||
|
Location |
Body (cg09945896) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.02E+00 | Statistic Test | p-value: 1.24E-02; Z-score: -4.92E-01 | ||
|
Methylation in Case |
8.80E-01 (Median) | Methylation in Control | 8.94E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 38 |
Methylation of ABCA3 in atypical teratoid rhabdoid tumor | [ 1 ] | |||
|
Location |
Body (cg09954729) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.04E+00 | Statistic Test | p-value: 1.26E-02; Z-score: 5.07E-01 | ||
|
Methylation in Case |
8.84E-01 (Median) | Methylation in Control | 8.50E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 39 |
Methylation of ABCA3 in atypical teratoid rhabdoid tumor | [ 1 ] | |||
|
Location |
Body (cg10125193) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.11E+00 | Statistic Test | p-value: 1.36E-02; Z-score: 8.28E-01 | ||
|
Methylation in Case |
8.90E-01 (Median) | Methylation in Control | 8.01E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 40 |
Methylation of ABCA3 in atypical teratoid rhabdoid tumor | [ 1 ] | |||
|
Location |
Body (cg10275969) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 1.43E-02; Z-score: -4.52E-01 | ||
|
Methylation in Case |
8.96E-01 (Median) | Methylation in Control | 9.08E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 41 |
Methylation of ABCA3 in atypical teratoid rhabdoid tumor | [ 1 ] | |||
|
Location |
3'UTR (cg06335980) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.21E+00 | Statistic Test | p-value: 1.15E-13; Z-score: -2.15E+00 | ||
|
Methylation in Case |
6.80E-01 (Median) | Methylation in Control | 8.20E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 42 |
Methylation of ABCA3 in atypical teratoid rhabdoid tumor | [ 1 ] | |||
|
Location |
3'UTR (cg07737682) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.15E+00 | Statistic Test | p-value: 2.66E-13; Z-score: -2.38E+00 | ||
|
Methylation in Case |
7.43E-01 (Median) | Methylation in Control | 8.56E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 43 |
Methylation of ABCA3 in atypical teratoid rhabdoid tumor | [ 1 ] | |||
|
Location |
3'UTR (cg10154010) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.99E+00 | Statistic Test | p-value: 2.51E-12; Z-score: 2.13E+00 | ||
|
Methylation in Case |
3.97E-01 (Median) | Methylation in Control | 1.99E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Bladder cancer |
32 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of ABCA3 in bladder cancer | [ 2 ] | |||
|
Location |
5'UTR (cg06250288) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.54E+00 | Statistic Test | p-value: 3.48E-13; Z-score: -2.12E+01 | ||
|
Methylation in Case |
4.90E-01 (Median) | Methylation in Control | 7.52E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of ABCA3 in bladder cancer | [ 2 ] | |||
|
Location |
5'UTR (cg08644341) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.40E+00 | Statistic Test | p-value: 1.40E-08; Z-score: -1.81E+01 | ||
|
Methylation in Case |
5.75E-01 (Median) | Methylation in Control | 8.02E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of ABCA3 in bladder cancer | [ 2 ] | |||
|
Location |
5'UTR (cg09722408) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.21E+00 | Statistic Test | p-value: 1.38E-05; Z-score: -6.16E+00 | ||
|
Methylation in Case |
7.33E-01 (Median) | Methylation in Control | 8.86E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of ABCA3 in bladder cancer | [ 2 ] | |||
|
Location |
5'UTR (cg08900781) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.13E+00 | Statistic Test | p-value: 2.68E-05; Z-score: -6.70E+00 | ||
|
Methylation in Case |
7.71E-01 (Median) | Methylation in Control | 8.74E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of ABCA3 in bladder cancer | [ 2 ] | |||
|
Location |
5'UTR (cg02543796) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.06E+00 | Statistic Test | p-value: 1.79E-03; Z-score: -2.53E+00 | ||
|
Methylation in Case |
7.57E-01 (Median) | Methylation in Control | 8.02E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 6 |
Methylation of ABCA3 in bladder cancer | [ 2 ] | |||
|
Location |
Body (cg01550915) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -2.11E+00 | Statistic Test | p-value: 7.79E-14; Z-score: -3.31E+01 | ||
|
Methylation in Case |
3.78E-01 (Median) | Methylation in Control | 7.98E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 7 |
Methylation of ABCA3 in bladder cancer | [ 2 ] | |||
|
Location |
Body (cg08490220) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.72E+00 | Statistic Test | p-value: 1.16E-11; Z-score: -1.14E+01 | ||
|
Methylation in Case |
3.61E-01 (Median) | Methylation in Control | 6.22E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 8 |
Methylation of ABCA3 in bladder cancer | [ 2 ] | |||
|
Location |
Body (cg04149930) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.78E+00 | Statistic Test | p-value: 3.02E-10; Z-score: -1.07E+01 | ||
|
Methylation in Case |
4.13E-01 (Median) | Methylation in Control | 7.38E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 9 |
Methylation of ABCA3 in bladder cancer | [ 2 ] | |||
|
Location |
Body (cg04058100) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.30E+00 | Statistic Test | p-value: 4.41E-07; Z-score: -1.03E+01 | ||
|
Methylation in Case |
6.54E-01 (Median) | Methylation in Control | 8.53E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 10 |
Methylation of ABCA3 in bladder cancer | [ 2 ] | |||
|
Location |
Body (cg09954729) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.58E+00 | Statistic Test | p-value: 1.40E-06; Z-score: -7.64E+00 | ||
|
Methylation in Case |
5.85E-01 (Median) | Methylation in Control | 9.26E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 11 |
Methylation of ABCA3 in bladder cancer | [ 2 ] | |||
|
Location |
Body (cg08131081) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.19E+00 | Statistic Test | p-value: 3.42E-06; Z-score: -2.46E+01 | ||
|
Methylation in Case |
7.78E-01 (Median) | Methylation in Control | 9.22E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 12 |
Methylation of ABCA3 in bladder cancer | [ 2 ] | |||
|
Location |
Body (cg09263316) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.53E+00 | Statistic Test | p-value: 8.69E-06; Z-score: -1.41E+01 | ||
|
Methylation in Case |
5.17E-01 (Median) | Methylation in Control | 7.94E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 13 |
Methylation of ABCA3 in bladder cancer | [ 2 ] | |||
|
Location |
Body (cg02257312) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.21E+00 | Statistic Test | p-value: 1.43E-05; Z-score: -1.99E+01 | ||
|
Methylation in Case |
7.39E-01 (Median) | Methylation in Control | 8.91E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 14 |
Methylation of ABCA3 in bladder cancer | [ 2 ] | |||
|
Location |
Body (cg19754709) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.49E+00 | Statistic Test | p-value: 8.80E-05; Z-score: -4.57E+00 | ||
|
Methylation in Case |
4.03E-01 (Median) | Methylation in Control | 5.98E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 15 |
Methylation of ABCA3 in bladder cancer | [ 2 ] | |||
|
Location |
Body (cg06780216) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.24E+00 | Statistic Test | p-value: 1.25E-04; Z-score: -6.88E+00 | ||
|
Methylation in Case |
6.90E-01 (Median) | Methylation in Control | 8.58E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 16 |
Methylation of ABCA3 in bladder cancer | [ 2 ] | |||
|
Location |
Body (cg00644103) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.59E+00 | Statistic Test | p-value: 1.71E-04; Z-score: -4.60E+00 | ||
|
Methylation in Case |
3.80E-01 (Median) | Methylation in Control | 6.07E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 17 |
Methylation of ABCA3 in bladder cancer | [ 2 ] | |||
|
Location |
Body (cg05147509) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.08E+00 | Statistic Test | p-value: 1.73E-04; Z-score: 3.08E+00 | ||
|
Methylation in Case |
8.00E-01 (Median) | Methylation in Control | 7.39E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 18 |
Methylation of ABCA3 in bladder cancer | [ 2 ] | |||
|
Location |
Body (cg00039478) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.04E+00 | Statistic Test | p-value: 2.56E-04; Z-score: -2.07E+00 | ||
|
Methylation in Case |
7.67E-01 (Median) | Methylation in Control | 7.96E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 19 |
Methylation of ABCA3 in bladder cancer | [ 2 ] | |||
|
Location |
Body (cg08449748) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.34E+00 | Statistic Test | p-value: 2.97E-04; Z-score: -1.50E+01 | ||
|
Methylation in Case |
3.88E-01 (Median) | Methylation in Control | 5.22E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 20 |
Methylation of ABCA3 in bladder cancer | [ 2 ] | |||
|
Location |
Body (cg05218653) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.18E+00 | Statistic Test | p-value: 3.48E-04; Z-score: -1.34E+01 | ||
|
Methylation in Case |
8.01E-01 (Median) | Methylation in Control | 9.44E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 21 |
Methylation of ABCA3 in bladder cancer | [ 2 ] | |||
|
Location |
Body (cg09945896) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.16E+00 | Statistic Test | p-value: 9.52E-04; Z-score: -8.12E+00 | ||
|
Methylation in Case |
6.75E-01 (Median) | Methylation in Control | 7.84E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 22 |
Methylation of ABCA3 in bladder cancer | [ 2 ] | |||
|
Location |
Body (cg10275969) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.24E+00 | Statistic Test | p-value: 1.63E-03; Z-score: -2.97E+00 | ||
|
Methylation in Case |
4.34E-01 (Median) | Methylation in Control | 5.38E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 23 |
Methylation of ABCA3 in bladder cancer | [ 2 ] | |||
|
Location |
Body (cg01278797) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.05E+00 | Statistic Test | p-value: 2.29E-03; Z-score: -3.65E+00 | ||
|
Methylation in Case |
8.26E-01 (Median) | Methylation in Control | 8.67E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 24 |
Methylation of ABCA3 in bladder cancer | [ 2 ] | |||
|
Location |
Body (cg06933862) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.05E+00 | Statistic Test | p-value: 2.83E-03; Z-score: -4.74E+00 | ||
|
Methylation in Case |
8.86E-01 (Median) | Methylation in Control | 9.26E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 25 |
Methylation of ABCA3 in bladder cancer | [ 2 ] | |||
|
Location |
Body (cg07701514) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.26E+00 | Statistic Test | p-value: 4.08E-03; Z-score: -3.28E+00 | ||
|
Methylation in Case |
3.86E-01 (Median) | Methylation in Control | 4.85E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 26 |
Methylation of ABCA3 in bladder cancer | [ 2 ] | |||
|
Location |
Body (cg02715407) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.10E+00 | Statistic Test | p-value: 4.77E-03; Z-score: -6.20E+00 | ||
|
Methylation in Case |
6.80E-01 (Median) | Methylation in Control | 7.51E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 27 |
Methylation of ABCA3 in bladder cancer | [ 2 ] | |||
|
Location |
Body (cg05093254) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.00E+00 | Statistic Test | p-value: 5.57E-03; Z-score: -9.97E-01 | ||
|
Methylation in Case |
9.77E-01 (Median) | Methylation in Control | 9.81E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 28 |
Methylation of ABCA3 in bladder cancer | [ 2 ] | |||
|
Location |
Body (cg05654361) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.10E+00 | Statistic Test | p-value: 5.82E-03; Z-score: -3.00E+00 | ||
|
Methylation in Case |
6.28E-01 (Median) | Methylation in Control | 6.94E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 29 |
Methylation of ABCA3 in bladder cancer | [ 2 ] | |||
|
Location |
Body (cg09481056) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 3.17E-02; Z-score: -3.94E-01 | ||
|
Methylation in Case |
7.48E-01 (Median) | Methylation in Control | 7.55E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 30 |
Methylation of ABCA3 in bladder cancer | [ 2 ] | |||
|
Location |
3'UTR (cg06335980) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.45E+00 | Statistic Test | p-value: 9.26E-08; Z-score: -1.42E+01 | ||
|
Methylation in Case |
4.90E-01 (Median) | Methylation in Control | 7.11E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 31 |
Methylation of ABCA3 in bladder cancer | [ 2 ] | |||
|
Location |
3'UTR (cg07737682) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.46E+00 | Statistic Test | p-value: 1.10E-05; Z-score: -5.82E+00 | ||
|
Methylation in Case |
4.78E-01 (Median) | Methylation in Control | 6.98E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 32 |
Methylation of ABCA3 in bladder cancer | [ 2 ] | |||
|
Location |
3'UTR (cg10154010) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.15E+00 | Statistic Test | p-value: 5.78E-03; Z-score: -1.96E+00 | ||
|
Methylation in Case |
6.98E-01 (Median) | Methylation in Control | 8.01E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Breast cancer |
20 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of ABCA3 in breast cancer | [ 3 ] | |||
|
Location |
5'UTR (cg08644341) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.10E+00 | Statistic Test | p-value: 1.51E-09; Z-score: 1.73E+00 | ||
|
Methylation in Case |
7.98E-01 (Median) | Methylation in Control | 7.24E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of ABCA3 in breast cancer | [ 3 ] | |||
|
Location |
5'UTR (cg08900781) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.03E+00 | Statistic Test | p-value: 4.36E-07; Z-score: -1.28E+00 | ||
|
Methylation in Case |
8.43E-01 (Median) | Methylation in Control | 8.66E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of ABCA3 in breast cancer | [ 3 ] | |||
|
Location |
5'UTR (cg02543796) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.05E+00 | Statistic Test | p-value: 1.48E-02; Z-score: -6.98E-01 | ||
|
Methylation in Case |
7.84E-01 (Median) | Methylation in Control | 8.22E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of ABCA3 in breast cancer | [ 3 ] | |||
|
Location |
Body (cg10275969) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.38E+00 | Statistic Test | p-value: 4.44E-31; Z-score: 4.20E+00 | ||
|
Methylation in Case |
7.38E-01 (Median) | Methylation in Control | 5.36E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of ABCA3 in breast cancer | [ 3 ] | |||
|
Location |
Body (cg07701514) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.15E+00 | Statistic Test | p-value: 3.66E-10; Z-score: 1.63E+00 | ||
|
Methylation in Case |
7.42E-01 (Median) | Methylation in Control | 6.44E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 6 |
Methylation of ABCA3 in breast cancer | [ 3 ] | |||
|
Location |
Body (cg04149930) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.09E+00 | Statistic Test | p-value: 2.49E-06; Z-score: -1.25E+00 | ||
|
Methylation in Case |
7.40E-01 (Median) | Methylation in Control | 8.09E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 7 |
Methylation of ABCA3 in breast cancer | [ 3 ] | |||
|
Location |
Body (cg05654361) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.05E+00 | Statistic Test | p-value: 7.51E-06; Z-score: 1.08E+00 | ||
|
Methylation in Case |
7.48E-01 (Median) | Methylation in Control | 7.14E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 8 |
Methylation of ABCA3 in breast cancer | [ 3 ] | |||
|
Location |
Body (cg10125193) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.05E+00 | Statistic Test | p-value: 1.56E-04; Z-score: -1.11E+00 | ||
|
Methylation in Case |
7.90E-01 (Median) | Methylation in Control | 8.30E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 9 |
Methylation of ABCA3 in breast cancer | [ 3 ] | |||
|
Location |
Body (cg04058100) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.08E+00 | Statistic Test | p-value: 2.39E-04; Z-score: -1.07E+00 | ||
|
Methylation in Case |
7.99E-01 (Median) | Methylation in Control | 8.61E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 10 |
Methylation of ABCA3 in breast cancer | [ 3 ] | |||
|
Location |
Body (cg07753939) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.05E+00 | Statistic Test | p-value: 5.36E-04; Z-score: -8.95E-01 | ||
|
Methylation in Case |
9.06E-01 (Median) | Methylation in Control | 9.55E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 11 |
Methylation of ABCA3 in breast cancer | [ 3 ] | |||
|
Location |
Body (cg09681286) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.02E+00 | Statistic Test | p-value: 1.75E-03; Z-score: 2.85E-01 | ||
|
Methylation in Case |
8.43E-01 (Median) | Methylation in Control | 8.29E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 12 |
Methylation of ABCA3 in breast cancer | [ 3 ] | |||
|
Location |
Body (cg09945896) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.08E+00 | Statistic Test | p-value: 2.12E-03; Z-score: 4.97E-01 | ||
|
Methylation in Case |
8.14E-01 (Median) | Methylation in Control | 7.53E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 13 |
Methylation of ABCA3 in breast cancer | [ 3 ] | |||
|
Location |
Body (cg00039478) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.03E+00 | Statistic Test | p-value: 7.02E-03; Z-score: -6.84E-01 | ||
|
Methylation in Case |
7.42E-01 (Median) | Methylation in Control | 7.66E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 14 |
Methylation of ABCA3 in breast cancer | [ 3 ] | |||
|
Location |
Body (cg20915212) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.03E+00 | Statistic Test | p-value: 1.12E-02; Z-score: -7.79E-01 | ||
|
Methylation in Case |
7.07E-01 (Median) | Methylation in Control | 7.31E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 15 |
Methylation of ABCA3 in breast cancer | [ 3 ] | |||
|
Location |
Body (cg08449748) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.04E+00 | Statistic Test | p-value: 2.45E-02; Z-score: 6.30E-01 | ||
|
Methylation in Case |
7.26E-01 (Median) | Methylation in Control | 6.95E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 16 |
Methylation of ABCA3 in breast cancer | [ 3 ] | |||
|
Location |
Body (cg06780216) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.15E+00 | Statistic Test | p-value: 2.78E-02; Z-score: -5.93E-01 | ||
|
Methylation in Case |
8.23E-01 (Median) | Methylation in Control | 9.43E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 17 |
Methylation of ABCA3 in breast cancer | [ 3 ] | |||
|
Location |
Body (cg02715407) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.02E+00 | Statistic Test | p-value: 3.38E-02; Z-score: -3.37E-01 | ||
|
Methylation in Case |
7.69E-01 (Median) | Methylation in Control | 7.82E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 18 |
Methylation of ABCA3 in breast cancer | [ 3 ] | |||
|
Location |
Body (cg16463165) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.01E+00 | Statistic Test | p-value: 3.83E-02; Z-score: 2.51E-01 | ||
|
Methylation in Case |
6.78E-01 (Median) | Methylation in Control | 6.70E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 19 |
Methylation of ABCA3 in breast cancer | [ 3 ] | |||
|
Location |
3'UTR (cg06335980) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.08E+00 | Statistic Test | p-value: 2.81E-03; Z-score: 6.23E-01 | ||
|
Methylation in Case |
7.86E-01 (Median) | Methylation in Control | 7.26E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 20 |
Methylation of ABCA3 in breast cancer | [ 3 ] | |||
|
Location |
3'UTR (cg07737682) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.04E+00 | Statistic Test | p-value: 2.92E-02; Z-score: 8.00E-01 | ||
|
Methylation in Case |
7.08E-01 (Median) | Methylation in Control | 6.79E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Colon cancer |
10 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of ABCA3 in colon adenocarcinoma | [ 4 ] | |||
|
Location |
5'UTR (cg03363743) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.35E+00 | Statistic Test | p-value: 3.62E-07; Z-score: 2.62E+00 | ||
|
Methylation in Case |
5.03E-01 (Median) | Methylation in Control | 3.73E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of ABCA3 in colon adenocarcinoma | [ 4 ] | |||
|
Location |
5'UTR (cg06250288) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.16E+00 | Statistic Test | p-value: 8.05E-05; Z-score: -3.04E+00 | ||
|
Methylation in Case |
6.18E-01 (Median) | Methylation in Control | 7.18E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of ABCA3 in colon adenocarcinoma | [ 4 ] | |||
|
Location |
TSS1500 (cg01183122) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.04E+00 | Statistic Test | p-value: 4.27E-03; Z-score: -1.12E+00 | ||
|
Methylation in Case |
8.13E-01 (Median) | Methylation in Control | 8.48E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of ABCA3 in colon adenocarcinoma | [ 4 ] | |||
|
Location |
TSS200 (cg25307168) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.17E+00 | Statistic Test | p-value: 1.47E-07; Z-score: 1.59E+00 | ||
|
Methylation in Case |
5.35E-01 (Median) | Methylation in Control | 4.58E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of ABCA3 in colon adenocarcinoma | [ 4 ] | |||
|
Location |
TSS200 (cg02330121) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 4.13E+00 | Statistic Test | p-value: 9.01E-07; Z-score: 1.11E+01 | ||
|
Methylation in Case |
2.78E-01 (Median) | Methylation in Control | 6.72E-02 (Median) | ||
|
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 6 |
Methylation of ABCA3 in colon adenocarcinoma | [ 4 ] | |||
|
Location |
TSS200 (cg16843423) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 2.91E+00 | Statistic Test | p-value: 1.02E-03; Z-score: 4.47E+00 | ||
|
Methylation in Case |
1.37E-01 (Median) | Methylation in Control | 4.71E-02 (Median) | ||
|
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 7 |
Methylation of ABCA3 in colon adenocarcinoma | [ 4 ] | |||
|
Location |
Body (cg04849842) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 2.22E+00 | Statistic Test | p-value: 4.27E-10; Z-score: 5.72E+00 | ||
|
Methylation in Case |
6.01E-01 (Median) | Methylation in Control | 2.70E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 8 |
Methylation of ABCA3 in colon adenocarcinoma | [ 4 ] | |||
|
Location |
Body (cg03645007) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.08E+00 | Statistic Test | p-value: 6.84E-04; Z-score: -1.81E+00 | ||
|
Methylation in Case |
7.00E-01 (Median) | Methylation in Control | 7.56E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 9 |
Methylation of ABCA3 in colon adenocarcinoma | [ 4 ] | |||
|
Location |
Body (cg06094523) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.08E+00 | Statistic Test | p-value: 1.29E-03; Z-score: -7.13E-01 | ||
|
Methylation in Case |
3.85E-01 (Median) | Methylation in Control | 4.16E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 10 |
Methylation of ABCA3 in colon adenocarcinoma | [ 4 ] | |||
|
Location |
Body (cg21974358) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.17E+00 | Statistic Test | p-value: 3.76E-03; Z-score: 1.06E+00 | ||
|
Methylation in Case |
6.51E-01 (Median) | Methylation in Control | 5.56E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Colorectal cancer |
33 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of ABCA3 in colorectal cancer | [ 5 ] | |||
|
Location |
5'UTR (cg08644341) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.05E+00 | Statistic Test | p-value: 1.60E-06; Z-score: -2.26E+00 | ||
|
Methylation in Case |
8.66E-01 (Median) | Methylation in Control | 9.06E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of ABCA3 in colorectal cancer | [ 5 ] | |||
|
Location |
5'UTR (cg06250288) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.07E+00 | Statistic Test | p-value: 2.33E-06; Z-score: -1.57E+00 | ||
|
Methylation in Case |
7.87E-01 (Median) | Methylation in Control | 8.41E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of ABCA3 in colorectal cancer | [ 5 ] | |||
|
Location |
5'UTR (cg08900781) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 1.71E-03; Z-score: -8.81E-01 | ||
|
Methylation in Case |
9.40E-01 (Median) | Methylation in Control | 9.48E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of ABCA3 in colorectal cancer | [ 5 ] | |||
|
Location |
Body (cg00644103) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.14E+00 | Statistic Test | p-value: 3.56E-11; Z-score: -4.32E+00 | ||
|
Methylation in Case |
7.69E-01 (Median) | Methylation in Control | 8.74E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of ABCA3 in colorectal cancer | [ 5 ] | |||
|
Location |
Body (cg19754709) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.12E+00 | Statistic Test | p-value: 3.82E-10; Z-score: -3.86E+00 | ||
|
Methylation in Case |
7.73E-01 (Median) | Methylation in Control | 8.69E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 6 |
Methylation of ABCA3 in colorectal cancer | [ 5 ] | |||
|
Location |
Body (cg04058100) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.15E+00 | Statistic Test | p-value: 6.24E-10; Z-score: -4.75E+00 | ||
|
Methylation in Case |
7.74E-01 (Median) | Methylation in Control | 8.90E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 7 |
Methylation of ABCA3 in colorectal cancer | [ 5 ] | |||
|
Location |
Body (cg04149930) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.09E+00 | Statistic Test | p-value: 3.60E-09; Z-score: -2.53E+00 | ||
|
Methylation in Case |
7.92E-01 (Median) | Methylation in Control | 8.65E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 8 |
Methylation of ABCA3 in colorectal cancer | [ 5 ] | |||
|
Location |
Body (cg02715407) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.05E+00 | Statistic Test | p-value: 3.11E-08; Z-score: -2.92E+00 | ||
|
Methylation in Case |
8.58E-01 (Median) | Methylation in Control | 9.00E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 9 |
Methylation of ABCA3 in colorectal cancer | [ 5 ] | |||
|
Location |
Body (cg09481056) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.03E+00 | Statistic Test | p-value: 7.29E-08; Z-score: -2.00E+00 | ||
|
Methylation in Case |
8.79E-01 (Median) | Methylation in Control | 9.10E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 10 |
Methylation of ABCA3 in colorectal cancer | [ 5 ] | |||
|
Location |
Body (cg08490220) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.10E+00 | Statistic Test | p-value: 1.12E-07; Z-score: -1.85E+00 | ||
|
Methylation in Case |
6.99E-01 (Median) | Methylation in Control | 7.71E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 11 |
Methylation of ABCA3 in colorectal cancer | [ 5 ] | |||
|
Location |
Body (cg09945896) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.08E+00 | Statistic Test | p-value: 4.76E-07; Z-score: -3.09E+00 | ||
|
Methylation in Case |
8.12E-01 (Median) | Methylation in Control | 8.73E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 12 |
Methylation of ABCA3 in colorectal cancer | [ 5 ] | |||
|
Location |
Body (cg09681286) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.11E+00 | Statistic Test | p-value: 6.34E-07; Z-score: -1.96E+00 | ||
|
Methylation in Case |
7.85E-01 (Median) | Methylation in Control | 8.73E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 13 |
Methylation of ABCA3 in colorectal cancer | [ 5 ] | |||
|
Location |
Body (cg01550915) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.05E+00 | Statistic Test | p-value: 6.76E-07; Z-score: -1.45E+00 | ||
|
Methylation in Case |
7.99E-01 (Median) | Methylation in Control | 8.38E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 14 |
Methylation of ABCA3 in colorectal cancer | [ 5 ] | |||
|
Location |
Body (cg05218653) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.02E+00 | Statistic Test | p-value: 1.38E-05; Z-score: -1.16E+00 | ||
|
Methylation in Case |
9.53E-01 (Median) | Methylation in Control | 9.69E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 15 |
Methylation of ABCA3 in colorectal cancer | [ 5 ] | |||
|
Location |
Body (cg09954729) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.04E+00 | Statistic Test | p-value: 2.17E-05; Z-score: -1.18E+00 | ||
|
Methylation in Case |
9.06E-01 (Median) | Methylation in Control | 9.39E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 16 |
Methylation of ABCA3 in colorectal cancer | [ 5 ] | |||
|
Location |
Body (cg08131081) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 2.17E-05; Z-score: -1.46E+00 | ||
|
Methylation in Case |
9.33E-01 (Median) | Methylation in Control | 9.44E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 17 |
Methylation of ABCA3 in colorectal cancer | [ 5 ] | |||
|
Location |
Body (cg07301574) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.00E+00 | Statistic Test | p-value: 7.53E-05; Z-score: -5.11E-02 | ||
|
Methylation in Case |
9.17E-01 (Median) | Methylation in Control | 9.17E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 18 |
Methylation of ABCA3 in colorectal cancer | [ 5 ] | |||
|
Location |
Body (cg16463165) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.06E+00 | Statistic Test | p-value: 8.38E-05; Z-score: -1.35E+00 | ||
|
Methylation in Case |
8.07E-01 (Median) | Methylation in Control | 8.51E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 19 |
Methylation of ABCA3 in colorectal cancer | [ 5 ] | |||
|
Location |
Body (cg00039478) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.00E+00 | Statistic Test | p-value: 1.66E-04; Z-score: -4.26E-01 | ||
|
Methylation in Case |
9.07E-01 (Median) | Methylation in Control | 9.11E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 20 |
Methylation of ABCA3 in colorectal cancer | [ 5 ] | |||
|
Location |
Body (cg06780216) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 3.37E-04; Z-score: -1.44E+00 | ||
|
Methylation in Case |
9.42E-01 (Median) | Methylation in Control | 9.53E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 21 |
Methylation of ABCA3 in colorectal cancer | [ 5 ] | |||
|
Location |
Body (cg01278797) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.02E+00 | Statistic Test | p-value: 4.40E-04; Z-score: -2.35E+00 | ||
|
Methylation in Case |
9.16E-01 (Median) | Methylation in Control | 9.33E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 22 |
Methylation of ABCA3 in colorectal cancer | [ 5 ] | |||
|
Location |
Body (cg05814755) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.02E+00 | Statistic Test | p-value: 4.94E-04; Z-score: -1.11E+00 | ||
|
Methylation in Case |
9.15E-01 (Median) | Methylation in Control | 9.31E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 23 |
Methylation of ABCA3 in colorectal cancer | [ 5 ] | |||
|
Location |
Body (cg09263316) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.02E+00 | Statistic Test | p-value: 6.21E-04; Z-score: -5.96E-01 | ||
|
Methylation in Case |
8.85E-01 (Median) | Methylation in Control | 9.03E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 24 |
Methylation of ABCA3 in colorectal cancer | [ 5 ] | |||
|
Location |
Body (cg06933862) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 2.75E-03; Z-score: -8.34E-01 | ||
|
Methylation in Case |
9.52E-01 (Median) | Methylation in Control | 9.58E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 25 |
Methylation of ABCA3 in colorectal cancer | [ 5 ] | |||
|
Location |
Body (cg07701514) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.03E+00 | Statistic Test | p-value: 3.16E-03; Z-score: -6.23E-01 | ||
|
Methylation in Case |
7.78E-01 (Median) | Methylation in Control | 8.02E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 26 |
Methylation of ABCA3 in colorectal cancer | [ 5 ] | |||
|
Location |
Body (cg10125193) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 4.00E-03; Z-score: -6.12E-01 | ||
|
Methylation in Case |
8.93E-01 (Median) | Methylation in Control | 9.04E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 27 |
Methylation of ABCA3 in colorectal cancer | [ 5 ] | |||
|
Location |
Body (cg02257312) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 7.76E-03; Z-score: -8.30E-01 | ||
|
Methylation in Case |
9.27E-01 (Median) | Methylation in Control | 9.35E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 28 |
Methylation of ABCA3 in colorectal cancer | [ 5 ] | |||
|
Location |
Body (cg07753939) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.00E+00 | Statistic Test | p-value: 3.44E-02; Z-score: 2.08E-02 | ||
|
Methylation in Case |
9.65E-01 (Median) | Methylation in Control | 9.64E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 29 |
Methylation of ABCA3 in colorectal cancer | [ 5 ] | |||
|
Location |
Body (cg05824333) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.00E+00 | Statistic Test | p-value: 3.81E-02; Z-score: -7.23E-02 | ||
|
Methylation in Case |
9.66E-01 (Median) | Methylation in Control | 9.67E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 30 |
Methylation of ABCA3 in colorectal cancer | [ 5 ] | |||
|
Location |
Body (cg02124920) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 4.04E-02; Z-score: -2.36E-01 | ||
|
Methylation in Case |
8.90E-01 (Median) | Methylation in Control | 8.96E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 31 |
Methylation of ABCA3 in colorectal cancer | [ 5 ] | |||
|
Location |
3'UTR (cg07737682) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.05E+00 | Statistic Test | p-value: 2.13E-06; Z-score: -2.53E+00 | ||
|
Methylation in Case |
8.39E-01 (Median) | Methylation in Control | 8.77E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 32 |
Methylation of ABCA3 in colorectal cancer | [ 5 ] | |||
|
Location |
3'UTR (cg10154010) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.02E+00 | Statistic Test | p-value: 9.81E-03; Z-score: -9.16E-01 | ||
|
Methylation in Case |
9.27E-01 (Median) | Methylation in Control | 9.45E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 33 |
Methylation of ABCA3 in colorectal cancer | [ 5 ] | |||
|
Location |
3'UTR (cg06335980) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 2.75E-02; Z-score: -2.25E-01 | ||
|
Methylation in Case |
8.34E-01 (Median) | Methylation in Control | 8.40E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Hepatocellular carcinoma |
34 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of ABCA3 in hepatocellular carcinoma | [ 6 ] | |||
|
Location |
5'UTR (cg08900781) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.11E+00 | Statistic Test | p-value: 2.80E-08; Z-score: -2.20E+00 | ||
|
Methylation in Case |
7.65E-01 (Median) | Methylation in Control | 8.47E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of ABCA3 in hepatocellular carcinoma | [ 6 ] | |||
|
Location |
5'UTR (cg04783228) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.07E+00 | Statistic Test | p-value: 5.60E-08; Z-score: -9.48E-01 | ||
|
Methylation in Case |
7.52E-01 (Median) | Methylation in Control | 8.06E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of ABCA3 in hepatocellular carcinoma | [ 6 ] | |||
|
Location |
5'UTR (cg02543796) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 5.69E-04; Z-score: -7.48E-01 | ||
|
Methylation in Case |
8.09E-01 (Median) | Methylation in Control | 8.21E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of ABCA3 in hepatocellular carcinoma | [ 6 ] | |||
|
Location |
TSS200 (cg13286281) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.94E+00 | Statistic Test | p-value: 2.28E-10; Z-score: 4.15E+00 | ||
|
Methylation in Case |
2.92E-01 (Median) | Methylation in Control | 1.50E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of ABCA3 in hepatocellular carcinoma | [ 6 ] | |||
|
Location |
Body (cg02883668) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.72E+00 | Statistic Test | p-value: 1.33E-17; Z-score: -2.57E+00 | ||
|
Methylation in Case |
2.20E-01 (Median) | Methylation in Control | 3.79E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 6 |
Methylation of ABCA3 in hepatocellular carcinoma | [ 6 ] | |||
|
Location |
Body (cg10246871) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.52E+00 | Statistic Test | p-value: 3.82E-17; Z-score: -1.33E+01 | ||
|
Methylation in Case |
5.68E-01 (Median) | Methylation in Control | 8.65E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 7 |
Methylation of ABCA3 in hepatocellular carcinoma | [ 6 ] | |||
|
Location |
Body (cg16455444) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.92E+00 | Statistic Test | p-value: 1.38E-16; Z-score: -6.12E+00 | ||
|
Methylation in Case |
3.08E-01 (Median) | Methylation in Control | 5.92E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 8 |
Methylation of ABCA3 in hepatocellular carcinoma | [ 6 ] | |||
|
Location |
Body (cg23093692) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.62E+00 | Statistic Test | p-value: 2.04E-16; Z-score: -4.02E+00 | ||
|
Methylation in Case |
4.77E-01 (Median) | Methylation in Control | 7.73E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 9 |
Methylation of ABCA3 in hepatocellular carcinoma | [ 6 ] | |||
|
Location |
Body (cg16535035) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.51E+00 | Statistic Test | p-value: 1.33E-15; Z-score: -4.82E+00 | ||
|
Methylation in Case |
5.04E-01 (Median) | Methylation in Control | 7.61E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 10 |
Methylation of ABCA3 in hepatocellular carcinoma | [ 6 ] | |||
|
Location |
Body (cg17655346) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.42E+00 | Statistic Test | p-value: 6.87E-14; Z-score: -6.11E+00 | ||
|
Methylation in Case |
5.54E-01 (Median) | Methylation in Control | 7.88E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 11 |
Methylation of ABCA3 in hepatocellular carcinoma | [ 6 ] | |||
|
Location |
Body (cg02287939) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.27E+00 | Statistic Test | p-value: 5.21E-12; Z-score: -1.58E+01 | ||
|
Methylation in Case |
7.66E-01 (Median) | Methylation in Control | 9.75E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 12 |
Methylation of ABCA3 in hepatocellular carcinoma | [ 6 ] | |||
|
Location |
Body (cg04912273) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.08E+00 | Statistic Test | p-value: 5.86E-12; Z-score: 1.59E+00 | ||
|
Methylation in Case |
7.61E-01 (Median) | Methylation in Control | 7.03E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 13 |
Methylation of ABCA3 in hepatocellular carcinoma | [ 6 ] | |||
|
Location |
Body (cg16523422) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.29E+00 | Statistic Test | p-value: 4.67E-11; Z-score: -2.97E+00 | ||
|
Methylation in Case |
6.21E-01 (Median) | Methylation in Control | 8.01E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 14 |
Methylation of ABCA3 in hepatocellular carcinoma | [ 6 ] | |||
|
Location |
Body (cg10810847) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.91E+00 | Statistic Test | p-value: 1.01E-10; Z-score: 5.49E+00 | ||
|
Methylation in Case |
3.46E-01 (Median) | Methylation in Control | 1.82E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 15 |
Methylation of ABCA3 in hepatocellular carcinoma | [ 6 ] | |||
|
Location |
Body (cg08943004) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.12E+00 | Statistic Test | p-value: 1.41E-10; Z-score: -6.28E+00 | ||
|
Methylation in Case |
8.52E-01 (Median) | Methylation in Control | 9.55E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 16 |
Methylation of ABCA3 in hepatocellular carcinoma | [ 6 ] | |||
|
Location |
Body (cg02715407) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.19E+00 | Statistic Test | p-value: 2.34E-09; Z-score: -3.42E+00 | ||
|
Methylation in Case |
6.50E-01 (Median) | Methylation in Control | 7.71E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 17 |
Methylation of ABCA3 in hepatocellular carcinoma | [ 6 ] | |||
|
Location |
Body (cg02257312) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.14E+00 | Statistic Test | p-value: 3.18E-09; Z-score: -5.03E+00 | ||
|
Methylation in Case |
7.61E-01 (Median) | Methylation in Control | 8.67E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 18 |
Methylation of ABCA3 in hepatocellular carcinoma | [ 6 ] | |||
|
Location |
Body (cg09263316) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.16E+00 | Statistic Test | p-value: 1.44E-08; Z-score: -2.00E+00 | ||
|
Methylation in Case |
6.85E-01 (Median) | Methylation in Control | 7.95E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 19 |
Methylation of ABCA3 in hepatocellular carcinoma | [ 6 ] | |||
|
Location |
Body (cg01278797) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.12E+00 | Statistic Test | p-value: 2.17E-08; Z-score: -3.17E+00 | ||
|
Methylation in Case |
7.63E-01 (Median) | Methylation in Control | 8.55E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 20 |
Methylation of ABCA3 in hepatocellular carcinoma | [ 6 ] | |||
|
Location |
Body (cg05093254) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.08E+00 | Statistic Test | p-value: 4.27E-08; Z-score: -6.51E+00 | ||
|
Methylation in Case |
9.02E-01 (Median) | Methylation in Control | 9.71E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 21 |
Methylation of ABCA3 in hepatocellular carcinoma | [ 6 ] | |||
|
Location |
Body (cg10125193) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.12E+00 | Statistic Test | p-value: 8.33E-08; Z-score: -2.73E+00 | ||
|
Methylation in Case |
7.31E-01 (Median) | Methylation in Control | 8.22E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 22 |
Methylation of ABCA3 in hepatocellular carcinoma | [ 6 ] | |||
|
Location |
Body (cg05824333) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.04E+00 | Statistic Test | p-value: 4.26E-07; Z-score: -4.04E+00 | ||
|
Methylation in Case |
9.16E-01 (Median) | Methylation in Control | 9.54E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 23 |
Methylation of ABCA3 in hepatocellular carcinoma | [ 6 ] | |||
|
Location |
Body (cg05814755) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.05E+00 | Statistic Test | p-value: 5.10E-07; Z-score: -1.59E+00 | ||
|
Methylation in Case |
7.86E-01 (Median) | Methylation in Control | 8.28E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 24 |
Methylation of ABCA3 in hepatocellular carcinoma | [ 6 ] | |||
|
Location |
Body (cg07301574) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.06E+00 | Statistic Test | p-value: 1.31E-06; Z-score: -2.42E+00 | ||
|
Methylation in Case |
7.41E-01 (Median) | Methylation in Control | 7.86E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 25 |
Methylation of ABCA3 in hepatocellular carcinoma | [ 6 ] | |||
|
Location |
Body (cg09632163) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.03E+00 | Statistic Test | p-value: 2.00E-06; Z-score: -1.63E+00 | ||
|
Methylation in Case |
9.24E-01 (Median) | Methylation in Control | 9.54E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 26 |
Methylation of ABCA3 in hepatocellular carcinoma | [ 6 ] | |||
|
Location |
Body (cg09481056) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.07E+00 | Statistic Test | p-value: 2.10E-06; Z-score: -1.42E+00 | ||
|
Methylation in Case |
7.62E-01 (Median) | Methylation in Control | 8.15E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 27 |
Methylation of ABCA3 in hepatocellular carcinoma | [ 6 ] | |||
|
Location |
Body (cg08449748) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.10E+00 | Statistic Test | p-value: 2.10E-06; Z-score: -1.45E+00 | ||
|
Methylation in Case |
6.72E-01 (Median) | Methylation in Control | 7.37E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 28 |
Methylation of ABCA3 in hepatocellular carcinoma | [ 6 ] | |||
|
Location |
Body (cg07753939) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.04E+00 | Statistic Test | p-value: 3.28E-06; Z-score: -7.80E-01 | ||
|
Methylation in Case |
9.30E-01 (Median) | Methylation in Control | 9.63E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 29 |
Methylation of ABCA3 in hepatocellular carcinoma | [ 6 ] | |||
|
Location |
Body (cg05147509) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.05E+00 | Statistic Test | p-value: 5.36E-05; Z-score: -3.96E-01 | ||
|
Methylation in Case |
7.78E-01 (Median) | Methylation in Control | 8.19E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 30 |
Methylation of ABCA3 in hepatocellular carcinoma | [ 6 ] | |||
|
Location |
Body (cg01491428) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.49E+00 | Statistic Test | p-value: 2.95E-04; Z-score: -7.03E-01 | ||
|
Methylation in Case |
3.66E-01 (Median) | Methylation in Control | 5.45E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 31 |
Methylation of ABCA3 in hepatocellular carcinoma | [ 6 ] | |||
|
Location |
Body (cg00039478) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.02E+00 | Statistic Test | p-value: 1.90E-03; Z-score: -1.69E-01 | ||
|
Methylation in Case |
7.61E-01 (Median) | Methylation in Control | 7.78E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 32 |
Methylation of ABCA3 in hepatocellular carcinoma | [ 6 ] | |||
|
Location |
Body (cg20915212) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.01E+00 | Statistic Test | p-value: 2.95E-02; Z-score: 2.01E-01 | ||
|
Methylation in Case |
6.88E-01 (Median) | Methylation in Control | 6.82E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 33 |
Methylation of ABCA3 in hepatocellular carcinoma | [ 6 ] | |||
|
Location |
3'UTR (cg07737682) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.17E+00 | Statistic Test | p-value: 3.72E-08; Z-score: -3.19E+00 | ||
|
Methylation in Case |
5.84E-01 (Median) | Methylation in Control | 6.84E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 34 |
Methylation of ABCA3 in hepatocellular carcinoma | [ 6 ] | |||
|
Location |
3'UTR (cg10154010) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 2.21E-04; Z-score: -2.84E-01 | ||
|
Methylation in Case |
8.90E-01 (Median) | Methylation in Control | 9.01E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
HIV infection |
16 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of ABCA3 in HIV infection | [ 7 ] | |||
|
Location |
5'UTR (cg06250288) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.04E+00 | Statistic Test | p-value: 3.41E-03; Z-score: -1.03E+00 | ||
|
Methylation in Case |
7.96E-01 (Median) | Methylation in Control | 8.25E-01 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of ABCA3 in HIV infection | [ 7 ] | |||
|
Location |
5'UTR (cg08644341) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.02E+00 | Statistic Test | p-value: 8.18E-03; Z-score: -7.14E-01 | ||
|
Methylation in Case |
9.05E-01 (Median) | Methylation in Control | 9.20E-01 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of ABCA3 in HIV infection | [ 7 ] | |||
|
Location |
Body (cg09481056) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.19E+00 | Statistic Test | p-value: 3.22E-18; Z-score: 3.15E+00 | ||
|
Methylation in Case |
8.08E-01 (Median) | Methylation in Control | 6.81E-01 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of ABCA3 in HIV infection | [ 7 ] | |||
|
Location |
Body (cg10125193) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.03E+00 | Statistic Test | p-value: 1.38E-07; Z-score: 1.04E+00 | ||
|
Methylation in Case |
8.62E-01 (Median) | Methylation in Control | 8.37E-01 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of ABCA3 in HIV infection | [ 7 ] | |||
|
Location |
Body (cg08449748) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.07E+00 | Statistic Test | p-value: 6.68E-07; Z-score: 1.41E+00 | ||
|
Methylation in Case |
7.90E-01 (Median) | Methylation in Control | 7.40E-01 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 6 |
Methylation of ABCA3 in HIV infection | [ 7 ] | |||
|
Location |
Body (cg09263316) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.05E+00 | Statistic Test | p-value: 1.38E-06; Z-score: -1.85E+00 | ||
|
Methylation in Case |
8.66E-01 (Median) | Methylation in Control | 9.06E-01 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 7 |
Methylation of ABCA3 in HIV infection | [ 7 ] | |||
|
Location |
Body (cg05147509) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.03E+00 | Statistic Test | p-value: 2.63E-04; Z-score: 7.71E-01 | ||
|
Methylation in Case |
8.61E-01 (Median) | Methylation in Control | 8.37E-01 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 8 |
Methylation of ABCA3 in HIV infection | [ 7 ] | |||
|
Location |
Body (cg08490220) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.05E+00 | Statistic Test | p-value: 2.71E-04; Z-score: -1.59E+00 | ||
|
Methylation in Case |
7.48E-01 (Median) | Methylation in Control | 7.87E-01 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 9 |
Methylation of ABCA3 in HIV infection | [ 7 ] | |||
|
Location |
Body (cg02715407) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.03E+00 | Statistic Test | p-value: 3.08E-03; Z-score: -8.01E-01 | ||
|
Methylation in Case |
8.25E-01 (Median) | Methylation in Control | 8.46E-01 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 10 |
Methylation of ABCA3 in HIV infection | [ 7 ] | |||
|
Location |
Body (cg05093254) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.00E+00 | Statistic Test | p-value: 4.88E-03; Z-score: -8.67E-01 | ||
|
Methylation in Case |
9.91E-01 (Median) | Methylation in Control | 9.94E-01 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 11 |
Methylation of ABCA3 in HIV infection | [ 7 ] | |||
|
Location |
Body (cg04058100) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.03E+00 | Statistic Test | p-value: 1.16E-02; Z-score: -1.08E+00 | ||
|
Methylation in Case |
8.63E-01 (Median) | Methylation in Control | 8.90E-01 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 12 |
Methylation of ABCA3 in HIV infection | [ 7 ] | |||
|
Location |
Body (cg07753939) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.00E+00 | Statistic Test | p-value: 1.56E-02; Z-score: 4.64E-01 | ||
|
Methylation in Case |
9.81E-01 (Median) | Methylation in Control | 9.76E-01 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 13 |
Methylation of ABCA3 in HIV infection | [ 7 ] | |||
|
Location |
Body (cg07301574) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.01E+00 | Statistic Test | p-value: 1.65E-02; Z-score: 3.87E-01 | ||
|
Methylation in Case |
8.31E-01 (Median) | Methylation in Control | 8.23E-01 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 14 |
Methylation of ABCA3 in HIV infection | [ 7 ] | |||
|
Location |
Body (cg09632163) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.01E+00 | Statistic Test | p-value: 1.92E-02; Z-score: 6.66E-01 | ||
|
Methylation in Case |
9.37E-01 (Median) | Methylation in Control | 9.25E-01 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 15 |
Methylation of ABCA3 in HIV infection | [ 7 ] | |||
|
Location |
Body (cg19754709) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.02E+00 | Statistic Test | p-value: 2.57E-02; Z-score: -7.62E-01 | ||
|
Methylation in Case |
8.13E-01 (Median) | Methylation in Control | 8.33E-01 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 16 |
Methylation of ABCA3 in HIV infection | [ 7 ] | |||
|
Location |
Body (cg05218653) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.00E+00 | Statistic Test | p-value: 4.36E-02; Z-score: -1.61E-01 | ||
|
Methylation in Case |
9.91E-01 (Median) | Methylation in Control | 9.91E-01 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Lung adenocarcinoma |
13 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of ABCA3 in lung adenocarcinoma | [ 8 ] | |||
|
Location |
5'UTR (cg08900781) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.07E+00 | Statistic Test | p-value: 5.86E-03; Z-score: 1.65E+00 | ||
|
Methylation in Case |
8.44E-01 (Median) | Methylation in Control | 7.90E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of ABCA3 in lung adenocarcinoma | [ 8 ] | |||
|
Location |
5'UTR (cg02543796) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.04E+00 | Statistic Test | p-value: 2.67E-02; Z-score: 7.42E-01 | ||
|
Methylation in Case |
8.06E-01 (Median) | Methylation in Control | 7.76E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of ABCA3 in lung adenocarcinoma | [ 8 ] | |||
|
Location |
Body (cg19754709) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.06E+00 | Statistic Test | p-value: 1.03E-03; Z-score: -2.07E+00 | ||
|
Methylation in Case |
7.77E-01 (Median) | Methylation in Control | 8.21E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of ABCA3 in lung adenocarcinoma | [ 8 ] | |||
|
Location |
Body (cg08449748) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.08E+00 | Statistic Test | p-value: 4.89E-03; Z-score: 1.29E+00 | ||
|
Methylation in Case |
7.48E-01 (Median) | Methylation in Control | 6.94E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of ABCA3 in lung adenocarcinoma | [ 8 ] | |||
|
Location |
Body (cg09263316) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.06E+00 | Statistic Test | p-value: 6.69E-03; Z-score: -3.41E+00 | ||
|
Methylation in Case |
8.30E-01 (Median) | Methylation in Control | 8.77E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 6 |
Methylation of ABCA3 in lung adenocarcinoma | [ 8 ] | |||
|
Location |
Body (cg07753939) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.06E+00 | Statistic Test | p-value: 6.87E-03; Z-score: 1.87E+00 | ||
|
Methylation in Case |
9.21E-01 (Median) | Methylation in Control | 8.69E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 7 |
Methylation of ABCA3 in lung adenocarcinoma | [ 8 ] | |||
|
Location |
Body (cg04058100) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.08E+00 | Statistic Test | p-value: 8.98E-03; Z-score: -6.39E+00 | ||
|
Methylation in Case |
7.90E-01 (Median) | Methylation in Control | 8.54E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 8 |
Methylation of ABCA3 in lung adenocarcinoma | [ 8 ] | |||
|
Location |
Body (cg04149930) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.10E+00 | Statistic Test | p-value: 1.53E-02; Z-score: -3.35E+00 | ||
|
Methylation in Case |
7.40E-01 (Median) | Methylation in Control | 8.18E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 9 |
Methylation of ABCA3 in lung adenocarcinoma | [ 8 ] | |||
|
Location |
Body (cg00644103) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.04E+00 | Statistic Test | p-value: 2.69E-02; Z-score: -2.48E+00 | ||
|
Methylation in Case |
8.04E-01 (Median) | Methylation in Control | 8.34E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 10 |
Methylation of ABCA3 in lung adenocarcinoma | [ 8 ] | |||
|
Location |
Body (cg07701514) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.05E+00 | Statistic Test | p-value: 3.36E-02; Z-score: 8.23E-01 | ||
|
Methylation in Case |
7.94E-01 (Median) | Methylation in Control | 7.58E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 11 |
Methylation of ABCA3 in lung adenocarcinoma | [ 8 ] | |||
|
Location |
Body (cg06933862) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 3.75E-02; Z-score: -8.77E-01 | ||
|
Methylation in Case |
9.20E-01 (Median) | Methylation in Control | 9.27E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 12 |
Methylation of ABCA3 in lung adenocarcinoma | [ 8 ] | |||
|
Location |
Body (cg09954729) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.02E+00 | Statistic Test | p-value: 3.82E-02; Z-score: -1.95E+00 | ||
|
Methylation in Case |
9.45E-01 (Median) | Methylation in Control | 9.60E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 13 |
Methylation of ABCA3 in lung adenocarcinoma | [ 8 ] | |||
|
Location |
Body (cg01278797) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.02E+00 | Statistic Test | p-value: 4.07E-02; Z-score: -1.09E+00 | ||
|
Methylation in Case |
8.68E-01 (Median) | Methylation in Control | 8.85E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Panic disorder |
4 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of ABCA3 in panic disorder | [ 9 ] | |||
|
Location |
5'UTR (cg08900781) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.05E+00 | Statistic Test | p-value: 2.83E-02; Z-score: 3.79E-01 | ||
|
Methylation in Case |
3.67E+00 (Median) | Methylation in Control | 3.50E+00 (Median) | ||
|
Studied Phenotype |
Panic disorder [ ICD-11: 6B01] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of ABCA3 in panic disorder | [ 9 ] | |||
|
Location |
Body (cg06933862) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.04E+00 | Statistic Test | p-value: 7.79E-03; Z-score: -4.72E-01 | ||
|
Methylation in Case |
4.53E+00 (Median) | Methylation in Control | 4.69E+00 (Median) | ||
|
Studied Phenotype |
Panic disorder [ ICD-11: 6B01] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of ABCA3 in panic disorder | [ 9 ] | |||
|
Location |
Body (cg16463165) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.12E+00 | Statistic Test | p-value: 1.35E-02; Z-score: 3.92E-01 | ||
|
Methylation in Case |
1.86E+00 (Median) | Methylation in Control | 1.67E+00 (Median) | ||
|
Studied Phenotype |
Panic disorder [ ICD-11: 6B01] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of ABCA3 in panic disorder | [ 9 ] | |||
|
Location |
Body (cg00039478) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.11E+00 | Statistic Test | p-value: 2.12E-02; Z-score: 4.64E-01 | ||
|
Methylation in Case |
1.72E+00 (Median) | Methylation in Control | 1.55E+00 (Median) | ||
|
Studied Phenotype |
Panic disorder [ ICD-11: 6B01] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Papillary thyroid cancer |
13 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of ABCA3 in papillary thyroid cancer | [ 10 ] | |||
|
Location |
5'UTR (cg08900781) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.15E+00 | Statistic Test | p-value: 6.08E-06; Z-score: -1.33E+00 | ||
|
Methylation in Case |
6.99E-01 (Median) | Methylation in Control | 8.03E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of ABCA3 in papillary thyroid cancer | [ 10 ] | |||
|
Location |
Body (cg05147509) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.07E+00 | Statistic Test | p-value: 2.80E-07; Z-score: 1.51E+00 | ||
|
Methylation in Case |
8.19E-01 (Median) | Methylation in Control | 7.69E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of ABCA3 in papillary thyroid cancer | [ 10 ] | |||
|
Location |
Body (cg00039478) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.02E+00 | Statistic Test | p-value: 1.01E-04; Z-score: -7.42E-01 | ||
|
Methylation in Case |
8.36E-01 (Median) | Methylation in Control | 8.54E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of ABCA3 in papillary thyroid cancer | [ 10 ] | |||
|
Location |
Body (cg08131081) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 3.41E-04; Z-score: -9.00E-01 | ||
|
Methylation in Case |
9.09E-01 (Median) | Methylation in Control | 9.20E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of ABCA3 in papillary thyroid cancer | [ 10 ] | |||
|
Location |
Body (cg02124920) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.02E+00 | Statistic Test | p-value: 4.74E-04; Z-score: 4.64E-01 | ||
|
Methylation in Case |
8.25E-01 (Median) | Methylation in Control | 8.12E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 6 |
Methylation of ABCA3 in papillary thyroid cancer | [ 10 ] | |||
|
Location |
Body (cg06780216) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.02E+00 | Statistic Test | p-value: 6.22E-04; Z-score: 7.52E-01 | ||
|
Methylation in Case |
8.93E-01 (Median) | Methylation in Control | 8.74E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 7 |
Methylation of ABCA3 in papillary thyroid cancer | [ 10 ] | |||
|
Location |
Body (cg02715407) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 3.93E-03; Z-score: -4.68E-01 | ||
|
Methylation in Case |
8.76E-01 (Median) | Methylation in Control | 8.86E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 8 |
Methylation of ABCA3 in papillary thyroid cancer | [ 10 ] | |||
|
Location |
Body (cg08490220) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.02E+00 | Statistic Test | p-value: 6.46E-03; Z-score: -5.25E-01 | ||
|
Methylation in Case |
7.60E-01 (Median) | Methylation in Control | 7.76E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 9 |
Methylation of ABCA3 in papillary thyroid cancer | [ 10 ] | |||
|
Location |
Body (cg01278797) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 1.07E-02; Z-score: -6.58E-01 | ||
|
Methylation in Case |
9.09E-01 (Median) | Methylation in Control | 9.20E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 10 |
Methylation of ABCA3 in papillary thyroid cancer | [ 10 ] | |||
|
Location |
Body (cg07753939) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.01E+00 | Statistic Test | p-value: 1.34E-02; Z-score: 3.57E-01 | ||
|
Methylation in Case |
9.14E-01 (Median) | Methylation in Control | 9.08E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 11 |
Methylation of ABCA3 in papillary thyroid cancer | [ 10 ] | |||
|
Location |
Body (cg16463165) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.03E+00 | Statistic Test | p-value: 1.45E-02; Z-score: 5.40E-01 | ||
|
Methylation in Case |
7.37E-01 (Median) | Methylation in Control | 7.13E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 12 |
Methylation of ABCA3 in papillary thyroid cancer | [ 10 ] | |||
|
Location |
Body (cg04149930) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 2.76E-02; Z-score: -1.94E-01 | ||
|
Methylation in Case |
9.05E-01 (Median) | Methylation in Control | 9.11E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 13 |
Methylation of ABCA3 in papillary thyroid cancer | [ 10 ] | |||
|
Location |
Body (cg08449748) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.04E+00 | Statistic Test | p-value: 2.88E-02; Z-score: 5.42E-01 | ||
|
Methylation in Case |
7.50E-01 (Median) | Methylation in Control | 7.21E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Systemic lupus erythematosus |
11 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of ABCA3 in systemic lupus erythematosus | [ 11 ] | |||
|
Location |
5'UTR (cg06250288) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 1.76E-03; Z-score: -1.18E-01 | ||
|
Methylation in Case |
8.22E-01 (Median) | Methylation in Control | 8.27E-01 (Median) | ||
|
Studied Phenotype |
Systemic lupus erythematosus [ ICD-11: 4A40.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of ABCA3 in systemic lupus erythematosus | [ 11 ] | |||
|
Location |
5'UTR (cg08644341) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.00E+00 | Statistic Test | p-value: 2.90E-02; Z-score: -1.21E-01 | ||
|
Methylation in Case |
8.96E-01 (Median) | Methylation in Control | 9.00E-01 (Median) | ||
|
Studied Phenotype |
Systemic lupus erythematosus [ ICD-11: 4A40.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of ABCA3 in systemic lupus erythematosus | [ 11 ] | |||
|
Location |
Body (cg09632163) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.00E+00 | Statistic Test | p-value: 5.54E-03; Z-score: -1.46E-01 | ||
|
Methylation in Case |
9.28E-01 (Median) | Methylation in Control | 9.31E-01 (Median) | ||
|
Studied Phenotype |
Systemic lupus erythematosus [ ICD-11: 4A40.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of ABCA3 in systemic lupus erythematosus | [ 11 ] | |||
|
Location |
Body (cg04058100) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 5.84E-03; Z-score: -2.33E-01 | ||
|
Methylation in Case |
8.50E-01 (Median) | Methylation in Control | 8.61E-01 (Median) | ||
|
Studied Phenotype |
Systemic lupus erythematosus [ ICD-11: 4A40.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of ABCA3 in systemic lupus erythematosus | [ 11 ] | |||
|
Location |
Body (cg08322747) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.00E+00 | Statistic Test | p-value: 8.42E-03; Z-score: -2.02E-01 | ||
|
Methylation in Case |
9.62E-01 (Median) | Methylation in Control | 9.64E-01 (Median) | ||
|
Studied Phenotype |
Systemic lupus erythematosus [ ICD-11: 4A40.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 6 |
Methylation of ABCA3 in systemic lupus erythematosus | [ 11 ] | |||
|
Location |
Body (cg01491428) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 9.47E-03; Z-score: -7.72E-02 | ||
|
Methylation in Case |
8.16E-01 (Median) | Methylation in Control | 8.28E-01 (Median) | ||
|
Studied Phenotype |
Systemic lupus erythematosus [ ICD-11: 4A40.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 7 |
Methylation of ABCA3 in systemic lupus erythematosus | [ 11 ] | |||
|
Location |
Body (cg01278797) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 1.46E-02; Z-score: -1.94E-01 | ||
|
Methylation in Case |
8.95E-01 (Median) | Methylation in Control | 9.00E-01 (Median) | ||
|
Studied Phenotype |
Systemic lupus erythematosus [ ICD-11: 4A40.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 8 |
Methylation of ABCA3 in systemic lupus erythematosus | [ 11 ] | |||
|
Location |
Body (cg02715407) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 2.92E-02; Z-score: -1.89E-01 | ||
|
Methylation in Case |
8.39E-01 (Median) | Methylation in Control | 8.49E-01 (Median) | ||
|
Studied Phenotype |
Systemic lupus erythematosus [ ICD-11: 4A40.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 9 |
Methylation of ABCA3 in systemic lupus erythematosus | [ 11 ] | |||
|
Location |
Body (cg02257312) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.00E+00 | Statistic Test | p-value: 3.45E-02; Z-score: -2.02E-01 | ||
|
Methylation in Case |
9.21E-01 (Median) | Methylation in Control | 9.25E-01 (Median) | ||
|
Studied Phenotype |
Systemic lupus erythematosus [ ICD-11: 4A40.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 10 |
Methylation of ABCA3 in systemic lupus erythematosus | [ 11 ] | |||
|
Location |
Body (cg06780216) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.00E+00 | Statistic Test | p-value: 4.29E-02; Z-score: -8.84E-02 | ||
|
Methylation in Case |
9.44E-01 (Median) | Methylation in Control | 9.45E-01 (Median) | ||
|
Studied Phenotype |
Systemic lupus erythematosus [ ICD-11: 4A40.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 11 |
Methylation of ABCA3 in systemic lupus erythematosus | [ 11 ] | |||
|
Location |
3'UTR (cg07737682) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 4.52E-02; Z-score: -1.94E-01 | ||
|
Methylation in Case |
8.28E-01 (Median) | Methylation in Control | 8.36E-01 (Median) | ||
|
Studied Phenotype |
Systemic lupus erythematosus [ ICD-11: 4A40.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Pancretic ductal adenocarcinoma |
18 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of ABCA3 in pancretic ductal adenocarcinoma | [ 12 ] | |||
|
Location |
TSS1500 (cg18290624) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.71E+00 | Statistic Test | p-value: 7.35E-12; Z-score: 2.34E+00 | ||
|
Methylation in Case |
4.46E-01 (Median) | Methylation in Control | 2.61E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of ABCA3 in pancretic ductal adenocarcinoma | [ 12 ] | |||
|
Location |
TSS1500 (cg23338195) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.07E+00 | Statistic Test | p-value: 4.82E-06; Z-score: -7.51E-01 | ||
|
Methylation in Case |
6.34E-01 (Median) | Methylation in Control | 6.78E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of ABCA3 in pancretic ductal adenocarcinoma | [ 12 ] | |||
|
Location |
TSS1500 (cg14762670) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.10E+00 | Statistic Test | p-value: 1.30E-03; Z-score: -7.29E-01 | ||
|
Methylation in Case |
3.32E-01 (Median) | Methylation in Control | 3.65E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of ABCA3 in pancretic ductal adenocarcinoma | [ 12 ] | |||
|
Location |
TSS1500 (cg21762534) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.22E+00 | Statistic Test | p-value: 2.44E-03; Z-score: -6.99E-01 | ||
|
Methylation in Case |
9.11E-02 (Median) | Methylation in Control | 1.12E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of ABCA3 in pancretic ductal adenocarcinoma | [ 12 ] | |||
|
Location |
TSS1500 (cg15916061) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.20E+00 | Statistic Test | p-value: 1.20E-02; Z-score: 9.51E-01 | ||
|
Methylation in Case |
5.42E-01 (Median) | Methylation in Control | 4.53E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 6 |
Methylation of ABCA3 in pancretic ductal adenocarcinoma | [ 12 ] | |||
|
Location |
TSS1500 (cg23053624) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.06E+00 | Statistic Test | p-value: 1.68E-02; Z-score: -3.17E-01 | ||
|
Methylation in Case |
8.11E-02 (Median) | Methylation in Control | 8.61E-02 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 7 |
Methylation of ABCA3 in pancretic ductal adenocarcinoma | [ 12 ] | |||
|
Location |
TSS200 (cg18555069) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.64E+00 | Statistic Test | p-value: 3.66E-16; Z-score: 1.95E+00 | ||
|
Methylation in Case |
4.71E-02 (Median) | Methylation in Control | 2.88E-02 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 8 |
Methylation of ABCA3 in pancretic ductal adenocarcinoma | [ 12 ] | |||
|
Location |
TSS200 (cg23825213) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.11E+00 | Statistic Test | p-value: 3.52E-04; Z-score: 9.10E-01 | ||
|
Methylation in Case |
6.86E-01 (Median) | Methylation in Control | 6.20E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 9 |
Methylation of ABCA3 in pancretic ductal adenocarcinoma | [ 12 ] | |||
|
Location |
Body (cg19980199) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.18E+00 | Statistic Test | p-value: 7.91E-10; Z-score: 1.83E+00 | ||
|
Methylation in Case |
7.72E-01 (Median) | Methylation in Control | 6.56E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 10 |
Methylation of ABCA3 in pancretic ductal adenocarcinoma | [ 12 ] | |||
|
Location |
Body (cg02079831) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.11E+00 | Statistic Test | p-value: 1.65E-06; Z-score: 5.89E-01 | ||
|
Methylation in Case |
2.84E-01 (Median) | Methylation in Control | 2.57E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 11 |
Methylation of ABCA3 in pancretic ductal adenocarcinoma | [ 12 ] | |||
|
Location |
Body (cg18445760) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.06E+00 | Statistic Test | p-value: 1.77E-05; Z-score: 9.44E-01 | ||
|
Methylation in Case |
8.36E-01 (Median) | Methylation in Control | 7.88E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 12 |
Methylation of ABCA3 in pancretic ductal adenocarcinoma | [ 12 ] | |||
|
Location |
Body (cg04524933) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.06E+00 | Statistic Test | p-value: 2.12E-04; Z-score: 8.81E-01 | ||
|
Methylation in Case |
9.10E-01 (Median) | Methylation in Control | 8.57E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 13 |
Methylation of ABCA3 in pancretic ductal adenocarcinoma | [ 12 ] | |||
|
Location |
Body (cg26090940) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.13E+00 | Statistic Test | p-value: 3.80E-03; Z-score: 7.49E-01 | ||
|
Methylation in Case |
6.41E-01 (Median) | Methylation in Control | 5.69E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 14 |
Methylation of ABCA3 in pancretic ductal adenocarcinoma | [ 12 ] | |||
|
Location |
Body (cg07396272) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.07E+00 | Statistic Test | p-value: 8.72E-03; Z-score: 1.07E+00 | ||
|
Methylation in Case |
8.13E-01 (Median) | Methylation in Control | 7.62E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 15 |
Methylation of ABCA3 in pancretic ductal adenocarcinoma | [ 12 ] | |||
|
Location |
Body (cg11977139) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 1.10E-02; Z-score: -4.47E-01 | ||
|
Methylation in Case |
8.62E-01 (Median) | Methylation in Control | 8.74E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 16 |
Methylation of ABCA3 in pancretic ductal adenocarcinoma | [ 12 ] | |||
|
Location |
Body (cg06342870) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.00E+00 | Statistic Test | p-value: 1.44E-02; Z-score: -3.75E-01 | ||
|
Methylation in Case |
9.09E-01 (Median) | Methylation in Control | 9.13E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 17 |
Methylation of ABCA3 in pancretic ductal adenocarcinoma | [ 12 ] | |||
|
Location |
Body (cg00153543) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.00E+00 | Statistic Test | p-value: 4.89E-02; Z-score: -4.40E-03 | ||
|
Methylation in Case |
6.90E-01 (Median) | Methylation in Control | 6.90E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 18 |
Methylation of ABCA3 in pancretic ductal adenocarcinoma | [ 12 ] | |||
|
Location |
3'UTR (cg20733663) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.03E+00 | Statistic Test | p-value: 1.48E-04; Z-score: -5.69E-01 | ||
|
Methylation in Case |
5.73E-01 (Median) | Methylation in Control | 5.92E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Prostate cancer |
4 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of ABCA3 in prostate cancer | [ 13 ] | |||
|
Location |
TSS1500 (cg09941770) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 2.50E+00 | Statistic Test | p-value: 2.66E-02; Z-score: 1.44E+01 | ||
|
Methylation in Case |
2.47E-01 (Median) | Methylation in Control | 9.89E-02 (Median) | ||
|
Studied Phenotype |
Prostate cancer [ ICD-11: 2C82] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of ABCA3 in prostate cancer | [ 13 ] | |||
|
Location |
TSS200 (cg16552454) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 2.39E+00 | Statistic Test | p-value: 1.28E-03; Z-score: 3.95E+01 | ||
|
Methylation in Case |
6.05E-01 (Median) | Methylation in Control | 2.53E-01 (Median) | ||
|
Studied Phenotype |
Prostate cancer [ ICD-11: 2C82] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of ABCA3 in prostate cancer | [ 13 ] | |||
|
Location |
Body (cg09226986) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.58E+00 | Statistic Test | p-value: 1.94E-03; Z-score: 3.49E+00 | ||
|
Methylation in Case |
7.89E-01 (Median) | Methylation in Control | 5.01E-01 (Median) | ||
|
Studied Phenotype |
Prostate cancer [ ICD-11: 2C82] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of ABCA3 in prostate cancer | [ 13 ] | |||
|
Location |
Body (cg15992711) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.31E+00 | Statistic Test | p-value: 3.10E-02; Z-score: -5.41E+00 | ||
|
Methylation in Case |
4.00E-01 (Median) | Methylation in Control | 5.24E-01 (Median) | ||
|
Studied Phenotype |
Prostate cancer [ ICD-11: 2C82] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Renal cell carcinoma |
11 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of ABCA3 in clear cell renal cell carcinoma | [ 14 ] | |||
|
Location |
Body (cg05147509) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.08E+00 | Statistic Test | p-value: 6.08E-16; Z-score: 2.64E+00 | ||
|
Methylation in Case |
8.71E-01 (Median) | Methylation in Control | 8.04E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of ABCA3 in clear cell renal cell carcinoma | [ 14 ] | |||
|
Location |
Body (cg10125193) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.03E+00 | Statistic Test | p-value: 7.54E-09; Z-score: 2.13E+00 | ||
|
Methylation in Case |
9.32E-01 (Median) | Methylation in Control | 9.01E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of ABCA3 in clear cell renal cell carcinoma | [ 14 ] | |||
|
Location |
Body (cg05824333) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.01E+00 | Statistic Test | p-value: 8.06E-08; Z-score: 1.24E+00 | ||
|
Methylation in Case |
9.72E-01 (Median) | Methylation in Control | 9.62E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of ABCA3 in clear cell renal cell carcinoma | [ 14 ] | |||
|
Location |
Body (cg09681286) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.21E+00 | Statistic Test | p-value: 5.40E-07; Z-score: 3.35E+00 | ||
|
Methylation in Case |
8.96E-01 (Median) | Methylation in Control | 7.43E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of ABCA3 in clear cell renal cell carcinoma | [ 14 ] | |||
|
Location |
Body (cg09945896) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.07E+00 | Statistic Test | p-value: 3.23E-04; Z-score: 1.95E+00 | ||
|
Methylation in Case |
8.76E-01 (Median) | Methylation in Control | 8.18E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 6 |
Methylation of ABCA3 in clear cell renal cell carcinoma | [ 14 ] | |||
|
Location |
Body (cg08322747) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.00E+00 | Statistic Test | p-value: 4.31E-03; Z-score: -4.20E-01 | ||
|
Methylation in Case |
9.72E-01 (Median) | Methylation in Control | 9.74E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 7 |
Methylation of ABCA3 in clear cell renal cell carcinoma | [ 14 ] | |||
|
Location |
Body (cg00039478) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 6.48E-03; Z-score: -4.87E-01 | ||
|
Methylation in Case |
8.82E-01 (Median) | Methylation in Control | 8.90E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 8 |
Methylation of ABCA3 in clear cell renal cell carcinoma | [ 14 ] | |||
|
Location |
Body (cg07301574) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.07E+00 | Statistic Test | p-value: 8.65E-03; Z-score: 2.16E+00 | ||
|
Methylation in Case |
9.06E-01 (Median) | Methylation in Control | 8.48E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 9 |
Methylation of ABCA3 in clear cell renal cell carcinoma | [ 14 ] | |||
|
Location |
Body (cg08490220) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.02E+00 | Statistic Test | p-value: 2.62E-02; Z-score: -5.22E-01 | ||
|
Methylation in Case |
8.13E-01 (Median) | Methylation in Control | 8.27E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 10 |
Methylation of ABCA3 in clear cell renal cell carcinoma | [ 14 ] | |||
|
Location |
Body (cg05654361) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.12E+00 | Statistic Test | p-value: 2.94E-02; Z-score: 1.69E+00 | ||
|
Methylation in Case |
8.53E-01 (Median) | Methylation in Control | 7.61E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 11 |
Methylation of ABCA3 in clear cell renal cell carcinoma | [ 14 ] | |||
|
Location |
Body (cg20915212) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.02E+00 | Statistic Test | p-value: 4.44E-02; Z-score: 8.25E-01 | ||
|
Methylation in Case |
8.11E-01 (Median) | Methylation in Control | 7.97E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Depression |
3 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of ABCA3 in depression | [ 15 ] | |||
|
Location |
Body (cg05824333) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.00E+00 | Statistic Test | p-value: 1.80E-02; Z-score: 4.32E-02 | ||
|
Methylation in Case |
9.52E-01 (Median) | Methylation in Control | 9.52E-01 (Median) | ||
|
Studied Phenotype |
Depression [ ICD-11: 6A8Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of ABCA3 in depression | [ 15 ] | |||
|
Location |
Body (cg04058100) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 4.13E-02; Z-score: -4.57E-01 | ||
|
Methylation in Case |
8.58E-01 (Median) | Methylation in Control | 8.66E-01 (Median) | ||
|
Studied Phenotype |
Depression [ ICD-11: 6A8Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of ABCA3 in depression | [ 15 ] | |||
|
Location |
Body (cg04149930) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 4.34E-02; Z-score: -2.58E-01 | ||
|
Methylation in Case |
6.77E-01 (Median) | Methylation in Control | 6.84E-01 (Median) | ||
|
Studied Phenotype |
Depression [ ICD-11: 6A8Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
microRNA |
|||||
|
Unclear Phenotype |
5 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
miR-20a directly targets ABCA3 | [ 16 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | CLASH | ||
|
miRNA Stemloop ID |
miR-20a | miRNA Mature ID | miR-20a-5p | ||
|
miRNA Sequence |
UAAAGUGCUUAUAGUGCAGGUAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon 2 |
miR-335 directly targets ABCA3 | [ 17 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | Microarray | ||
|
miRNA Stemloop ID |
miR-335 | miRNA Mature ID | miR-335-5p | ||
|
miRNA Sequence |
UCAAGAGCAAUAACGAAAAAUGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 3 |
miR-409 directly targets ABCA3 | [ 18 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-409 | miRNA Mature ID | miR-409-5p | ||
|
miRNA Sequence |
AGGUUACCCGAGCAACUUUGCAU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
miR-92a directly targets ABCA3 | [ 16 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | CLASH | ||
|
miRNA Stemloop ID |
miR-92a | miRNA Mature ID | miR-92a-3p | ||
|
miRNA Sequence |
UAUUGCACUUGUCCCGGCCUGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon 5 |
miR-92b directly targets ABCA3 | [ 16 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | CLASH | ||
|
miRNA Stemloop ID |
miR-92b | miRNA Mature ID | miR-92b-3p | ||
|
miRNA Sequence |
UAUUGCACUCGUCCCGGCCUCC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.