Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID DTD0043 Transporter Info
Gene Name ABCA5
Transporter Name ATP-binding cassette sub-family A member 5
Gene ID
23461
UniProt ID
Q8WWZ7
Epigenetic Regulations of This DT (EGR)

Methylation

  Atypical teratoid rhabdoid tumor

            4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of ABCA5 in atypical teratoid rhabdoid tumor [ 1 ]

Location

 5'UTR (cg06001310)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -2.72E+00 Statistic Test p-value: 5.14E-08; Z-score: -1.94E+00

Methylation in Case

 1.68E-01 (Median) Methylation in Control 4.56E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of ABCA5 in atypical teratoid rhabdoid tumor [ 1 ]

Location

 5'UTR (cg09530790)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.62E+00 Statistic Test p-value: 1.80E-07; Z-score: -1.64E+00

Methylation in Case

 3.57E-01 (Median) Methylation in Control 5.80E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of ABCA5 in atypical teratoid rhabdoid tumor [ 1 ]

Location

 5'UTR (cg17302455)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.08E+00 Statistic Test p-value: 1.92E-06; Z-score: -9.97E-01

Methylation in Case

 8.46E-01 (Median) Methylation in Control 9.10E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of ABCA5 in atypical teratoid rhabdoid tumor [ 1 ]

Location

 5'UTR (cg24127866)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.14E+00 Statistic Test p-value: 7.95E-06; Z-score: -1.30E+00

Methylation in Case

 7.40E-01 (Median) Methylation in Control 8.47E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Bladder cancer

            4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of ABCA5 in bladder cancer [ 2 ]

Location

 5'UTR (cg17302455)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.14E+00 Statistic Test p-value: 5.37E-05; Z-score: -2.94E+00

Methylation in Case

 7.52E-01 (Median) Methylation in Control 8.54E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of ABCA5 in bladder cancer [ 2 ]

Location

 5'UTR (cg09530790)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.48E+00 Statistic Test p-value: 5.55E-03; Z-score: -2.25E+00

Methylation in Case

 5.56E-02 (Median) Methylation in Control 8.23E-02 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of ABCA5 in bladder cancer [ 2 ]

Location

 TSS1500 (cg06409153)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -2.15E+00 Statistic Test p-value: 4.93E-05; Z-score: -5.30E+00

Methylation in Case

 9.95E-02 (Median) Methylation in Control 2.14E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of ABCA5 in bladder cancer [ 2 ]

Location

 TSS1500 (cg10187674)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -2.03E+00 Statistic Test p-value: 9.93E-04; Z-score: -3.16E+00

Methylation in Case

 1.02E-01 (Median) Methylation in Control 2.08E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Breast cancer

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of ABCA5 in breast cancer [ 3 ]

Location

 5'UTR (cg09530790)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.64E+00 Statistic Test p-value: 2.59E-08; Z-score: 1.76E+00

Methylation in Case

 9.07E-02 (Median) Methylation in Control 5.55E-02 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of ABCA5 in breast cancer [ 3 ]

Location

 5'UTR (cg17302455)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.04E+00 Statistic Test p-value: 5.30E-07; Z-score: -9.42E-01

Methylation in Case

 8.55E-01 (Median) Methylation in Control 8.90E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Renal cell carcinoma

            3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of ABCA5 in clear cell renal cell carcinoma [ 4 ]

Location

 5'UTR (cg09530790)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.79E+00 Statistic Test p-value: 9.87E-05; Z-score: 1.14E+00

Methylation in Case

 3.90E-02 (Median) Methylation in Control 2.19E-02 (Median)

Studied Phenotype

 Renal cell carcinoma [ ICD-11: 2C90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of ABCA5 in clear cell renal cell carcinoma [ 4 ]

Location

 5'UTR (cg24127866)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.21E+00 Statistic Test p-value: 2.00E-04; Z-score: 9.69E-01

Methylation in Case

 2.76E-02 (Median) Methylation in Control 2.28E-02 (Median)

Studied Phenotype

 Renal cell carcinoma [ ICD-11: 2C90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of ABCA5 in clear cell renal cell carcinoma [ 4 ]

Location

 TSS1500 (cg08197943)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.11E+00 Statistic Test p-value: 7.47E-03; Z-score: 4.63E-01

Methylation in Case

 1.80E-02 (Median) Methylation in Control 1.63E-02 (Median)

Studied Phenotype

 Renal cell carcinoma [ ICD-11: 2C90]

Experimental Material

 Patient tissue samples

  Colorectal cancer

            3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of ABCA5 in colorectal cancer [ 5 ]

Location

 5'UTR (cg17302455)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.02E+00 Statistic Test p-value: 3.85E-05; Z-score: -1.90E+00

Methylation in Case

 9.06E-01 (Median) Methylation in Control 9.28E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of ABCA5 in colorectal cancer [ 5 ]

Location

 TSS1500 (cg00803816)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.02E+00 Statistic Test p-value: 3.22E-02; Z-score: 1.04E-01

Methylation in Case

 9.14E-02 (Median) Methylation in Control 8.99E-02 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Hepatocellular carcinoma

            5 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of ABCA5 in hepatocellular carcinoma [ 6 ]

Location

 5'UTR (cg09530790)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.34E+00 Statistic Test p-value: 3.76E-06; Z-score: -9.05E-01

Methylation in Case

 8.97E-02 (Median) Methylation in Control 1.20E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of ABCA5 in hepatocellular carcinoma [ 6 ]

Location

 5'UTR (cg17302455)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.02E+00 Statistic Test p-value: 2.38E-03; Z-score: -4.39E-01

Methylation in Case

 8.35E-01 (Median) Methylation in Control 8.51E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of ABCA5 in hepatocellular carcinoma [ 6 ]

Location

 TSS200 (cg07039560)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.40E+00 Statistic Test p-value: 4.00E-21; Z-score: 2.69E+00

Methylation in Case

 7.29E-01 (Median) Methylation in Control 5.20E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of ABCA5 in hepatocellular carcinoma [ 6 ]

Location

 Body (cg11557546)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.52E+00 Statistic Test p-value: 2.86E-17; Z-score: -4.69E+00

Methylation in Case

 3.70E-01 (Median) Methylation in Control 5.63E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of ABCA5 in hepatocellular carcinoma [ 6 ]

Location

 Body (cg08411738)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.23E+00 Statistic Test p-value: 3.07E-11; Z-score: -2.99E+00

Methylation in Case

 6.57E-01 (Median) Methylation in Control 8.11E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  HIV infection

            3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of ABCA5 in HIV infection [ 7 ]

Location

 5'UTR (cg09530790)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.28E+00 Statistic Test p-value: 8.66E-05; Z-score: 1.06E+00

Methylation in Case

 2.44E-01 (Median) Methylation in Control 1.90E-01 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of ABCA5 in HIV infection [ 7 ]

Location

 5'UTR (cg06001310)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.23E+00 Statistic Test p-value: 5.96E-03; Z-score: 1.04E+00

Methylation in Case

 4.37E-02 (Median) Methylation in Control 3.55E-02 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of ABCA5 in HIV infection [ 7 ]

Location

 TSS1500 (cg10187674)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.13E+00 Statistic Test p-value: 1.14E-02; Z-score: 5.98E-01

Methylation in Case

 1.89E-01 (Median) Methylation in Control 1.66E-01 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Lung adenocarcinoma

            3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of ABCA5 in lung adenocarcinoma [ 8 ]

Location

 5'UTR (cg09530790)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.28E+00 Statistic Test p-value: 3.15E-02; Z-score: 1.71E+00

Methylation in Case

 2.20E-01 (Median) Methylation in Control 1.72E-01 (Median)

Studied Phenotype

 Lung adenocarcinoma [ ICD-11: 2C25.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of ABCA5 in lung adenocarcinoma [ 8 ]

Location

 TSS1500 (cg06409153)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.41E+00 Statistic Test p-value: 1.92E-03; Z-score: -1.90E+00

Methylation in Case

 2.62E-01 (Median) Methylation in Control 3.68E-01 (Median)

Studied Phenotype

 Lung adenocarcinoma [ ICD-11: 2C25.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of ABCA5 in lung adenocarcinoma [ 8 ]

Location

 TSS1500 (cg10187674)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.34E+00 Statistic Test p-value: 5.55E-03; Z-score: -1.74E+00

Methylation in Case

 2.94E-01 (Median) Methylation in Control 3.95E-01 (Median)

Studied Phenotype

 Lung adenocarcinoma [ ICD-11: 2C25.0]

Experimental Material

 Patient tissue samples

  Pancretic ductal adenocarcinoma

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of ABCA5 in pancretic ductal adenocarcinoma [ 9 ]

Location

 5'UTR (cg23189044)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.69E+00 Statistic Test p-value: 1.59E-15; Z-score: -2.33E+00

Methylation in Case

 1.70E-01 (Median) Methylation in Control 2.86E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Panic disorder

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of ABCA5 in panic disorder [ 10 ]

Location

 TSS1500 (cg10187674)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -9.53E-01 Statistic Test p-value: 3.87E-02; Z-score: -3.71E-01

Methylation in Case

 -3.07E+00 (Median) Methylation in Control -2.92E+00 (Median)

Studied Phenotype

 Panic disorder [ ICD-11: 6B01]

Experimental Material

 Patient tissue samples

  Papillary thyroid cancer

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of ABCA5 in papillary thyroid cancer [ 11 ]

Location

 TSS1500 (cg00803816)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.04E+00 Statistic Test p-value: 3.55E-02; Z-score: 3.01E-01

Methylation in Case

 4.48E-02 (Median) Methylation in Control 4.29E-02 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Colon cancer

            3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of ABCA5 in colon adenocarcinoma [ 12 ]

Location

 1stExon (cg13694749)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.26E+00 Statistic Test p-value: 3.04E-05; Z-score: -4.15E+00

Methylation in Case

 6.17E-01 (Median) Methylation in Control 7.75E-01 (Median)

Studied Phenotype

 Colon cancer [ ICD-11: 2B90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of ABCA5 in colon adenocarcinoma [ 12 ]

Location

 Body (cg00905417)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.12E+00 Statistic Test p-value: 5.75E-05; Z-score: -2.93E+00

Methylation in Case

 7.43E-01 (Median) Methylation in Control 8.35E-01 (Median)

Studied Phenotype

 Colon cancer [ ICD-11: 2B90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of ABCA5 in colon adenocarcinoma [ 12 ]

Location

 Body (cg14673267)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.05E+00 Statistic Test p-value: 1.14E-03; Z-score: -2.32E+00

Methylation in Case

 8.99E-01 (Median) Methylation in Control 9.41E-01 (Median)

Studied Phenotype

 Colon cancer [ ICD-11: 2B90]

Experimental Material

 Patient tissue samples

  Prostate cancer

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of ABCA5 in prostate cancer [ 13 ]

Location

 3'UTR (cg16038327)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.26E+00 Statistic Test p-value: 4.49E-02; Z-score: -2.54E+00

Methylation in Case

 6.41E-01 (Median) Methylation in Control 8.06E-01 (Median)

Studied Phenotype

 Prostate cancer [ ICD-11: 2C82]

Experimental Material

 Patient tissue samples

  Third ventricle chordoid glioma

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Moderate hypomethylation of ABCA5 in third ventricle chordoid glioma than that in healthy individual

Studied Phenotype

 Third ventricle chordoid glioma [ICD-11:2A00.0Y]

The Methylation Level of Disease Section Compare with the Healthy Individual

 p-value: 0.021335972; Fold-change: -0.298085831; Z-score: -0.932991457
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue
Download DT methylation data in the tissue of healthy individual

  Posterior fossa ependymoma

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Significant hypomethylation of ABCA5 in posterior fossa ependymoma than that in healthy individual

Studied Phenotype

 Posterior fossa ependymoma [ICD-11:2D50.2]

The Methylation Level of Disease Section Compare with the Healthy Individual

 p-value: 2.94E-119; Fold-change: -0.659182878; Z-score: -4.314305674
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue
Download DT methylation data in the tissue of healthy individual

  RELA YAP fusion ependymoma

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Significant hypomethylation of ABCA5 in rela yap fusion ependymoma than that in healthy individual

Studied Phenotype

 RELA YAP fusion ependymoma [ICD-11:2A00.0Y]

The Methylation Level of Disease Section Compare with the Healthy Individual

 p-value: 2.80E-47; Fold-change: -0.616884535; Z-score: -3.735193305
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue
Download DT methylation data in the tissue of healthy individual

  Spinal ependymoma

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Significant hypomethylation of ABCA5 in spinal ependymoma than that in healthy individual

Studied Phenotype

 Spinal ependymoma [ICD-11:2A00.0Y]

The Methylation Level of Disease Section Compare with the Healthy Individual

 p-value: 7.55E-21; Fold-change: -0.637107411; Z-score: -2.834198952
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue
Download DT methylation data in the tissue of healthy individual

microRNA

  Unclear Phenotype

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 miR-335 directly targets ABCA5 [ 14 ]

Epigenetic Type

 microRNA Experiment Method Microarray

miRNA Stemloop ID

 miR-335 miRNA Mature ID miR-335-5p

miRNA Sequence

 UCAAGAGCAAUAACGAAAAAUGU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human
References
1 Atypical Teratoid/Rhabdoid Tumors Are Comprised of Three Epigenetic Subgroups with Distinct Enhancer Landscapes. Cancer Cell. 2016 Mar 14;29(3):379-393.
2 DNA Methylation Dynamics in Urological Tumors.
3 Genome-wide Scan for Methylation Profiles in Breast Cancer
4 A CpG-methylation-based assay to predict survival in clear cell renal cell carcinoma. Nat Commun. 2015 Oct 30;6:8699.
5 Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
6 Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
7 HIV-1 Infection Accelerates Age According to the Epigenetic Clock. J Infect Dis. 2015 Nov 15;212(10):1563-73.
8 DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
9 Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
10 DNA Methylation signatures in panic disorder. Transl Psychiatry. 2017 Dec 18;7(12):1287.
11 Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
12 Genome-scale analysis of DNA methylation in colorectal cancer using Infinium HumanMethylation450 BeadChips. Epigenetics. 2013 Sep;8(9):921-34.
13 Reducing the risk of false discovery enabling identification of biologically significant genome-wide methylation status using the HumanMethylation450 array. BMC Genomics. 2014 Jan 22;15:51.
14 Endogenous human microRNAs that suppress breast cancer metastasis. Nature. 2008 Jan 10;451(7175):147-52.

If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.