Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID	DTD0052 Transporter Info
Gene Name	ABCB6
Transporter Name	ATP-binding cassette sub-family B member 6
Gene ID	10058
UniProt ID	Q9NP58

Epigenetic Regulations of This DT (EGR)
Methylation
Hepatocellular carcinoma	9 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Hypermethylation of ABCB6 in hepatitis C virus-related hepatocellular carcinoma			[ 1 ]
Epigenetic Type	Methylation	Experiment Method	Methylation-specific PCR
Related Molecular Changes	Down regulation of ABCB6	Experiment Method	RT-qPCR
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples; Multiple cell lines of human
Additional Notes	The percentage of DNA methylation of ABCB6 was inversely correlated with the ABCB6 mRNA levels in hepatoma cell lines and clinical samples.
Epigenetic Phenomenon 2	Methylation of ABCB6 in hepatocellular carcinoma			[ 8 ]
Location	TSS1500 (cg13800769)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.55E+00	Statistic Test	p-value: 1.33E-11; Z-score: -2.61E+00
Methylation in Case	2.33E-01 (Median)	Methylation in Control	3.61E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of ABCB6 in hepatocellular carcinoma			[ 8 ]
Location	TSS1500 (cg06716437)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.21E+00	Statistic Test	p-value: 7.94E-05; Z-score: 1.00E+00
Methylation in Case	2.41E-01 (Median)	Methylation in Control	1.99E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of ABCB6 in hepatocellular carcinoma			[ 8 ]
Location	TSS1500 (cg23153680)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.10E+00	Statistic Test	p-value: 6.13E-03; Z-score: 2.72E-01
Methylation in Case	2.29E-01 (Median)	Methylation in Control	2.08E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of ABCB6 in hepatocellular carcinoma			[ 8 ]
Location	TSS200 (cg07920064)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.03E+00	Statistic Test	p-value: 3.94E-02; Z-score: 7.78E-02
Methylation in Case	3.56E-02 (Median)	Methylation in Control	3.44E-02 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of ABCB6 in hepatocellular carcinoma			[ 8 ]
Location	TSS200 (cg07100128)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.01E+00	Statistic Test	p-value: 4.17E-02; Z-score: 7.98E-02
Methylation in Case	5.82E-02 (Median)	Methylation in Control	5.74E-02 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of ABCB6 in hepatocellular carcinoma			[ 8 ]
Location	Body (cg22167704)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.44E+00	Statistic Test	p-value: 1.26E-16; Z-score: -9.74E+00
Methylation in Case	5.59E-01 (Median)	Methylation in Control	8.04E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of ABCB6 in hepatocellular carcinoma			[ 8 ]
Location	Body (cg19412109)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.43E+00	Statistic Test	p-value: 8.34E-05; Z-score: -1.12E+00
Methylation in Case	1.03E-01 (Median)	Methylation in Control	1.47E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 9	Methylation of ABCB6 in hepatocellular carcinoma			[ 8 ]
Location	3'UTR (cg02776283)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.07E+00	Statistic Test	p-value: 1.76E-04; Z-score: 1.13E+00
Methylation in Case	7.07E-01 (Median)	Methylation in Control	6.61E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Pancretic ductal adenocarcinoma	8 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of ABCB6 in pancretic ductal adenocarcinoma			[ 2 ]
Location	5'UTR (cg13425422)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.01E+00	Statistic Test	p-value: 6.61E-03; Z-score: -2.14E-01
Methylation in Case	8.59E-01 (Median)	Methylation in Control	8.69E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of ABCB6 in pancretic ductal adenocarcinoma			[ 2 ]
Location	TSS1500 (cg06652199)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 4.40E+00	Statistic Test	p-value: 5.50E-28; Z-score: 4.49E+00
Methylation in Case	2.86E-01 (Median)	Methylation in Control	6.50E-02 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of ABCB6 in pancretic ductal adenocarcinoma			[ 2 ]
Location	TSS1500 (cg06417752)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.20E+00	Statistic Test	p-value: 1.25E-07; Z-score: -1.33E+00
Methylation in Case	2.20E-01 (Median)	Methylation in Control	2.65E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of ABCB6 in pancretic ductal adenocarcinoma			[ 2 ]
Location	TSS1500 (cg25771897)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.03E+00	Statistic Test	p-value: 3.55E-02; Z-score: -1.24E-01
Methylation in Case	1.13E-01 (Median)	Methylation in Control	1.17E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of ABCB6 in pancretic ductal adenocarcinoma			[ 2 ]
Location	TSS200 (cg25841634)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.07E+00	Statistic Test	p-value: 1.05E-02; Z-score: -5.05E-01
Methylation in Case	7.42E-02 (Median)	Methylation in Control	7.96E-02 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of ABCB6 in pancretic ductal adenocarcinoma			[ 2 ]
Location	TSS200 (cg07920064)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.06E+00	Statistic Test	p-value: 4.40E-02; Z-score: -4.11E-01
Methylation in Case	6.21E-02 (Median)	Methylation in Control	6.57E-02 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of ABCB6 in pancretic ductal adenocarcinoma			[ 2 ]
Location	1stExon (cg13925011)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.06E+00	Statistic Test	p-value: 3.37E-03; Z-score: 6.16E-01
Methylation in Case	6.95E-01 (Median)	Methylation in Control	6.56E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of ABCB6 in pancretic ductal adenocarcinoma			[ 2 ]
Location	Body (cg00089550)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.09E+00	Statistic Test	p-value: 7.11E-03; Z-score: -7.65E-01
Methylation in Case	3.77E-01 (Median)	Methylation in Control	4.12E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Bladder cancer	4 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of ABCB6 in bladder cancer			[ 3 ]
Location	TSS1500 (cg23153680)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 2.08E+00	Statistic Test	p-value: 1.16E-05; Z-score: 4.26E+00
Methylation in Case	3.35E-01 (Median)	Methylation in Control	1.61E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of ABCB6 in bladder cancer			[ 3 ]
Location	TSS1500 (cg06716437)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 2.14E+00	Statistic Test	p-value: 1.26E-05; Z-score: 5.40E+00
Methylation in Case	2.92E-01 (Median)	Methylation in Control	1.37E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of ABCB6 in bladder cancer			[ 3 ]
Location	Body (cg19964303)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.06E+00	Statistic Test	p-value: 1.71E-05; Z-score: 4.79E+00
Methylation in Case	8.78E-01 (Median)	Methylation in Control	8.25E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of ABCB6 in bladder cancer			[ 3 ]
Location	3'UTR (cg02776283)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.24E+00	Statistic Test	p-value: 1.07E-03; Z-score: 3.49E+00
Methylation in Case	8.32E-01 (Median)	Methylation in Control	6.70E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Breast cancer	8 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of ABCB6 in breast cancer			[ 4 ]
Location	TSS1500 (cg23153680)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 2.21E+00	Statistic Test	p-value: 1.01E-12; Z-score: 3.24E+00
Methylation in Case	2.30E-01 (Median)	Methylation in Control	1.04E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of ABCB6 in breast cancer			[ 4 ]
Location	TSS1500 (cg06716437)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.52E+00	Statistic Test	p-value: 3.09E-09; Z-score: 2.11E+00
Methylation in Case	2.18E-01 (Median)	Methylation in Control	1.43E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of ABCB6 in breast cancer			[ 4 ]
Location	TSS200 (cg24775454)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.22E+00	Statistic Test	p-value: 1.37E-02; Z-score: 2.17E-01
Methylation in Case	1.17E-02 (Median)	Methylation in Control	9.60E-03 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of ABCB6 in breast cancer			[ 4 ]
Location	TSS200 (cg08290072)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.16E+00	Statistic Test	p-value: 2.05E-02; Z-score: 1.93E-01
Methylation in Case	9.20E-03 (Median)	Methylation in Control	7.92E-03 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of ABCB6 in breast cancer			[ 4 ]
Location	TSS200 (cg18014247)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.12E+00	Statistic Test	p-value: 2.16E-02; Z-score: 4.61E-01
Methylation in Case	6.39E-02 (Median)	Methylation in Control	5.73E-02 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of ABCB6 in breast cancer			[ 4 ]
Location	TSS200 (cg26544277)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.12E+00	Statistic Test	p-value: 2.70E-02; Z-score: 2.68E-01
Methylation in Case	3.46E-02 (Median)	Methylation in Control	3.08E-02 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of ABCB6 in breast cancer			[ 4 ]
Location	Body (cg19412109)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.40E+00	Statistic Test	p-value: 1.03E-07; Z-score: 1.51E+00
Methylation in Case	1.34E-01 (Median)	Methylation in Control	9.57E-02 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of ABCB6 in breast cancer			[ 4 ]
Location	Body (cg19964303)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.07E+00	Statistic Test	p-value: 4.13E-05; Z-score: 8.20E-01
Methylation in Case	8.76E-01 (Median)	Methylation in Control	8.16E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Renal cell carcinoma	4 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of ABCB6 in clear cell renal cell carcinoma			[ 5 ]
Location	TSS1500 (cg23153680)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.90E+00	Statistic Test	p-value: 6.12E-06; Z-score: 1.00E+00
Methylation in Case	1.09E-01 (Median)	Methylation in Control	5.76E-02 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of ABCB6 in clear cell renal cell carcinoma			[ 5 ]
Location	TSS1500 (cg06716437)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 2.03E+00	Statistic Test	p-value: 1.09E-05; Z-score: 1.19E+00
Methylation in Case	1.15E-01 (Median)	Methylation in Control	5.66E-02 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of ABCB6 in clear cell renal cell carcinoma			[ 5 ]
Location	1stExon (cg23547073)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.21E+00	Statistic Test	p-value: 2.74E-06; Z-score: 1.49E+00
Methylation in Case	4.88E-02 (Median)	Methylation in Control	4.04E-02 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of ABCB6 in clear cell renal cell carcinoma			[ 5 ]
Location	Body (cg19412109)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.74E+00	Statistic Test	p-value: 9.03E-06; Z-score: 1.55E+00
Methylation in Case	8.44E-02 (Median)	Methylation in Control	4.84E-02 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Colon cancer	4 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of ABCB6 in colon adenocarcinoma			[ 6 ]
Location	TSS1500 (cg16703956)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.29E+00	Statistic Test	p-value: 2.77E-06; Z-score: 1.35E+00
Methylation in Case	6.73E-01 (Median)	Methylation in Control	5.22E-01 (Median)
Studied Phenotype	Colon cancer [ ICD-11: 2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of ABCB6 in colon adenocarcinoma			[ 6 ]
Location	1stExon (cg20302133)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.22E+00	Statistic Test	p-value: 7.58E-06; Z-score: 9.13E-01
Methylation in Case	6.69E-01 (Median)	Methylation in Control	5.49E-01 (Median)
Studied Phenotype	Colon cancer [ ICD-11: 2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of ABCB6 in colon adenocarcinoma			[ 6 ]
Location	Body (cg16146033)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.30E+00	Statistic Test	p-value: 4.79E-06; Z-score: -1.09E+00
Methylation in Case	2.91E-01 (Median)	Methylation in Control	3.78E-01 (Median)
Studied Phenotype	Colon cancer [ ICD-11: 2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of ABCB6 in colon adenocarcinoma			[ 6 ]
Location	Body (cg05367173)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.17E+00	Statistic Test	p-value: 6.74E-06; Z-score: -4.91E+00
Methylation in Case	7.35E-01 (Median)	Methylation in Control	8.63E-01 (Median)
Studied Phenotype	Colon cancer [ ICD-11: 2B90]
Experimental Material	Patient tissue samples
Colorectal cancer	4 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of ABCB6 in colorectal cancer			[ 7 ]
Location	TSS1500 (cg06716437)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.42E+00	Statistic Test	p-value: 3.27E-02; Z-score: -1.22E+00
Methylation in Case	2.75E-01 (Median)	Methylation in Control	3.89E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of ABCB6 in colorectal cancer			[ 7 ]
Location	TSS200 (cg07100128)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.06E+00	Statistic Test	p-value: 2.49E-02; Z-score: 4.57E-01
Methylation in Case	8.34E-02 (Median)	Methylation in Control	7.90E-02 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of ABCB6 in colorectal cancer			[ 7 ]
Location	TSS200 (cg07920064)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.18E+00	Statistic Test	p-value: 4.39E-02; Z-score: 6.41E-01
Methylation in Case	2.69E-02 (Median)	Methylation in Control	2.28E-02 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of ABCB6 in colorectal cancer			[ 7 ]
Location	1stExon (cg23547073)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.05E+00	Statistic Test	p-value: 2.52E-02; Z-score: 2.64E-01
Methylation in Case	1.17E-01 (Median)	Methylation in Control	1.12E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
HIV infection	10 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of ABCB6 in HIV infection			[ 9 ]
Location	TSS1500 (cg23153680)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 2.27E+00	Statistic Test	p-value: 1.36E-09; Z-score: 3.32E+00
Methylation in Case	3.51E-01 (Median)	Methylation in Control	1.55E-01 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of ABCB6 in HIV infection			[ 9 ]
Location	TSS1500 (cg06716437)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.57E+00	Statistic Test	p-value: 2.29E-07; Z-score: 1.92E+00
Methylation in Case	2.31E-01 (Median)	Methylation in Control	1.47E-01 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of ABCB6 in HIV infection			[ 9 ]
Location	TSS200 (cg26544277)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.65E+00	Statistic Test	p-value: 1.47E-03; Z-score: 1.26E+00
Methylation in Case	4.68E-02 (Median)	Methylation in Control	2.83E-02 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of ABCB6 in HIV infection			[ 9 ]
Location	TSS200 (cg07920064)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.24E+00	Statistic Test	p-value: 1.27E-02; Z-score: 7.46E-01
Methylation in Case	4.70E-02 (Median)	Methylation in Control	3.78E-02 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of ABCB6 in HIV infection			[ 9 ]
Location	TSS200 (cg08290072)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 2.52E+00	Statistic Test	p-value: 1.39E-02; Z-score: 1.45E+00
Methylation in Case	2.26E-02 (Median)	Methylation in Control	8.97E-03 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of ABCB6 in HIV infection			[ 9 ]
Location	TSS200 (cg24775454)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 2.53E+00	Statistic Test	p-value: 2.92E-02; Z-score: 1.15E+00
Methylation in Case	1.55E-02 (Median)	Methylation in Control	6.14E-03 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of ABCB6 in HIV infection			[ 9 ]
Location	TSS200 (cg07100128)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.12E+00	Statistic Test	p-value: 3.39E-02; Z-score: 6.02E-01
Methylation in Case	6.94E-02 (Median)	Methylation in Control	6.18E-02 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of ABCB6 in HIV infection			[ 9 ]
Location	TSS200 (cg18014247)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.12E+00	Statistic Test	p-value: 4.33E-02; Z-score: 4.95E-01
Methylation in Case	7.32E-02 (Median)	Methylation in Control	6.53E-02 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 9	Methylation of ABCB6 in HIV infection			[ 9 ]
Location	Body (cg19412109)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.29E+00	Statistic Test	p-value: 1.35E-04; Z-score: 1.82E+00
Methylation in Case	2.42E-01 (Median)	Methylation in Control	1.88E-01 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 10	Methylation of ABCB6 in HIV infection			[ 9 ]
Location	3'UTR (cg02776283)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.72E+00	Statistic Test	p-value: 8.14E-07; Z-score: 2.92E+00
Methylation in Case	3.91E-01 (Median)	Methylation in Control	2.27E-01 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Lung adenocarcinoma	4 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of ABCB6 in lung adenocarcinoma			[ 10 ]
Location	TSS1500 (cg06716437)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.36E+00	Statistic Test	p-value: 8.20E-04; Z-score: 1.97E+00
Methylation in Case	2.64E-01 (Median)	Methylation in Control	1.94E-01 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of ABCB6 in lung adenocarcinoma			[ 10 ]
Location	TSS1500 (cg23153680)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.54E+00	Statistic Test	p-value: 6.64E-03; Z-score: 2.32E+00
Methylation in Case	2.77E-01 (Median)	Methylation in Control	1.80E-01 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of ABCB6 in lung adenocarcinoma			[ 10 ]
Location	TSS200 (cg08290072)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.56E+00	Statistic Test	p-value: 2.90E-02; Z-score: 1.45E+00
Methylation in Case	3.81E-02 (Median)	Methylation in Control	2.45E-02 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of ABCB6 in lung adenocarcinoma			[ 10 ]
Location	Body (cg19412109)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.44E+00	Statistic Test	p-value: 3.60E-04; Z-score: 2.88E+00
Methylation in Case	2.12E-01 (Median)	Methylation in Control	1.47E-01 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Panic disorder	2 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of ABCB6 in panic disorder			[ 11 ]
Location	TSS1500 (cg23153680)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -8.47E-01	Statistic Test	p-value: 2.65E-04; Z-score: -7.56E-01
Methylation in Case	-3.52E+00 (Median)	Methylation in Control	-2.98E+00 (Median)
Studied Phenotype	Panic disorder [ ICD-11: 6B01]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of ABCB6 in panic disorder			[ 11 ]
Location	TSS200 (cg07100128)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 9.65E-01	Statistic Test	p-value: 7.88E-03; Z-score: 4.83E-01
Methylation in Case	-4.36E+00 (Median)	Methylation in Control	-4.51E+00 (Median)
Studied Phenotype	Panic disorder [ ICD-11: 6B01]
Experimental Material	Patient tissue samples
Papillary thyroid cancer	6 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of ABCB6 in papillary thyroid cancer			[ 12 ]
Location	TSS1500 (cg23153680)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.47E+00	Statistic Test	p-value: 1.27E-09; Z-score: 2.06E+00
Methylation in Case	2.20E-01 (Median)	Methylation in Control	1.50E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of ABCB6 in papillary thyroid cancer			[ 12 ]
Location	TSS1500 (cg06716437)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.38E+00	Statistic Test	p-value: 9.34E-07; Z-score: 1.48E+00
Methylation in Case	1.13E-01 (Median)	Methylation in Control	8.18E-02 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of ABCB6 in papillary thyroid cancer			[ 12 ]
Location	TSS200 (cg07100128)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.09E+00	Statistic Test	p-value: 4.34E-02; Z-score: 4.04E-01
Methylation in Case	5.25E-02 (Median)	Methylation in Control	4.81E-02 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of ABCB6 in papillary thyroid cancer			[ 12 ]
Location	TSS200 (cg26544277)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.02E+00	Statistic Test	p-value: 4.66E-02; Z-score: 1.36E-01
Methylation in Case	7.06E-02 (Median)	Methylation in Control	6.91E-02 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of ABCB6 in papillary thyroid cancer			[ 12 ]
Location	Body (cg19964303)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.03E+00	Statistic Test	p-value: 7.58E-03; Z-score: 1.03E+00
Methylation in Case	8.94E-01 (Median)	Methylation in Control	8.72E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of ABCB6 in papillary thyroid cancer			[ 12 ]
Location	Body (cg00719108)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.01E+00	Statistic Test	p-value: 7.91E-03; Z-score: 7.02E-01
Methylation in Case	9.46E-01 (Median)	Methylation in Control	9.41E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Atypical teratoid rhabdoid tumor	3 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of ABCB6 in atypical teratoid rhabdoid tumor			[ 13 ]
Location	1stExon (cg23547073)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.34E+00	Statistic Test	p-value: 1.02E-16; Z-score: -2.19E+00
Methylation in Case	5.14E-01 (Median)	Methylation in Control	6.90E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of ABCB6 in atypical teratoid rhabdoid tumor			[ 13 ]
Location	Body (cg00719108)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.38E+00	Statistic Test	p-value: 3.64E-05; Z-score: 1.23E+00
Methylation in Case	6.89E-02 (Median)	Methylation in Control	4.98E-02 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of ABCB6 in atypical teratoid rhabdoid tumor			[ 13 ]
Location	3'UTR (cg02776283)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.48E+00	Statistic Test	p-value: 4.33E-15; Z-score: -2.72E+00
Methylation in Case	4.79E-01 (Median)	Methylation in Control	7.10E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Systemic lupus erythematosus	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of ABCB6 in systemic lupus erythematosus			[ 14 ]
Location	1stExon (cg23547073)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.06E+00	Statistic Test	p-value: 4.75E-04; Z-score: -2.66E-01
Methylation in Case	1.29E-01 (Median)	Methylation in Control	1.36E-01 (Median)
Studied Phenotype	Systemic lupus erythematosus [ ICD-11: 4A40.0]
Experimental Material	Patient tissue samples
Prostate cancer	3 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of ABCB6 in prostate cancer			[ 15 ]
Location	Body (cg21506819)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.29E+00	Statistic Test	p-value: 1.38E-02; Z-score: 2.01E+00
Methylation in Case	8.50E-01 (Median)	Methylation in Control	6.58E-01 (Median)
Studied Phenotype	Prostate cancer [ ICD-11: 2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of ABCB6 in prostate cancer			[ 15 ]
Location	Body (cg05394840)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.03E+00	Statistic Test	p-value: 3.52E-02; Z-score: 1.99E+00
Methylation in Case	9.36E-01 (Median)	Methylation in Control	9.11E-01 (Median)
Studied Phenotype	Prostate cancer [ ICD-11: 2C82]
Experimental Material	Patient tissue samples
microRNA
Unclear Phenotype	3 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	miR-1 directly targets ABCB6			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	Proteomics
miRNA Stemloop ID	miR-1	miRNA Mature ID	miR-1-3p
miRNA Sequence	UGGAAUGUAAAGAAGUAUGUAU
miRNA Target Type	Direct
Experimental Material	Human cervical cancer cell line (Hela)
Epigenetic Phenomenon 2	miR-26b directly targets ABCB6			[ 17 ]
Epigenetic Type	microRNA	Experiment Method	Microarray
miRNA Stemloop ID	miR-26b	miRNA Mature ID	miR-26b-5p
miRNA Sequence	UUCAAGUAAUUCAGGAUAGGU
miRNA Target Type	Direct
Experimental Material	Human cervical cancer cell line (Hela)
Epigenetic Phenomenon 3	miR-7113 directly targets ABCB6			[ 18 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-7113	miRNA Mature ID	miR-7113-5p
miRNA Sequence	UCCAGGGAGACAGUGUGUGAG
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)

References
1	ABCB6 mRNA and DNA methylation levels serve as useful biomarkers for prediction of early intrahepatic recurrence of hepatitis C virus-related hepatocellular carcinoma. Int J Oncol. 2013 May;42(5):1551-9.
2	Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
3	DNA Methylation Dynamics in Urological Tumors.
4	Genome-wide Scan for Methylation Profiles in Breast Cancer
5	A CpG-methylation-based assay to predict survival in clear cell renal cell carcinoma. Nat Commun. 2015 Oct 30;6:8699.
6	Genome-scale analysis of DNA methylation in colorectal cancer using Infinium HumanMethylation450 BeadChips. Epigenetics. 2013 Sep;8(9):921-34.
7	Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
8	Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
9	HIV-1 Infection Accelerates Age According to the Epigenetic Clock. J Infect Dis. 2015 Nov 15;212(10):1563-73.
10	DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
11	DNA Methylation signatures in panic disorder. Transl Psychiatry. 2017 Dec 18;7(12):1287.
12	Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
13	Atypical Teratoid/Rhabdoid Tumors Are Comprised of Three Epigenetic Subgroups with Distinct Enhancer Landscapes. Cancer Cell. 2016 Mar 14;29(3):379-393.
14	Genome-wide DNA methylation analysis of systemic lupus erythematosus reveals persistent hypomethylation of interferon genes and compositional changes to CD4+ T-cell populations. PLoS Genet. 2013;9(8):e1003678.
15	Reducing the risk of false discovery enabling identification of biologically significant genome-wide methylation status using the HumanMethylation450 array. BMC Genomics. 2014 Jan 22;15:51.
16	Widespread changes in protein synthesis induced by microRNAs. Nature. 2008 Sep 4;455(7209):58-63.
17	MicroRNA target prediction by expression analysis of host genes. Genome Res. 2009 Mar;19(3):481-90.
18	Genome-wide identification of microRNA targets in human ES cells reveals a role for miR-302 in modulating BMP response. Genes Dev. 2011 Oct 15;25(20):2173-86.

If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.

Detail Information of Epigenetic Regulations

Visitor Map

Correspondence