Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID	DTD0042 Transporter Info
Gene Name	ABCA4
Transporter Name	ATP-binding cassette sub-family A member 4
Gene ID	24
UniProt ID	P78363

Epigenetic Regulations of This DT (EGR)
Methylation
Bladder cancer	16 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of ABCA4 in bladder cancer			[ 1 ]
Location	TSS1500 (cg09360041)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -2.24E+00	Statistic Test	p-value: 5.09E-13; Z-score: -1.69E+01
Methylation in Case	3.57E-01 (Median)	Methylation in Control	8.00E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of ABCA4 in bladder cancer			[ 1 ]
Location	TSS1500 (cg12869058)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.88E+00	Statistic Test	p-value: 9.95E-10; Z-score: -2.57E+01
Methylation in Case	4.30E-01 (Median)	Methylation in Control	8.07E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of ABCA4 in bladder cancer			[ 1 ]
Location	TSS1500 (cg06895831)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.70E+00	Statistic Test	p-value: 1.71E-09; Z-score: -1.02E+01
Methylation in Case	4.45E-01 (Median)	Methylation in Control	7.56E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of ABCA4 in bladder cancer			[ 1 ]
Location	TSS1500 (cg16298016)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.12E+00	Statistic Test	p-value: 3.05E-04; Z-score: -3.83E+00
Methylation in Case	7.66E-01 (Median)	Methylation in Control	8.62E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of ABCA4 in bladder cancer			[ 1 ]
Location	Body (cg14014879)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.78E+00	Statistic Test	p-value: 4.15E-13; Z-score: 1.41E+01
Methylation in Case	6.96E-01 (Median)	Methylation in Control	3.92E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of ABCA4 in bladder cancer			[ 1 ]
Location	Body (cg01922613)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.83E+00	Statistic Test	p-value: 3.39E-12; Z-score: 1.17E+01
Methylation in Case	7.85E-01 (Median)	Methylation in Control	4.30E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of ABCA4 in bladder cancer			[ 1 ]
Location	Body (cg18185648)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.88E+00	Statistic Test	p-value: 2.14E-07; Z-score: 5.90E+00
Methylation in Case	6.09E-01 (Median)	Methylation in Control	3.25E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of ABCA4 in bladder cancer			[ 1 ]
Location	Body (cg04491808)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.29E+00	Statistic Test	p-value: 5.55E-07; Z-score: -4.29E+00
Methylation in Case	5.33E-01 (Median)	Methylation in Control	6.91E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 9	Methylation of ABCA4 in bladder cancer			[ 1 ]
Location	Body (cg12600556)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.17E+00	Statistic Test	p-value: 9.51E-07; Z-score: -7.30E+00
Methylation in Case	6.95E-01 (Median)	Methylation in Control	8.13E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 10	Methylation of ABCA4 in bladder cancer			[ 1 ]
Location	Body (cg01807748)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -2.19E+00	Statistic Test	p-value: 4.34E-06; Z-score: -6.05E+00
Methylation in Case	1.78E-01 (Median)	Methylation in Control	3.90E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 11	Methylation of ABCA4 in bladder cancer			[ 1 ]
Location	Body (cg18800235)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.28E+00	Statistic Test	p-value: 1.67E-05; Z-score: -8.56E+00
Methylation in Case	6.52E-01 (Median)	Methylation in Control	8.34E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 12	Methylation of ABCA4 in bladder cancer			[ 1 ]
Location	Body (cg01921066)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.98E+00	Statistic Test	p-value: 1.82E-04; Z-score: -3.83E+00
Methylation in Case	1.20E-01 (Median)	Methylation in Control	2.38E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 13	Methylation of ABCA4 in bladder cancer			[ 1 ]
Location	Body (cg09168805)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.70E+00	Statistic Test	p-value: 2.23E-04; Z-score: -3.40E+00
Methylation in Case	3.19E-01 (Median)	Methylation in Control	5.42E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 14	Methylation of ABCA4 in bladder cancer			[ 1 ]
Location	Body (cg09234454)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.58E+00	Statistic Test	p-value: 1.11E-02; Z-score: 2.60E+00
Methylation in Case	9.14E-01 (Median)	Methylation in Control	5.79E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 15	Methylation of ABCA4 in bladder cancer			[ 1 ]
Location	Body (cg09326529)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.01E+00	Statistic Test	p-value: 2.78E-02; Z-score: -4.67E+00
Methylation in Case	9.58E-01 (Median)	Methylation in Control	9.70E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 16	Methylation of ABCA4 in bladder cancer			[ 1 ]
Location	3'UTR (cg18377941)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.13E+00	Statistic Test	p-value: 7.00E-05; Z-score: -6.35E+00
Methylation in Case	8.06E-01 (Median)	Methylation in Control	9.08E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Breast cancer	18 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of ABCA4 in breast cancer			[ 2 ]
Location	TSS1500 (cg09360041)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.15E+00	Statistic Test	p-value: 6.43E-13; Z-score: -2.04E+00
Methylation in Case	7.11E-01 (Median)	Methylation in Control	8.17E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of ABCA4 in breast cancer			[ 2 ]
Location	TSS1500 (cg12869058)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.15E+00	Statistic Test	p-value: 5.69E-08; Z-score: -1.43E+00
Methylation in Case	7.15E-01 (Median)	Methylation in Control	8.19E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of ABCA4 in breast cancer			[ 2 ]
Location	TSS1500 (cg06895831)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.07E+00	Statistic Test	p-value: 2.14E-07; Z-score: -1.45E+00
Methylation in Case	7.93E-01 (Median)	Methylation in Control	8.47E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of ABCA4 in breast cancer			[ 2 ]
Location	TSS1500 (cg16298016)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.04E+00	Statistic Test	p-value: 2.13E-02; Z-score: -6.33E-01
Methylation in Case	8.66E-01 (Median)	Methylation in Control	8.98E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of ABCA4 in breast cancer			[ 2 ]
Location	1stExon (cg04592706)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.03E+00	Statistic Test	p-value: 5.04E-08; Z-score: -1.14E+00
Methylation in Case	8.88E-01 (Median)	Methylation in Control	9.16E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of ABCA4 in breast cancer			[ 2 ]
Location	Body (cg04491808)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.24E+00	Statistic Test	p-value: 3.59E-17; Z-score: -3.25E+00
Methylation in Case	6.22E-01 (Median)	Methylation in Control	7.74E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of ABCA4 in breast cancer			[ 2 ]
Location	Body (cg18185648)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.56E+00	Statistic Test	p-value: 1.89E-13; Z-score: 3.09E+00
Methylation in Case	4.44E-01 (Median)	Methylation in Control	2.85E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of ABCA4 in breast cancer			[ 2 ]
Location	Body (cg19378389)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.11E+00	Statistic Test	p-value: 4.52E-10; Z-score: -1.75E+00
Methylation in Case	7.63E-01 (Median)	Methylation in Control	8.44E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 9	Methylation of ABCA4 in breast cancer			[ 2 ]
Location	Body (cg04100956)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.19E+00	Statistic Test	p-value: 4.37E-09; Z-score: -1.69E+00
Methylation in Case	5.80E-01 (Median)	Methylation in Control	6.91E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 10	Methylation of ABCA4 in breast cancer			[ 2 ]
Location	Body (cg14014879)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.22E+00	Statistic Test	p-value: 9.33E-08; Z-score: 1.99E+00
Methylation in Case	5.19E-01 (Median)	Methylation in Control	4.25E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 11	Methylation of ABCA4 in breast cancer			[ 2 ]
Location	Body (cg26904308)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.16E+00	Statistic Test	p-value: 1.41E-06; Z-score: 1.34E+00
Methylation in Case	7.61E-01 (Median)	Methylation in Control	6.55E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 12	Methylation of ABCA4 in breast cancer			[ 2 ]
Location	Body (cg01922613)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.26E+00	Statistic Test	p-value: 3.98E-06; Z-score: 1.19E+00
Methylation in Case	5.31E-01 (Median)	Methylation in Control	4.22E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 13	Methylation of ABCA4 in breast cancer			[ 2 ]
Location	Body (cg09168805)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.09E+00	Statistic Test	p-value: 4.98E-06; Z-score: 8.08E-01
Methylation in Case	6.85E-01 (Median)	Methylation in Control	6.31E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 14	Methylation of ABCA4 in breast cancer			[ 2 ]
Location	Body (cg12600556)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.02E+00	Statistic Test	p-value: 4.24E-03; Z-score: -4.40E-01
Methylation in Case	7.66E-01 (Median)	Methylation in Control	7.82E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 15	Methylation of ABCA4 in breast cancer			[ 2 ]
Location	Body (cg09234454)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.20E+00	Statistic Test	p-value: 4.65E-03; Z-score: 6.08E-01
Methylation in Case	7.66E-01 (Median)	Methylation in Control	6.36E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 16	Methylation of ABCA4 in breast cancer			[ 2 ]
Location	Body (cg01807748)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.09E+00	Statistic Test	p-value: 8.76E-03; Z-score: -9.02E-01
Methylation in Case	5.68E-01 (Median)	Methylation in Control	6.17E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 17	Methylation of ABCA4 in breast cancer			[ 2 ]
Location	Body (cg12085314)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.16E+00	Statistic Test	p-value: 1.34E-02; Z-score: 2.59E-01
Methylation in Case	6.15E-02 (Median)	Methylation in Control	5.31E-02 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 18	Methylation of ABCA4 in breast cancer			[ 2 ]
Location	3'UTR (cg18377941)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.03E+00	Statistic Test	p-value: 2.63E-07; Z-score: -9.70E-01
Methylation in Case	8.72E-01 (Median)	Methylation in Control	9.02E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Colorectal cancer	11 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of ABCA4 in colorectal cancer			[ 3 ]
Location	TSS1500 (cg16298016)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.14E+00	Statistic Test	p-value: 1.15E-10; Z-score: -4.67E+00
Methylation in Case	7.93E-01 (Median)	Methylation in Control	9.05E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of ABCA4 in colorectal cancer			[ 3 ]
Location	TSS1500 (cg09360041)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.12E+00	Statistic Test	p-value: 4.51E-06; Z-score: -1.36E+00
Methylation in Case	7.84E-01 (Median)	Methylation in Control	8.79E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of ABCA4 in colorectal cancer			[ 3 ]
Location	TSS1500 (cg06895831)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.29E+00	Statistic Test	p-value: 2.14E-04; Z-score: -1.18E+00
Methylation in Case	4.32E-01 (Median)	Methylation in Control	5.58E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of ABCA4 in colorectal cancer			[ 3 ]
Location	TSS1500 (cg12869058)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.02E+00	Statistic Test	p-value: 2.12E-02; Z-score: -2.37E-01
Methylation in Case	8.24E-01 (Median)	Methylation in Control	8.41E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of ABCA4 in colorectal cancer			[ 3 ]
Location	Body (cg04491808)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.14E+00	Statistic Test	p-value: 1.43E-08; Z-score: -2.05E+00
Methylation in Case	6.87E-01 (Median)	Methylation in Control	7.86E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of ABCA4 in colorectal cancer			[ 3 ]
Location	Body (cg01437135)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.11E+00	Statistic Test	p-value: 3.91E-08; Z-score: -1.78E+00
Methylation in Case	7.21E-01 (Median)	Methylation in Control	7.99E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of ABCA4 in colorectal cancer			[ 3 ]
Location	Body (cg19378389)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.04E+00	Statistic Test	p-value: 5.32E-06; Z-score: -1.91E+00
Methylation in Case	8.73E-01 (Median)	Methylation in Control	9.08E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of ABCA4 in colorectal cancer			[ 3 ]
Location	Body (cg04100956)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.07E+00	Statistic Test	p-value: 2.02E-04; Z-score: -9.90E-01
Methylation in Case	7.67E-01 (Median)	Methylation in Control	8.21E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 9	Methylation of ABCA4 in colorectal cancer			[ 3 ]
Location	Body (cg09168805)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.03E+00	Statistic Test	p-value: 3.52E-03; Z-score: -3.53E-01
Methylation in Case	7.72E-01 (Median)	Methylation in Control	7.96E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 10	Methylation of ABCA4 in colorectal cancer			[ 3 ]
Location	3'UTR (cg18377941)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.18E+00	Statistic Test	p-value: 1.31E-05; Z-score: -1.57E+00
Methylation in Case	7.51E-01 (Median)	Methylation in Control	8.86E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Hepatocellular carcinoma	22 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of ABCA4 in hepatocellular carcinoma			[ 4 ]
Location	TSS1500 (cg12175729)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 5.46E+00	Statistic Test	p-value: 3.62E-19; Z-score: 5.30E+00
Methylation in Case	4.43E-01 (Median)	Methylation in Control	8.12E-02 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of ABCA4 in hepatocellular carcinoma			[ 4 ]
Location	TSS1500 (cg06895831)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.04E+00	Statistic Test	p-value: 4.52E-05; Z-score: -4.75E-01
Methylation in Case	8.27E-01 (Median)	Methylation in Control	8.61E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of ABCA4 in hepatocellular carcinoma			[ 4 ]
Location	TSS1500 (cg16298016)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.03E+00	Statistic Test	p-value: 2.10E-04; Z-score: -4.95E-01
Methylation in Case	8.61E-01 (Median)	Methylation in Control	8.88E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of ABCA4 in hepatocellular carcinoma			[ 4 ]
Location	TSS1500 (cg09360041)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.02E+00	Statistic Test	p-value: 8.76E-04; Z-score: -3.07E-01
Methylation in Case	7.66E-01 (Median)	Methylation in Control	7.80E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of ABCA4 in hepatocellular carcinoma			[ 4 ]
Location	Body (cg15999077)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.76E+00	Statistic Test	p-value: 4.38E-24; Z-score: -3.97E+00
Methylation in Case	2.74E-01 (Median)	Methylation in Control	4.81E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of ABCA4 in hepatocellular carcinoma			[ 4 ]
Location	Body (cg16814060)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -2.05E+00	Statistic Test	p-value: 3.75E-22; Z-score: -4.03E+00
Methylation in Case	4.16E-01 (Median)	Methylation in Control	8.55E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of ABCA4 in hepatocellular carcinoma			[ 4 ]
Location	Body (cg04014105)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 2.13E+00	Statistic Test	p-value: 5.12E-16; Z-score: 2.62E+00
Methylation in Case	5.13E-01 (Median)	Methylation in Control	2.41E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of ABCA4 in hepatocellular carcinoma			[ 4 ]
Location	Body (cg13759513)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.11E+00	Statistic Test	p-value: 3.43E-14; Z-score: 1.60E+00
Methylation in Case	8.15E-01 (Median)	Methylation in Control	7.34E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 9	Methylation of ABCA4 in hepatocellular carcinoma			[ 4 ]
Location	Body (cg26068215)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.61E+00	Statistic Test	p-value: 5.34E-14; Z-score: -3.90E+00
Methylation in Case	4.32E-01 (Median)	Methylation in Control	6.96E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 10	Methylation of ABCA4 in hepatocellular carcinoma			[ 4 ]
Location	Body (cg01629545)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.35E+00	Statistic Test	p-value: 1.01E-11; Z-score: -2.72E+00
Methylation in Case	4.81E-01 (Median)	Methylation in Control	6.50E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 11	Methylation of ABCA4 in hepatocellular carcinoma			[ 4 ]
Location	Body (cg19241593)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.26E+00	Statistic Test	p-value: 3.98E-10; Z-score: -1.66E+00
Methylation in Case	6.48E-01 (Median)	Methylation in Control	8.19E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 12	Methylation of ABCA4 in hepatocellular carcinoma			[ 4 ]
Location	Body (cg11592640)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.20E+00	Statistic Test	p-value: 6.63E-10; Z-score: -2.41E+00
Methylation in Case	6.37E-01 (Median)	Methylation in Control	7.61E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 13	Methylation of ABCA4 in hepatocellular carcinoma			[ 4 ]
Location	Body (cg01922613)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.11E+00	Statistic Test	p-value: 3.11E-05; Z-score: 1.06E+00
Methylation in Case	7.78E-01 (Median)	Methylation in Control	7.03E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 14	Methylation of ABCA4 in hepatocellular carcinoma			[ 4 ]
Location	Body (cg19378389)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.06E+00	Statistic Test	p-value: 3.30E-05; Z-score: -1.08E+00
Methylation in Case	7.66E-01 (Median)	Methylation in Control	8.13E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 15	Methylation of ABCA4 in hepatocellular carcinoma			[ 4 ]
Location	Body (cg04100956)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.09E+00	Statistic Test	p-value: 8.45E-05; Z-score: 9.67E-01
Methylation in Case	6.54E-01 (Median)	Methylation in Control	5.97E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 16	Methylation of ABCA4 in hepatocellular carcinoma			[ 4 ]
Location	Body (cg21692182)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.00E+00	Statistic Test	p-value: 1.53E-03; Z-score: -3.17E-01
Methylation in Case	8.90E-01 (Median)	Methylation in Control	8.94E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 17	Methylation of ABCA4 in hepatocellular carcinoma			[ 4 ]
Location	Body (cg01921066)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.32E+00	Statistic Test	p-value: 1.78E-03; Z-score: -1.41E+00
Methylation in Case	1.97E-01 (Median)	Methylation in Control	2.60E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 18	Methylation of ABCA4 in hepatocellular carcinoma			[ 4 ]
Location	Body (cg09168805)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.05E+00	Statistic Test	p-value: 2.92E-03; Z-score: -7.35E-01
Methylation in Case	6.62E-01 (Median)	Methylation in Control	6.98E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 19	Methylation of ABCA4 in hepatocellular carcinoma			[ 4 ]
Location	Body (cg04491808)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.05E+00	Statistic Test	p-value: 8.64E-03; Z-score: -4.37E-01
Methylation in Case	6.32E-01 (Median)	Methylation in Control	6.62E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 20	Methylation of ABCA4 in hepatocellular carcinoma			[ 4 ]
Location	Body (cg26904308)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.03E+00	Statistic Test	p-value: 4.20E-02; Z-score: -1.78E-01
Methylation in Case	8.12E-01 (Median)	Methylation in Control	8.33E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 21	Methylation of ABCA4 in hepatocellular carcinoma			[ 4 ]
Location	Body (cg01437135)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.01E+00	Statistic Test	p-value: 4.44E-02; Z-score: 8.98E-02
Methylation in Case	7.18E-01 (Median)	Methylation in Control	7.12E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 22	Methylation of ABCA4 in hepatocellular carcinoma			[ 4 ]
Location	3'UTR (cg18377941)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.42E+00	Statistic Test	p-value: 5.11E-08; Z-score: -1.93E+00
Methylation in Case	4.80E-01 (Median)	Methylation in Control	6.83E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
HIV infection	14 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of ABCA4 in HIV infection			[ 5 ]
Location	TSS1500 (cg12869058)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.07E+00	Statistic Test	p-value: 8.89E-05; Z-score: -1.38E+00
Methylation in Case	7.12E-01 (Median)	Methylation in Control	7.62E-01 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of ABCA4 in HIV infection			[ 5 ]
Location	TSS1500 (cg06895831)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.03E+00	Statistic Test	p-value: 1.54E-02; Z-score: -9.30E-01
Methylation in Case	8.70E-01 (Median)	Methylation in Control	8.94E-01 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of ABCA4 in HIV infection			[ 5 ]
Location	TSS1500 (cg09360041)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.02E+00	Statistic Test	p-value: 2.32E-02; Z-score: -4.29E-01
Methylation in Case	7.38E-01 (Median)	Methylation in Control	7.56E-01 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of ABCA4 in HIV infection			[ 5 ]
Location	1stExon (cg04592706)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.02E+00	Statistic Test	p-value: 2.62E-03; Z-score: -8.18E-01
Methylation in Case	9.34E-01 (Median)	Methylation in Control	9.49E-01 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of ABCA4 in HIV infection			[ 5 ]
Location	Body (cg18185648)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.12E+00	Statistic Test	p-value: 3.14E-09; Z-score: 2.03E+00
Methylation in Case	8.36E-01 (Median)	Methylation in Control	7.48E-01 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of ABCA4 in HIV infection			[ 5 ]
Location	Body (cg18800235)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.09E+00	Statistic Test	p-value: 1.27E-06; Z-score: -2.57E+00
Methylation in Case	8.32E-01 (Median)	Methylation in Control	9.11E-01 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of ABCA4 in HIV infection			[ 5 ]
Location	Body (cg01437135)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.13E+00	Statistic Test	p-value: 2.03E-06; Z-score: -2.60E+00
Methylation in Case	7.09E-01 (Median)	Methylation in Control	8.05E-01 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of ABCA4 in HIV infection			[ 5 ]
Location	Body (cg19378389)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.08E+00	Statistic Test	p-value: 2.10E-06; Z-score: -2.58E+00
Methylation in Case	8.50E-01 (Median)	Methylation in Control	9.21E-01 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 9	Methylation of ABCA4 in HIV infection			[ 5 ]
Location	Body (cg04491808)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.13E+00	Statistic Test	p-value: 4.51E-06; Z-score: -1.74E+00
Methylation in Case	5.95E-01 (Median)	Methylation in Control	6.74E-01 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 10	Methylation of ABCA4 in HIV infection			[ 5 ]
Location	Body (cg12600556)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.03E+00	Statistic Test	p-value: 1.60E-05; Z-score: -1.00E+00
Methylation in Case	8.43E-01 (Median)	Methylation in Control	8.72E-01 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 11	Methylation of ABCA4 in HIV infection			[ 5 ]
Location	Body (cg14014879)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.02E+00	Statistic Test	p-value: 2.28E-04; Z-score: 8.52E-01
Methylation in Case	8.72E-01 (Median)	Methylation in Control	8.54E-01 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 12	Methylation of ABCA4 in HIV infection			[ 5 ]
Location	Body (cg01807748)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.01E+00	Statistic Test	p-value: 2.50E-03; Z-score: 3.92E-01
Methylation in Case	9.10E-01 (Median)	Methylation in Control	9.00E-01 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 13	Methylation of ABCA4 in HIV infection			[ 5 ]
Location	Body (cg04100956)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.06E+00	Statistic Test	p-value: 1.48E-02; Z-score: 5.19E-01
Methylation in Case	4.30E-01 (Median)	Methylation in Control	4.04E-01 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 14	Methylation of ABCA4 in HIV infection			[ 5 ]
Location	Body (cg04350215)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.27E+00	Statistic Test	p-value: 1.74E-02; Z-score: 1.14E+00
Methylation in Case	6.03E-01 (Median)	Methylation in Control	4.75E-01 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Lung adenocarcinoma	13 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of ABCA4 in lung adenocarcinoma			[ 6 ]
Location	TSS1500 (cg12869058)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.22E+00	Statistic Test	p-value: 4.50E-04; Z-score: -2.21E+00
Methylation in Case	6.04E-01 (Median)	Methylation in Control	7.40E-01 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of ABCA4 in lung adenocarcinoma			[ 6 ]
Location	TSS1500 (cg09360041)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.24E+00	Statistic Test	p-value: 1.05E-03; Z-score: -2.28E+00
Methylation in Case	5.77E-01 (Median)	Methylation in Control	7.16E-01 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of ABCA4 in lung adenocarcinoma			[ 6 ]
Location	TSS1500 (cg06895831)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.04E+00	Statistic Test	p-value: 4.28E-02; Z-score: -2.74E+00
Methylation in Case	7.55E-01 (Median)	Methylation in Control	7.87E-01 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of ABCA4 in lung adenocarcinoma			[ 6 ]
Location	Body (cg04491808)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.17E+00	Statistic Test	p-value: 4.50E-04; Z-score: -3.60E+00
Methylation in Case	6.03E-01 (Median)	Methylation in Control	7.05E-01 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of ABCA4 in lung adenocarcinoma			[ 6 ]
Location	Body (cg01807748)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.34E+00	Statistic Test	p-value: 5.75E-04; Z-score: 3.53E+00
Methylation in Case	6.72E-01 (Median)	Methylation in Control	5.02E-01 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of ABCA4 in lung adenocarcinoma			[ 6 ]
Location	Body (cg18185648)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.31E+00	Statistic Test	p-value: 1.29E-03; Z-score: 2.06E+00
Methylation in Case	6.92E-01 (Median)	Methylation in Control	5.26E-01 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of ABCA4 in lung adenocarcinoma			[ 6 ]
Location	Body (cg01921066)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.29E+00	Statistic Test	p-value: 1.72E-03; Z-score: 2.24E+00
Methylation in Case	3.32E-01 (Median)	Methylation in Control	2.58E-01 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of ABCA4 in lung adenocarcinoma			[ 6 ]
Location	Body (cg04100956)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.20E+00	Statistic Test	p-value: 2.98E-03; Z-score: -3.95E+00
Methylation in Case	5.88E-01 (Median)	Methylation in Control	7.09E-01 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 9	Methylation of ABCA4 in lung adenocarcinoma			[ 6 ]
Location	Body (cg19378389)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.05E+00	Statistic Test	p-value: 7.73E-03; Z-score: -1.35E+00
Methylation in Case	7.92E-01 (Median)	Methylation in Control	8.32E-01 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 10	Methylation of ABCA4 in lung adenocarcinoma			[ 6 ]
Location	Body (cg09168805)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.18E+00	Statistic Test	p-value: 1.48E-02; Z-score: 1.62E+00
Methylation in Case	6.61E-01 (Median)	Methylation in Control	5.59E-01 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 11	Methylation of ABCA4 in lung adenocarcinoma			[ 6 ]
Location	Body (cg12085314)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.40E+00	Statistic Test	p-value: 2.86E-02; Z-score: 1.90E+00
Methylation in Case	8.28E-02 (Median)	Methylation in Control	5.90E-02 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 12	Methylation of ABCA4 in lung adenocarcinoma			[ 6 ]
Location	Body (cg09234454)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.08E+00	Statistic Test	p-value: 4.54E-02; Z-score: 1.27E+00
Methylation in Case	8.80E-01 (Median)	Methylation in Control	8.14E-01 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 13	Methylation of ABCA4 in lung adenocarcinoma			[ 6 ]
Location	3'UTR (cg18377941)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.04E+00	Statistic Test	p-value: 1.39E-02; Z-score: -2.26E+00
Methylation in Case	8.75E-01 (Median)	Methylation in Control	9.06E-01 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Pancretic ductal adenocarcinoma	16 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of ABCA4 in pancretic ductal adenocarcinoma			[ 7 ]
Location	TSS1500 (cg25932807)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.61E+00	Statistic Test	p-value: 1.06E-20; Z-score: 3.38E+00
Methylation in Case	1.21E-01 (Median)	Methylation in Control	7.54E-02 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of ABCA4 in pancretic ductal adenocarcinoma			[ 7 ]
Location	TSS1500 (cg25241964)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.07E+00	Statistic Test	p-value: 8.36E-04; Z-score: 1.82E-01
Methylation in Case	5.68E-02 (Median)	Methylation in Control	5.30E-02 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of ABCA4 in pancretic ductal adenocarcinoma			[ 7 ]
Location	TSS1500 (cg11961175)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.22E+00	Statistic Test	p-value: 1.74E-03; Z-score: -5.65E-01
Methylation in Case	1.01E-01 (Median)	Methylation in Control	1.23E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of ABCA4 in pancretic ductal adenocarcinoma			[ 7 ]
Location	TSS200 (cg24890054)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.36E+00	Statistic Test	p-value: 5.34E-19; Z-score: 1.11E+00
Methylation in Case	1.13E-01 (Median)	Methylation in Control	8.25E-02 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of ABCA4 in pancretic ductal adenocarcinoma			[ 7 ]
Location	TSS200 (cg26857910)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.24E+00	Statistic Test	p-value: 1.09E-10; Z-score: 1.22E+00
Methylation in Case	8.39E-02 (Median)	Methylation in Control	6.78E-02 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of ABCA4 in pancretic ductal adenocarcinoma			[ 7 ]
Location	Body (cg08382534)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.76E+00	Statistic Test	p-value: 1.59E-53; Z-score: -7.94E+00
Methylation in Case	4.99E-01 (Median)	Methylation in Control	8.80E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of ABCA4 in pancretic ductal adenocarcinoma			[ 7 ]
Location	Body (cg12558347)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.50E+00	Statistic Test	p-value: 2.96E-13; Z-score: -2.62E+00
Methylation in Case	3.61E-01 (Median)	Methylation in Control	5.41E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of ABCA4 in pancretic ductal adenocarcinoma			[ 7 ]
Location	Body (cg11957400)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.31E+00	Statistic Test	p-value: 2.71E-10; Z-score: 1.90E+00
Methylation in Case	5.23E-01 (Median)	Methylation in Control	3.99E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 9	Methylation of ABCA4 in pancretic ductal adenocarcinoma			[ 7 ]
Location	Body (cg20119871)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.10E+00	Statistic Test	p-value: 7.60E-04; Z-score: 1.37E+00
Methylation in Case	7.48E-01 (Median)	Methylation in Control	6.80E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 10	Methylation of ABCA4 in pancretic ductal adenocarcinoma			[ 7 ]
Location	Body (cg26835327)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.09E+00	Statistic Test	p-value: 3.18E-03; Z-score: -4.51E-01
Methylation in Case	1.07E-01 (Median)	Methylation in Control	1.16E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 11	Methylation of ABCA4 in pancretic ductal adenocarcinoma			[ 7 ]
Location	Body (cg09146645)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.07E+00	Statistic Test	p-value: 6.96E-03; Z-score: -7.82E-01
Methylation in Case	6.24E-01 (Median)	Methylation in Control	6.69E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 12	Methylation of ABCA4 in pancretic ductal adenocarcinoma			[ 7 ]
Location	Body (cg06713373)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.02E+00	Statistic Test	p-value: 3.72E-02; Z-score: 4.44E-01
Methylation in Case	8.45E-01 (Median)	Methylation in Control	8.27E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 13	Methylation of ABCA4 in pancretic ductal adenocarcinoma			[ 7 ]
Location	Body (cg21946374)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.04E+00	Statistic Test	p-value: 3.72E-02; Z-score: -2.99E-01
Methylation in Case	7.03E-01 (Median)	Methylation in Control	7.31E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 14	Methylation of ABCA4 in pancretic ductal adenocarcinoma			[ 7 ]
Location	Body (cg02483462)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.09E+00	Statistic Test	p-value: 3.95E-02; Z-score: 7.60E-01
Methylation in Case	5.70E-01 (Median)	Methylation in Control	5.25E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 15	Methylation of ABCA4 in pancretic ductal adenocarcinoma			[ 7 ]
Location	Body (cg18813959)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.00E+00	Statistic Test	p-value: 4.93E-02; Z-score: 1.02E-02
Methylation in Case	8.39E-01 (Median)	Methylation in Control	8.39E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 16	Methylation of ABCA4 in pancretic ductal adenocarcinoma			[ 7 ]
Location	3'UTR (cg15554087)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.17E+00	Statistic Test	p-value: 3.81E-29; Z-score: -5.71E+00
Methylation in Case	7.31E-01 (Median)	Methylation in Control	8.53E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Panic disorder	2 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of ABCA4 in panic disorder			[ 8 ]
Location	TSS1500 (cg16298016)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.07E+00	Statistic Test	p-value: 3.15E-02; Z-score: 3.51E-01
Methylation in Case	1.98E+00 (Median)	Methylation in Control	1.85E+00 (Median)
Studied Phenotype	Panic disorder [ ICD-11: 6B01]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of ABCA4 in panic disorder			[ 8 ]
Location	Body (cg01437135)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.07E+00	Statistic Test	p-value: 1.74E-02; Z-score: 2.85E-01
Methylation in Case	2.30E+00 (Median)	Methylation in Control	2.16E+00 (Median)
Studied Phenotype	Panic disorder [ ICD-11: 6B01]
Experimental Material	Patient tissue samples
Papillary thyroid cancer	15 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of ABCA4 in papillary thyroid cancer			[ 9 ]
Location	TSS1500 (cg12869058)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.96E+00	Statistic Test	p-value: 4.92E-29; Z-score: -5.63E+00
Methylation in Case	4.26E-01 (Median)	Methylation in Control	8.35E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of ABCA4 in papillary thyroid cancer			[ 9 ]
Location	TSS1500 (cg09360041)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.95E+00	Statistic Test	p-value: 2.13E-24; Z-score: -4.41E+00
Methylation in Case	3.82E-01 (Median)	Methylation in Control	7.47E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of ABCA4 in papillary thyroid cancer			[ 9 ]
Location	TSS1500 (cg14787287)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.01E+00	Statistic Test	p-value: 2.24E-03; Z-score: -5.05E-01
Methylation in Case	9.43E-01 (Median)	Methylation in Control	9.48E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of ABCA4 in papillary thyroid cancer			[ 9 ]
Location	TSS1500 (cg06895831)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.04E+00	Statistic Test	p-value: 8.14E-03; Z-score: 1.01E+00
Methylation in Case	7.96E-01 (Median)	Methylation in Control	7.66E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of ABCA4 in papillary thyroid cancer			[ 9 ]
Location	TSS1500 (cg16298016)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.01E+00	Statistic Test	p-value: 1.43E-02; Z-score: 4.86E-01
Methylation in Case	9.32E-01 (Median)	Methylation in Control	9.26E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of ABCA4 in papillary thyroid cancer			[ 9 ]
Location	Body (cg18800235)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.55E+00	Statistic Test	p-value: 3.98E-22; Z-score: -1.04E+01
Methylation in Case	5.55E-01 (Median)	Methylation in Control	8.58E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of ABCA4 in papillary thyroid cancer			[ 9 ]
Location	Body (cg09234454)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.23E+00	Statistic Test	p-value: 2.69E-10; Z-score: -2.70E+00
Methylation in Case	6.32E-01 (Median)	Methylation in Control	7.79E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of ABCA4 in papillary thyroid cancer			[ 9 ]
Location	Body (cg01921066)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.36E+00	Statistic Test	p-value: 9.65E-08; Z-score: -1.40E+00
Methylation in Case	1.75E-01 (Median)	Methylation in Control	2.39E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 9	Methylation of ABCA4 in papillary thyroid cancer			[ 9 ]
Location	Body (cg26904308)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.04E+00	Statistic Test	p-value: 9.79E-07; Z-score: 1.05E+00
Methylation in Case	9.12E-01 (Median)	Methylation in Control	8.80E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 10	Methylation of ABCA4 in papillary thyroid cancer			[ 9 ]
Location	Body (cg09168805)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.10E+00	Statistic Test	p-value: 2.20E-05; Z-score: 1.24E+00
Methylation in Case	6.72E-01 (Median)	Methylation in Control	6.11E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 11	Methylation of ABCA4 in papillary thyroid cancer			[ 9 ]
Location	Body (cg01922613)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.18E+00	Statistic Test	p-value: 2.47E-03; Z-score: -8.00E-01
Methylation in Case	3.53E-01 (Median)	Methylation in Control	4.17E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 12	Methylation of ABCA4 in papillary thyroid cancer			[ 9 ]
Location	Body (cg04491808)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.03E+00	Statistic Test	p-value: 5.81E-03; Z-score: -5.30E-01
Methylation in Case	8.51E-01 (Median)	Methylation in Control	8.80E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 13	Methylation of ABCA4 in papillary thyroid cancer			[ 9 ]
Location	Body (cg18185648)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.26E+00	Statistic Test	p-value: 6.32E-03; Z-score: 6.59E-01
Methylation in Case	2.29E-01 (Median)	Methylation in Control	1.82E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 14	Methylation of ABCA4 in papillary thyroid cancer			[ 9 ]
Location	Body (cg12600556)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.00E+00	Statistic Test	p-value: 8.91E-03; Z-score: -1.68E-01
Methylation in Case	8.79E-01 (Median)	Methylation in Control	8.83E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 15	Methylation of ABCA4 in papillary thyroid cancer			[ 9 ]
Location	Body (cg01437135)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.09E+00	Statistic Test	p-value: 1.57E-02; Z-score: 4.14E-01
Methylation in Case	2.90E-01 (Median)	Methylation in Control	2.67E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Prostate cancer	7 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of ABCA4 in prostate cancer			[ 10 ]
Location	TSS1500 (cg01517431)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.16E+00	Statistic Test	p-value: 3.68E-02; Z-score: 1.85E+00
Methylation in Case	8.88E-01 (Median)	Methylation in Control	7.63E-01 (Median)
Studied Phenotype	Prostate cancer [ ICD-11: 2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of ABCA4 in prostate cancer			[ 10 ]
Location	TSS1500 (cg21881273)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 2.21E+00	Statistic Test	p-value: 4.96E-02; Z-score: 3.09E+00
Methylation in Case	7.67E-02 (Median)	Methylation in Control	3.47E-02 (Median)
Studied Phenotype	Prostate cancer [ ICD-11: 2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of ABCA4 in prostate cancer			[ 10 ]
Location	TSS200 (cg01323777)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.43E+00	Statistic Test	p-value: 2.75E-02; Z-score: 1.85E+00
Methylation in Case	8.39E-01 (Median)	Methylation in Control	5.86E-01 (Median)
Studied Phenotype	Prostate cancer [ ICD-11: 2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of ABCA4 in prostate cancer			[ 10 ]
Location	Body (cg23638455)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.63E+00	Statistic Test	p-value: 6.09E-03; Z-score: 2.82E+00
Methylation in Case	8.45E-01 (Median)	Methylation in Control	5.19E-01 (Median)
Studied Phenotype	Prostate cancer [ ICD-11: 2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of ABCA4 in prostate cancer			[ 10 ]
Location	Body (cg23958868)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.59E+00	Statistic Test	p-value: 1.32E-02; Z-score: -2.79E+00
Methylation in Case	3.53E-01 (Median)	Methylation in Control	5.61E-01 (Median)
Studied Phenotype	Prostate cancer [ ICD-11: 2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of ABCA4 in prostate cancer			[ 10 ]
Location	3'UTR (cg26270695)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.54E+00	Statistic Test	p-value: 1.16E-02; Z-score: -3.86E+00
Methylation in Case	3.37E-01 (Median)	Methylation in Control	5.19E-01 (Median)
Studied Phenotype	Prostate cancer [ ICD-11: 2C82]
Experimental Material	Patient tissue samples
Atypical teratoid rhabdoid tumor	15 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of ABCA4 in atypical teratoid rhabdoid tumor			[ 11 ]
Location	1stExon (cg04592706)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.55E+00	Statistic Test	p-value: 1.25E-24; Z-score: -3.36E+00
Methylation in Case	4.05E-01 (Median)	Methylation in Control	6.27E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of ABCA4 in atypical teratoid rhabdoid tumor			[ 11 ]
Location	Body (cg01437135)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.10E+00	Statistic Test	p-value: 6.71E-05; Z-score: 9.48E-01
Methylation in Case	8.90E-01 (Median)	Methylation in Control	8.09E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of ABCA4 in atypical teratoid rhabdoid tumor			[ 11 ]
Location	Body (cg01807748)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.13E+00	Statistic Test	p-value: 8.35E-05; Z-score: 6.88E-01
Methylation in Case	8.33E-01 (Median)	Methylation in Control	7.38E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of ABCA4 in atypical teratoid rhabdoid tumor			[ 11 ]
Location	Body (cg01921066)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -2.04E+00	Statistic Test	p-value: 9.52E-05; Z-score: -1.45E+00
Methylation in Case	2.00E-01 (Median)	Methylation in Control	4.07E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of ABCA4 in atypical teratoid rhabdoid tumor			[ 11 ]
Location	Body (cg01922613)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.11E+00	Statistic Test	p-value: 1.02E-04; Z-score: -1.13E+00
Methylation in Case	7.52E-01 (Median)	Methylation in Control	8.37E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of ABCA4 in atypical teratoid rhabdoid tumor			[ 11 ]
Location	Body (cg04100956)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.04E+00	Statistic Test	p-value: 5.56E-04; Z-score: -7.14E-01
Methylation in Case	8.47E-01 (Median)	Methylation in Control	8.78E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of ABCA4 in atypical teratoid rhabdoid tumor			[ 11 ]
Location	Body (cg04350215)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.07E+00	Statistic Test	p-value: 7.33E-04; Z-score: -4.57E-01
Methylation in Case	7.11E-01 (Median)	Methylation in Control	7.61E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of ABCA4 in atypical teratoid rhabdoid tumor			[ 11 ]
Location	Body (cg04491808)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.12E+00	Statistic Test	p-value: 8.49E-04; Z-score: 5.60E-01
Methylation in Case	8.19E-01 (Median)	Methylation in Control	7.33E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 9	Methylation of ABCA4 in atypical teratoid rhabdoid tumor			[ 11 ]
Location	Body (cg09168805)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.28E+00	Statistic Test	p-value: 9.53E-03; Z-score: -6.82E-01
Methylation in Case	1.36E-01 (Median)	Methylation in Control	1.73E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 10	Methylation of ABCA4 in atypical teratoid rhabdoid tumor			[ 11 ]
Location	Body (cg09234454)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.04E+00	Statistic Test	p-value: 9.70E-03; Z-score: 2.19E-01
Methylation in Case	1.11E-01 (Median)	Methylation in Control	1.07E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 11	Methylation of ABCA4 in atypical teratoid rhabdoid tumor			[ 11 ]
Location	Body (cg09326529)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.06E+00	Statistic Test	p-value: 9.87E-03; Z-score: -2.03E-01
Methylation in Case	1.07E-01 (Median)	Methylation in Control	1.14E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 12	Methylation of ABCA4 in atypical teratoid rhabdoid tumor			[ 11 ]
Location	Body (cg12085314)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.08E+00	Statistic Test	p-value: 2.66E-02; Z-score: -4.62E-01
Methylation in Case	6.43E-01 (Median)	Methylation in Control	6.97E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 13	Methylation of ABCA4 in atypical teratoid rhabdoid tumor			[ 11 ]
Location	Body (cg12600556)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.16E+00	Statistic Test	p-value: 2.84E-02; Z-score: -2.44E-01
Methylation in Case	1.70E-01 (Median)	Methylation in Control	1.97E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 14	Methylation of ABCA4 in atypical teratoid rhabdoid tumor			[ 11 ]
Location	Body (cg14014879)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.09E+00	Statistic Test	p-value: 4.21E-02; Z-score: -5.86E-01
Methylation in Case	5.51E-01 (Median)	Methylation in Control	6.04E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 15	Methylation of ABCA4 in atypical teratoid rhabdoid tumor			[ 11 ]
Location	3'UTR (cg18377941)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.13E+00	Statistic Test	p-value: 1.46E-10; Z-score: -1.61E+00
Methylation in Case	7.78E-01 (Median)	Methylation in Control	8.77E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Depression	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of ABCA4 in depression			[ 12 ]
Location	Body (cg12085314)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.19E+00	Statistic Test	p-value: 8.69E-03; Z-score: -4.44E-01
Methylation in Case	3.94E-02 (Median)	Methylation in Control	4.69E-02 (Median)
Studied Phenotype	Depression [ ICD-11: 6A8Z]
Experimental Material	Patient tissue samples
Systemic lupus erythematosus	3 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of ABCA4 in systemic lupus erythematosus			[ 13 ]
Location	Body (cg12600556)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.01E+00	Statistic Test	p-value: 1.83E-02; Z-score: -2.14E-01
Methylation in Case	8.54E-01 (Median)	Methylation in Control	8.62E-01 (Median)
Studied Phenotype	Systemic lupus erythematosus [ ICD-11: 4A40.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of ABCA4 in systemic lupus erythematosus			[ 13 ]
Location	Body (cg01921066)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.02E+00	Statistic Test	p-value: 2.26E-02; Z-score: -1.57E-01
Methylation in Case	5.05E-01 (Median)	Methylation in Control	5.16E-01 (Median)
Studied Phenotype	Systemic lupus erythematosus [ ICD-11: 4A40.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of ABCA4 in systemic lupus erythematosus			[ 13 ]
Location	Body (cg19378389)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.01E+00	Statistic Test	p-value: 2.31E-02; Z-score: -1.67E-01
Methylation in Case	8.38E-01 (Median)	Methylation in Control	8.50E-01 (Median)
Studied Phenotype	Systemic lupus erythematosus [ ICD-11: 4A40.0]
Experimental Material	Patient tissue samples
Anaplastic pleomorphic xanthoastrocytoma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Moderate hypermethylation of ABCA4 in anaplastic pleomorphic xanthoastrocytoma than that in healthy individual
Studied Phenotype	Anaplastic pleomorphic xanthoastrocytoma [ICD-11:2A00.0Y]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 1.67E-07; Fold-change: 0.221907876; Z-score: 1.821192192
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Arterial aneurysm	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Moderate hypermethylation of ABCA4 in arterial aneurysm than that in healthy individual
Studied Phenotype	Arterial aneurysm [ICD-11:BD51]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 0.00055652; Fold-change: 0.242898892; Z-score: 5.843915298
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue adjacent to the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data of patients in the normal section of the tissue adjacent to the disease section Download DT methylation data in the tissue of healthy individual
Lymphoma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Moderate hypermethylation of ABCA4 in lymphoma than that in healthy individual
Studied Phenotype	Lymphoma [ICD-11:2B30]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 1.14E-10; Fold-change: 0.22170038; Z-score: 1.526244033
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Melanocytoma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Moderate hypermethylation of ABCA4 in melanocytoma than that in healthy individual
Studied Phenotype	Melanocytoma [ICD-11:2F36.2]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 4.15E-08; Fold-change: 0.249667316; Z-score: 2.453350993
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Oligodendroglial tumour	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Moderate hypermethylation of ABCA4 in oligodendroglial tumour than that in healthy individual
Studied Phenotype	Oligodendroglial tumour [ICD-11:2A00.Y1]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 0.026268836; Fold-change: 0.246497124; Z-score: 1.379159806
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Oligodendroglioma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Moderate hypermethylation of ABCA4 in oligodendroglioma than that in healthy individual
Studied Phenotype	Oligodendroglioma [ICD-11:2A00.0Y]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 5.04E-18; Fold-change: 0.236878266; Z-score: 1.624720324
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Peripheral neuroectodermal tumour	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Moderate hypermethylation of ABCA4 in peripheral neuroectodermal tumour than that in healthy individual
Studied Phenotype	Peripheral neuroectodermal tumour [ICD-11:2B52]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 1.10E-08; Fold-change: 0.210296803; Z-score: 1.672611175
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Cerebral hemispheric glioma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Moderate hypomethylation of ABCA4 in cerebral hemispheric glioma than that in healthy individual
Studied Phenotype	Cerebral hemispheric glioma [ICD-11:2A00.5]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 0.019878972; Fold-change: -0.216225131; Z-score: -1.248388168
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Esthesioneuroblastoma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Moderate hypomethylation of ABCA4 in esthesioneuroblastoma than that in healthy individual
Studied Phenotype	Esthesioneuroblastoma [ICD-11:2D50.1]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 1.39E-13; Fold-change: -0.271965996; Z-score: -2.235223894
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Pituitary adenoma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Moderate hypomethylation of ABCA4 in pituitary adenoma than that in healthy individual
Studied Phenotype	Pituitary adenoma [ICD-11:2F37]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 1.49E-06; Fold-change: -0.2262136; Z-score: -4.427799828
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Medulloblastoma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Significant hypomethylation of ABCA4 in medulloblastoma than that in healthy individual
Studied Phenotype	Medulloblastoma [ICD-11:2A00.10]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 5.58E-65; Fold-change: -0.690513994; Z-score: -3.86036073
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Gastric cancer	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Moderate hypermethylation of ABCA4 in gastric cancer than that in adjacent tissue
Studied Phenotype	Gastric cancer [ICD-11:2B72]
The Methylation Level of Disease Section Compare with the Adjacent Tissue	p-value: 0.02387577; Fold-change: 0.206851018; Z-score: 3.808209408
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue adjacent to the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data of patients in the normal section of the tissue adjacent to the disease section Download DT methylation data in the tissue of healthy individual
Renal cell carcinoma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Moderate hypomethylation of ABCA4 in renal cell carcinoma than that in adjacent tissue
Studied Phenotype	Renal cell carcinoma [ICD-11:2C90]
The Methylation Level of Disease Section Compare with the Adjacent Tissue	p-value: 2.23E-10; Fold-change: -0.249053986; Z-score: -3.393909641
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals DT methylation level in tissue other than the diseased tissue of patients
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual Download DT methylation data in the tissue of the other disease section
microRNA
Unclear Phenotype	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	miR-335 directly targets ABCA4			[ 14 ]
Epigenetic Type	microRNA	Experiment Method	Microarray
miRNA Stemloop ID	miR-335	miRNA Mature ID	miR-335-5p
miRNA Sequence	UCAAGAGCAAUAACGAAAAAUGU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human

References
1	DNA Methylation Dynamics in Urological Tumors.
2	Genome-wide Scan for Methylation Profiles in Breast Cancer
3	Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
4	Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
5	HIV-1 Infection Accelerates Age According to the Epigenetic Clock. J Infect Dis. 2015 Nov 15;212(10):1563-73.
6	DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
7	Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
8	DNA Methylation signatures in panic disorder. Transl Psychiatry. 2017 Dec 18;7(12):1287.
9	Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
10	Reducing the risk of false discovery enabling identification of biologically significant genome-wide methylation status using the HumanMethylation450 array. BMC Genomics. 2014 Jan 22;15:51.
11	Atypical Teratoid/Rhabdoid Tumors Are Comprised of Three Epigenetic Subgroups with Distinct Enhancer Landscapes. Cancer Cell. 2016 Mar 14;29(3):379-393.
12	DNA methylation and inflammation marker profiles associated with a history of depression. Hum Mol Genet. 2018 Aug 15;27(16):2840-2850.
13	Genome-wide DNA methylation analysis of systemic lupus erythematosus reveals persistent hypomethylation of interferon genes and compositional changes to CD4+ T-cell populations. PLoS Genet. 2013;9(8):e1003678.
14	Endogenous human microRNAs that suppress breast cancer metastasis. Nature. 2008 Jan 10;451(7175):147-52.

If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.

Detail Information of Epigenetic Regulations

Visitor Map

Correspondence