Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID DTD0051 Transporter Info
Gene Name ABCB5
Transporter Name ATP-binding cassette sub-family B member 5
Gene ID
340273
UniProt ID
Q2M3G0
Epigenetic Regulations of This DT (EGR)

Methylation

  Atypical teratoid rhabdoid tumor

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of ABCB5 in atypical teratoid rhabdoid tumor [ 1 ]

Location

 5'UTR (cg21202529)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.03E+00 Statistic Test p-value: 5.13E-06; Z-score: -7.76E-01

Methylation in Case

 8.72E-01 (Median) Methylation in Control 8.96E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Bladder cancer

            4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of ABCB5 in bladder cancer [ 2 ]

Location

 5'UTR (cg21202529)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.28E+00 Statistic Test p-value: 2.02E-03; Z-score: -2.73E+00

Methylation in Case

 6.75E-01 (Median) Methylation in Control 8.66E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of ABCB5 in bladder cancer [ 2 ]

Location

 TSS1500 (cg20966504)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.54E+00 Statistic Test p-value: 1.36E-07; Z-score: -1.44E+01

Methylation in Case

 5.50E-01 (Median) Methylation in Control 8.49E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of ABCB5 in bladder cancer [ 2 ]

Location

 TSS1500 (cg08888968)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.03E+00 Statistic Test p-value: 5.20E-03; Z-score: -2.66E+00

Methylation in Case

 8.94E-01 (Median) Methylation in Control 9.19E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of ABCB5 in bladder cancer [ 2 ]

Location

 TSS200 (cg14878128)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.81E+00 Statistic Test p-value: 2.58E-03; Z-score: -2.40E+00

Methylation in Case

 4.05E-01 (Median) Methylation in Control 7.32E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Breast cancer

            4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of ABCB5 in breast cancer [ 3 ]

Location

 5'UTR (cg21202529)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.01E+00 Statistic Test p-value: 3.27E-03; Z-score: -2.21E-01

Methylation in Case

 8.76E-01 (Median) Methylation in Control 8.83E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of ABCB5 in breast cancer [ 3 ]

Location

 TSS1500 (cg20966504)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.19E+00 Statistic Test p-value: 2.85E-07; Z-score: 1.64E+00

Methylation in Case

 7.63E-01 (Median) Methylation in Control 6.44E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of ABCB5 in breast cancer [ 3 ]

Location

 TSS1500 (cg08888968)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.02E+00 Statistic Test p-value: 3.06E-02; Z-score: -3.33E-01

Methylation in Case

 8.98E-01 (Median) Methylation in Control 9.11E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of ABCB5 in breast cancer [ 3 ]

Location

 TSS200 (cg14878128)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.10E+00 Statistic Test p-value: 2.59E-02; Z-score: 5.34E-01

Methylation in Case

 5.70E-01 (Median) Methylation in Control 5.17E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Colorectal cancer

            5 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of ABCB5 in colorectal cancer [ 4 ]

Location

 5'UTR (cg21202529)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.05E+00 Statistic Test p-value: 2.47E-02; Z-score: -6.03E-01

Methylation in Case

 7.86E-01 (Median) Methylation in Control 8.25E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of ABCB5 in colorectal cancer [ 4 ]

Location

 TSS1500 (cg20966504)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.06E+00 Statistic Test p-value: 1.41E-06; Z-score: -2.46E+00

Methylation in Case

 8.32E-01 (Median) Methylation in Control 8.81E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of ABCB5 in colorectal cancer [ 4 ]

Location

 TSS1500 (cg08888968)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.01E+00 Statistic Test p-value: 4.37E-04; Z-score: -8.45E-01

Methylation in Case

 9.52E-01 (Median) Methylation in Control 9.58E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of ABCB5 in colorectal cancer [ 4 ]

Location

 TSS200 (cg14878128)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.19E+00 Statistic Test p-value: 9.82E-05; Z-score: -1.46E+00

Methylation in Case

 6.41E-01 (Median) Methylation in Control 7.65E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Hepatocellular carcinoma

            3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of ABCB5 in hepatocellular carcinoma [ 5 ]

Location

 5'UTR (cg21202529)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.28E+00 Statistic Test p-value: 1.06E-08; Z-score: -2.27E+00

Methylation in Case

 6.13E-01 (Median) Methylation in Control 7.83E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of ABCB5 in hepatocellular carcinoma [ 5 ]

Location

 TSS1500 (cg08888968)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.15E+00 Statistic Test p-value: 2.45E-09; Z-score: -3.23E+00

Methylation in Case

 7.57E-01 (Median) Methylation in Control 8.67E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of ABCB5 in hepatocellular carcinoma [ 5 ]

Location

 TSS200 (cg14878128)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.45E+00 Statistic Test p-value: 4.79E-07; Z-score: -1.36E+00

Methylation in Case

 3.63E-01 (Median) Methylation in Control 5.26E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  HIV infection

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of ABCB5 in HIV infection [ 6 ]

Location

 5'UTR (cg21202529)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.01E+00 Statistic Test p-value: 3.87E-02; Z-score: 3.92E-01

Methylation in Case

 9.51E-01 (Median) Methylation in Control 9.43E-01 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Pancretic ductal adenocarcinoma

            4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of ABCB5 in pancretic ductal adenocarcinoma [ 7 ]

Location

 5'UTR (cg19300741)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.56E+00 Statistic Test p-value: 4.99E-18; Z-score: 2.96E+00

Methylation in Case

 2.96E-01 (Median) Methylation in Control 1.90E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of ABCB5 in pancretic ductal adenocarcinoma [ 7 ]

Location

 Body (cg24151995)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.10E+00 Statistic Test p-value: 4.46E-04; Z-score: 6.95E-01

Methylation in Case

 3.15E-01 (Median) Methylation in Control 2.87E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of ABCB5 in pancretic ductal adenocarcinoma [ 7 ]

Location

 Body (cg23244463)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.00E+00 Statistic Test p-value: 9.61E-03; Z-score: -6.03E-02

Methylation in Case

 8.07E-01 (Median) Methylation in Control 8.10E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of ABCB5 in pancretic ductal adenocarcinoma [ 7 ]

Location

 Body (cg16793755)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.08E+00 Statistic Test p-value: 1.26E-02; Z-score: 6.60E-01

Methylation in Case

 7.47E-01 (Median) Methylation in Control 6.94E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Systemic lupus erythematosus

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of ABCB5 in systemic lupus erythematosus [ 8 ]

Location

 5'UTR (cg21202529)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.00E+00 Statistic Test p-value: 3.65E-02; Z-score: -1.52E-01

Methylation in Case

 9.34E-01 (Median) Methylation in Control 9.37E-01 (Median)

Studied Phenotype

 Systemic lupus erythematosus [ ICD-11: 4A40.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of ABCB5 in systemic lupus erythematosus [ 8 ]

Location

 TSS1500 (cg20966504)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.01E+00 Statistic Test p-value: 8.28E-03; Z-score: -2.96E-01

Methylation in Case

 9.07E-01 (Median) Methylation in Control 9.14E-01 (Median)

Studied Phenotype

 Systemic lupus erythematosus [ ICD-11: 4A40.0]

Experimental Material

 Patient tissue samples

  Panic disorder

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of ABCB5 in panic disorder [ 9 ]

Location

 TSS1500 (cg20966504)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.03E+00 Statistic Test p-value: 8.73E-03; Z-score: -1.91E-01

Methylation in Case

 2.61E+00 (Median) Methylation in Control 2.68E+00 (Median)

Studied Phenotype

 Panic disorder [ ICD-11: 6B01]

Experimental Material

 Patient tissue samples

  Papillary thyroid cancer

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of ABCB5 in papillary thyroid cancer [ 10 ]

Location

 TSS200 (cg14878128)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.07E+00 Statistic Test p-value: 4.19E-03; Z-score: -5.96E-01

Methylation in Case

 7.02E-01 (Median) Methylation in Control 7.52E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Esthesioneuroblastoma

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Moderate hypomethylation of ABCB5 in esthesioneuroblastoma than that in healthy individual

Studied Phenotype

 Esthesioneuroblastoma [ICD-11:2D50.1]

The Methylation Level of Disease Section Compare with the Healthy Individual

 p-value: 2.97E-06; Fold-change: -0.231921153; Z-score: -1.8149088
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue
Download DT methylation data in the tissue of healthy individual

  Melanocytoma

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Significant hypomethylation of ABCB5 in melanocytoma than that in healthy individual

Studied Phenotype

 Melanocytoma [ICD-11:2F36.2]

The Methylation Level of Disease Section Compare with the Healthy Individual

 p-value: 2.84E-16; Fold-change: -0.821669195; Z-score: -31.2495816
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue
Download DT methylation data in the tissue of healthy individual

microRNA

  Melanoma

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Higher expression of miR-340-5p in melanoma (compare with hypoxic conditions counterpart cells) [ 11 ]

Epigenetic Type

 microRNA Experiment Method .

Related Molecular Changes

 Down regulation of ABCB5 Experiment Method RT-qPCR

miRNA Stemloop ID

 miR-340 miRNA Mature ID miR-340-5p

miRNA Sequence

 UUAUAAAGCAAUGAGACUGAUU

miRNA Target Type

 Direct

Studied Phenotype

 Melanoma [ ICD-11: 2C30]

Experimental Material

 Patient tissue samples

Additional Notes

 Diminution of miR-340-5p levels is responsible for increased expression of ABCB5 in melanoma cells under oxygen-deprived conditions.

  Colon cancer

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Higher expression of miR-522 in colon cancer (compare with doxorubicin-resistance cells) [ 12 ]

Epigenetic Type

 microRNA Experiment Method Luciferase reporter assay

Related Molecular Changes

 Down regulation of ABCB5 Experiment Method RT-qPCR

miRNA Stemloop ID

 miR-522 miRNA Mature ID miR-522-5p

miRNA Sequence

 CUCUAGAGGGAAGCGCUUUCUG

miRNA Target Type

 Direct

Studied Phenotype

 Colon cancer [ ICD-11: 2B90]

Experimental Material

 Human colon cancer cell line (HT-29)

Additional Notes

 MicroRNA-522 reverses drug resistance of doxorubicin-induced HT29 colon cancer cell by targeting ABCB5.

  Unclear Phenotype

          28 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 miR-1 directly targets ABCB5 [ 13 ]

Epigenetic Type

 microRNA Experiment Method Microarray

miRNA Stemloop ID

 miR-1 miRNA Mature ID miR-1-3p

miRNA Sequence

 UGGAAUGUAAAGAAGUAUGUAU

miRNA Target Type

 Direct

Experimental Material

 Human cervical cancer cell line (Hela)

  Epigenetic Phenomenon 2

 miR-100 directly targets ABCB5 [ 14 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-100 miRNA Mature ID miR-100-3p

miRNA Sequence

 CAAGCUUGUAUCUAUAGGUAUG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 3

 miR-105 directly targets ABCB5 [ 15 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-105 miRNA Mature ID miR-105-5p

miRNA Sequence

 UCAAAUGCUCAGACUCCUGUGGU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 4

 miR-1304 directly targets ABCB5 [ 15 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-1304 miRNA Mature ID miR-1304-3p

miRNA Sequence

 UCUCACUGUAGCCUCGAACCCC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 5

 miR-1307 directly targets ABCB5 [ 15 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-1307 miRNA Mature ID miR-1307-3p

miRNA Sequence

 ACUCGGCGUGGCGUCGGUCGUG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 6

 miR-192 directly targets ABCB5 [ 14 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-192 miRNA Mature ID miR-192-3p

miRNA Sequence

 CUGCCAAUUCCAUAGGUCACAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 7

 miR-330 directly targets ABCB5 [ 14 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-330 miRNA Mature ID miR-330-3p

miRNA Sequence

 GCAAAGCACACGGCCUGCAGAGA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 8

 miR-3671 directly targets ABCB5 [ 15 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-3671 miRNA Mature ID miR-3671

miRNA Sequence

 AUCAAAUAAGGACUAGUCUGCA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 9

 miR-4284 directly targets ABCB5 [ 15 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4284 miRNA Mature ID miR-4284

miRNA Sequence

 GGGCUCACAUCACCCCAU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 10

 miR-4311 directly targets ABCB5 [ 14 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4311 miRNA Mature ID miR-4311

miRNA Sequence

 GAAAGAGAGCUGAGUGUG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 11

 miR-4480 directly targets ABCB5 [ 14 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4480 miRNA Mature ID miR-4480

miRNA Sequence

 AGCCAAGUGGAAGUUACUUUA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 12

 miR-4638 directly targets ABCB5 [ 15 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4638 miRNA Mature ID miR-4638-5p

miRNA Sequence

 ACUCGGCUGCGGUGGACAAGU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 13

 miR-4676 directly targets ABCB5 [ 15 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4676 miRNA Mature ID miR-4676-5p

miRNA Sequence

 GAGCCAGUGGUGAGACAGUGA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 14

 miR-4710 directly targets ABCB5 [ 15 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4710 miRNA Mature ID miR-4710

miRNA Sequence

 GGGUGAGGGCAGGUGGUU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 15

 miR-4772 directly targets ABCB5 [ 15 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4772 miRNA Mature ID miR-4772-3p

miRNA Sequence

 CCUGCAACUUUGCCUGAUCAGA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 16

 miR-5001 directly targets ABCB5 [ 15 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-5001 miRNA Mature ID miR-5001-3p

miRNA Sequence

 UUCUGCCUCUGUCCAGGUCCUU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 17

 miR-522 directly targets ABCB5 [ 12 ]

Epigenetic Type

 microRNA Experiment Method Flow//GFP reporter assay//qRT-PCR//Western blot

miRNA Stemloop ID

 miR-522 miRNA Mature ID miR-522-5p

miRNA Sequence

 CUCUAGAGGGAAGCGCUUUCUG

miRNA Target Type

 Direct

Experimental Material

 Human colon cancer cell line (HT-29)

  Epigenetic Phenomenon 18

 miR-5571 directly targets ABCB5 [ 15 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-5571 miRNA Mature ID miR-5571-3p

miRNA Sequence

 GUCCUAGGAGGCUCCUCUG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 19

 miR-580 directly targets ABCB5 [ 15 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-580 miRNA Mature ID miR-580-5p

miRNA Sequence

 UAAUGAUUCAUCAGACUCAGAU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 20

 miR-607 directly targets ABCB5 [ 15 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-607 miRNA Mature ID miR-607

miRNA Sequence

 GUUCAAAUCCAGAUCUAUAAC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 21

 miR-6741 directly targets ABCB5 [ 15 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6741 miRNA Mature ID miR-6741-3p

miRNA Sequence

 UCGGCUCUCUCCCUCACCCUAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 22

 miR-6778 directly targets ABCB5 [ 15 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6778 miRNA Mature ID miR-6778-3p

miRNA Sequence

 UGCCUCCCUGACAUUCCACAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 23

 miR-6791 directly targets ABCB5 [ 15 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6791 miRNA Mature ID miR-6791-3p

miRNA Sequence

 UGCCUCCUUGGUCUCCGGCAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 24

 miR-6829 directly targets ABCB5 [ 15 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6829 miRNA Mature ID miR-6829-3p

miRNA Sequence

 UGCCUCCUCCGUGGCCUCAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 25

 miR-6836 directly targets ABCB5 [ 15 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6836 miRNA Mature ID miR-6836-3p

miRNA Sequence

 AUGCCUCCCCCGGCCCCGCAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 26

 miR-6890 directly targets ABCB5 [ 15 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6890 miRNA Mature ID miR-6890-3p

miRNA Sequence

 CCACUGCCUAUGCCCCACAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 27

 miR-7853 directly targets ABCB5 [ 15 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-7853 miRNA Mature ID miR-7853-5p

miRNA Sequence

 UCAAAUGCAGAUCCUGACUUC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 28

 miR-7855 directly targets ABCB5 [ 15 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-7855 miRNA Mature ID miR-7855-5p

miRNA Sequence

 UUGGUGAGGACCCCAAGCUCGG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human
References
1 Atypical Teratoid/Rhabdoid Tumors Are Comprised of Three Epigenetic Subgroups with Distinct Enhancer Landscapes. Cancer Cell. 2016 Mar 14;29(3):379-393.
2 DNA Methylation Dynamics in Urological Tumors.
3 Genome-wide Scan for Methylation Profiles in Breast Cancer
4 Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
5 Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
6 HIV-1 Infection Accelerates Age According to the Epigenetic Clock. J Infect Dis. 2015 Nov 15;212(10):1563-73.
7 Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
8 Genome-wide DNA methylation analysis of systemic lupus erythematosus reveals persistent hypomethylation of interferon genes and compositional changes to CD4+ T-cell populations. PLoS Genet. 2013;9(8):e1003678.
9 DNA Methylation signatures in panic disorder. Transl Psychiatry. 2017 Dec 18;7(12):1287.
10 Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
11 Diminution of miR-340-5p levels is responsible for increased expression of ABCB5 in melanoma cells under oxygen-deprived conditions. Exp Mol Pathol. 2015 Dec;99(3):707-16.
12 MicroRNA-522 reverses drug resistance of doxorubicin-induced HT29 colon cancer cell by targeting ABCB5. Mol Med Rep. 2015 Sep;12(3):3930-3936.
13 The impact of microRNAs on protein output. Nature. 2008 Sep 4;455(7209):64-71.
14 The viral and cellular microRNA targetome in lymphoblastoid cell lines. PLoS Pathog. 2012 Jan;8(1):e1002484.
15 Remodeling of Ago2-mRNA interactions upon cellular stress reflects miRNA complementarity and correlates with altered translation rates. Genes Dev. 2013 Jul 15;27(14):1624-32.

If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.