Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID DTD0046 Transporter Info
Gene Name ABCA8
Transporter Name ATP-binding cassette sub-family A member 8
Gene ID
10351
UniProt ID
O94911
Epigenetic Regulations of This DT (EGR)

Methylation

  Atypical teratoid rhabdoid tumor

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of ABCA8 in atypical teratoid rhabdoid tumor [ 1 ]

Location

 5'UTR (cg03850529)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.40E+00 Statistic Test p-value: 2.03E-08; Z-score: 1.57E+00

Methylation in Case

 7.82E-01 (Median) Methylation in Control 5.59E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of ABCA8 in atypical teratoid rhabdoid tumor [ 1 ]

Location

 5'UTR (cg21660392)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.22E+00 Statistic Test p-value: 5.47E-06; Z-score: 1.32E+00

Methylation in Case

 8.49E-01 (Median) Methylation in Control 6.95E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Bladder cancer

            4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of ABCA8 in bladder cancer [ 2 ]

Location

 5'UTR (cg03850529)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.07E+00 Statistic Test p-value: 1.07E-05; Z-score: -5.36E+00

Methylation in Case

 8.36E-01 (Median) Methylation in Control 8.96E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of ABCA8 in bladder cancer [ 2 ]

Location

 5'UTR (cg21660392)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.21E+00 Statistic Test p-value: 7.09E-03; Z-score: 2.60E+00

Methylation in Case

 6.99E-01 (Median) Methylation in Control 5.80E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of ABCA8 in bladder cancer [ 2 ]

Location

 TSS200 (cg27464144)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.18E+00 Statistic Test p-value: 2.01E-02; Z-score: 1.07E+00

Methylation in Case

 5.01E-01 (Median) Methylation in Control 4.23E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of ABCA8 in bladder cancer [ 2 ]

Location

 Body (cg20561863)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -3.99E+00 Statistic Test p-value: 9.03E-04; Z-score: -3.23E+00

Methylation in Case

 7.88E-02 (Median) Methylation in Control 3.14E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Breast cancer

            4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of ABCA8 in breast cancer [ 3 ]

Location

 5'UTR (cg03850529)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.08E+00 Statistic Test p-value: 1.25E-10; Z-score: -3.86E+00

Methylation in Case

 8.35E-01 (Median) Methylation in Control 9.01E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of ABCA8 in breast cancer [ 3 ]

Location

 Body (cg17334372)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.11E+00 Statistic Test p-value: 4.93E-12; Z-score: -2.70E+00

Methylation in Case

 8.04E-01 (Median) Methylation in Control 8.95E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of ABCA8 in breast cancer [ 3 ]

Location

 Body (cg17461670)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.09E+00 Statistic Test p-value: 5.21E-11; Z-score: -2.83E+00

Methylation in Case

 8.07E-01 (Median) Methylation in Control 8.77E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of ABCA8 in breast cancer [ 3 ]

Location

 Body (cg20561863)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.67E+00 Statistic Test p-value: 4.41E-08; Z-score: 2.19E+00

Methylation in Case

 2.24E-01 (Median) Methylation in Control 1.34E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Colorectal cancer

            5 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of ABCA8 in colorectal cancer [ 4 ]

Location

 5'UTR (cg21660392)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.11E+00 Statistic Test p-value: 4.71E-07; Z-score: -2.37E+00

Methylation in Case

 7.56E-01 (Median) Methylation in Control 8.39E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of ABCA8 in colorectal cancer [ 4 ]

Location

 5'UTR (cg03850529)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.00E+00 Statistic Test p-value: 3.07E-03; Z-score: -1.07E-01

Methylation in Case

 9.44E-01 (Median) Methylation in Control 9.44E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of ABCA8 in colorectal cancer [ 4 ]

Location

 Body (cg20561863)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.75E+00 Statistic Test p-value: 1.16E-09; Z-score: -2.47E+00

Methylation in Case

 3.45E-01 (Median) Methylation in Control 6.05E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of ABCA8 in colorectal cancer [ 4 ]

Location

 Body (cg17461670)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.03E+00 Statistic Test p-value: 9.02E-06; Z-score: -1.72E+00

Methylation in Case

 9.01E-01 (Median) Methylation in Control 9.26E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of ABCA8 in colorectal cancer [ 4 ]

Location

 Body (cg17334372)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.01E+00 Statistic Test p-value: 9.25E-04; Z-score: -5.19E-01

Methylation in Case

 8.97E-01 (Median) Methylation in Control 9.07E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  HIV infection

            4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of ABCA8 in HIV infection [ 5 ]

Location

 5'UTR (cg21660392)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.00E+00 Statistic Test p-value: 4.12E-02; Z-score: -2.06E-01

Methylation in Case

 9.05E-01 (Median) Methylation in Control 9.08E-01 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of ABCA8 in HIV infection [ 5 ]

Location

 TSS200 (cg27464144)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.03E+00 Statistic Test p-value: 2.83E-03; Z-score: -1.00E+00

Methylation in Case

 8.69E-01 (Median) Methylation in Control 8.96E-01 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of ABCA8 in HIV infection [ 5 ]

Location

 Body (cg20561863)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.68E+00 Statistic Test p-value: 2.06E-06; Z-score: 2.84E+00

Methylation in Case

 3.45E-01 (Median) Methylation in Control 2.06E-01 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of ABCA8 in HIV infection [ 5 ]

Location

 Body (cg17334372)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.04E+00 Statistic Test p-value: 3.86E-02; Z-score: -6.34E-01

Methylation in Case

 8.45E-01 (Median) Methylation in Control 8.76E-01 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Panic disorder

            4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of ABCA8 in panic disorder [ 6 ]

Location

 5'UTR (cg03850529)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.19E+00 Statistic Test p-value: 1.65E-04; Z-score: -6.51E-01

Methylation in Case

 1.61E+00 (Median) Methylation in Control 1.92E+00 (Median)

Studied Phenotype

 Panic disorder [ ICD-11: 6B01]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of ABCA8 in panic disorder [ 6 ]

Location

 5'UTR (cg21660392)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.09E+00 Statistic Test p-value: 3.72E-02; Z-score: -3.58E-01

Methylation in Case

 1.92E+00 (Median) Methylation in Control 2.09E+00 (Median)

Studied Phenotype

 Panic disorder [ ICD-11: 6B01]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of ABCA8 in panic disorder [ 6 ]

Location

 TSS200 (cg27464144)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.98E+00 Statistic Test p-value: 3.64E-04; Z-score: -6.84E-01

Methylation in Case

 3.01E-01 (Median) Methylation in Control 5.97E-01 (Median)

Studied Phenotype

 Panic disorder [ ICD-11: 6B01]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of ABCA8 in panic disorder [ 6 ]

Location

 Body (cg17334372)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -8.18E-01 Statistic Test p-value: 6.00E-03; Z-score: -3.39E-01

Methylation in Case

 -5.81E-01 (Median) Methylation in Control -4.75E-01 (Median)

Studied Phenotype

 Panic disorder [ ICD-11: 6B01]

Experimental Material

 Patient tissue samples

  Papillary thyroid cancer

            3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of ABCA8 in papillary thyroid cancer [ 7 ]

Location

 5'UTR (cg21660392)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.03E+00 Statistic Test p-value: 1.04E-04; Z-score: 9.25E-01

Methylation in Case

 8.62E-01 (Median) Methylation in Control 8.35E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of ABCA8 in papillary thyroid cancer [ 7 ]

Location

 Body (cg20561863)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.68E+00 Statistic Test p-value: 5.40E-19; Z-score: -3.00E+00

Methylation in Case

 3.45E-01 (Median) Methylation in Control 5.82E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of ABCA8 in papillary thyroid cancer [ 7 ]

Location

 Body (cg17334372)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.02E+00 Statistic Test p-value: 2.44E-03; Z-score: -5.49E-01

Methylation in Case

 8.81E-01 (Median) Methylation in Control 8.96E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Prostate cancer

            4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of ABCA8 in prostate cancer [ 8 ]

Location

 5'UTR (cg23671196)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.09E+00 Statistic Test p-value: 2.35E-02; Z-score: 2.18E+00

Methylation in Case

 9.25E-01 (Median) Methylation in Control 8.47E-01 (Median)

Studied Phenotype

 Prostate cancer [ ICD-11: 2C82]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of ABCA8 in prostate cancer [ 8 ]

Location

 TSS1500 (cg14664759)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 3.74E+00 Statistic Test p-value: 2.13E-02; Z-score: 1.16E+01

Methylation in Case

 4.42E-01 (Median) Methylation in Control 1.18E-01 (Median)

Studied Phenotype

 Prostate cancer [ ICD-11: 2C82]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of ABCA8 in prostate cancer [ 8 ]

Location

 Body (cg18629527)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.54E+00 Statistic Test p-value: 4.89E-02; Z-score: -1.70E+00

Methylation in Case

 1.30E-01 (Median) Methylation in Control 2.01E-01 (Median)

Studied Phenotype

 Prostate cancer [ ICD-11: 2C82]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of ABCA8 in prostate cancer [ 8 ]

Location

 3'UTR (cg01442319)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.17E+00 Statistic Test p-value: 1.63E-02; Z-score: 2.31E+00

Methylation in Case

 8.64E-01 (Median) Methylation in Control 7.37E-01 (Median)

Studied Phenotype

 Prostate cancer [ ICD-11: 2C82]

Experimental Material

 Patient tissue samples

  Hepatocellular carcinoma

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of ABCA8 in hepatocellular carcinoma [ 9 ]

Location

 TSS200 (cg27464144)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.29E+00 Statistic Test p-value: 3.76E-05; Z-score: -1.43E+00

Methylation in Case

 3.65E-01 (Median) Methylation in Control 4.70E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of ABCA8 in hepatocellular carcinoma [ 9 ]

Location

 Body (cg12949769)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.48E+00 Statistic Test p-value: 2.46E-15; Z-score: -5.56E+00

Methylation in Case

 5.09E-01 (Median) Methylation in Control 7.54E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Systemic lupus erythematosus

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of ABCA8 in systemic lupus erythematosus [ 10 ]

Location

 TSS200 (cg27464144)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.01E+00 Statistic Test p-value: 4.77E-02; Z-score: -1.50E-01

Methylation in Case

 8.66E-01 (Median) Methylation in Control 8.73E-01 (Median)

Studied Phenotype

 Systemic lupus erythematosus [ ICD-11: 4A40.0]

Experimental Material

 Patient tissue samples

  Lung adenocarcinoma

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of ABCA8 in lung adenocarcinoma [ 11 ]

Location

 Body (cg20561863)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.26E+00 Statistic Test p-value: 9.66E-03; Z-score: -1.23E+00

Methylation in Case

 3.46E-01 (Median) Methylation in Control 4.36E-01 (Median)

Studied Phenotype

 Lung adenocarcinoma [ ICD-11: 2C25.0]

Experimental Material

 Patient tissue samples

microRNA

  Unclear Phenotype

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 miR-192 directly targets ABCA8 [ 12 ]

Epigenetic Type

 microRNA Experiment Method Microarray

miRNA Stemloop ID

 miR-192 miRNA Mature ID miR-192-5p

miRNA Sequence

 CUGACCUAUGAAUUGACAGCC

miRNA Target Type

 Direct

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 miR-335 directly targets ABCA8 [ 13 ]

Epigenetic Type

 microRNA Experiment Method Microarray

miRNA Stemloop ID

 miR-335 miRNA Mature ID miR-335-5p

miRNA Sequence

 UCAAGAGCAAUAACGAAAAAUGU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human
References
1 Atypical Teratoid/Rhabdoid Tumors Are Comprised of Three Epigenetic Subgroups with Distinct Enhancer Landscapes. Cancer Cell. 2016 Mar 14;29(3):379-393.
2 DNA Methylation Dynamics in Urological Tumors.
3 Genome-wide Scan for Methylation Profiles in Breast Cancer
4 Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
5 HIV-1 Infection Accelerates Age According to the Epigenetic Clock. J Infect Dis. 2015 Nov 15;212(10):1563-73.
6 DNA Methylation signatures in panic disorder. Transl Psychiatry. 2017 Dec 18;7(12):1287.
7 Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
8 Reducing the risk of false discovery enabling identification of biologically significant genome-wide methylation status using the HumanMethylation450 array. BMC Genomics. 2014 Jan 22;15:51.
9 Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
10 Genome-wide DNA methylation analysis of systemic lupus erythematosus reveals persistent hypomethylation of interferon genes and compositional changes to CD4+ T-cell populations. PLoS Genet. 2013;9(8):e1003678.
11 DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
12 A limited set of human MicroRNA is deregulated in follicular thyroid carcinoma. J Clin Endocrinol Metab. 2006 Sep;91(9):3584-91.
13 Endogenous human microRNAs that suppress breast cancer metastasis. Nature. 2008 Jan 10;451(7175):147-52.

If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.