Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID DTD0055 Transporter Info
Gene Name ABCB9
Transporter Name TAP-like protein
Gene ID
23457
UniProt ID
Q9NP78
Epigenetic Regulations of This DT (EGR)

Methylation

  Atypical teratoid rhabdoid tumor

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of ABCB9 in atypical teratoid rhabdoid tumor [ 1 ]

Location

 5'UTR (cg16314862)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -5.18E+00 Statistic Test p-value: 1.75E-06; Z-score: -1.59E+00

Methylation in Case

 6.35E-02 (Median) Methylation in Control 3.29E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of ABCB9 in atypical teratoid rhabdoid tumor [ 1 ]

Location

 5'UTR (cg16427983)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -2.52E+00 Statistic Test p-value: 1.81E-06; Z-score: -1.10E+00

Methylation in Case

 9.90E-02 (Median) Methylation in Control 2.50E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Breast cancer

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of ABCB9 in breast cancer [ 2 ]

Location

 5'UTR (cg16427983)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.07E+00 Statistic Test p-value: 3.06E-07; Z-score: 1.04E+00

Methylation in Case

 7.66E-01 (Median) Methylation in Control 7.16E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Colorectal cancer

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of ABCB9 in colorectal cancer [ 3 ]

Location

 5'UTR (cg16427983)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.05E+00 Statistic Test p-value: 3.43E-02; Z-score: 6.65E-01

Methylation in Case

 8.86E-01 (Median) Methylation in Control 8.44E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Hepatocellular carcinoma

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of ABCB9 in hepatocellular carcinoma [ 4 ]

Location

 5'UTR (cg16427983)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.02E+00 Statistic Test p-value: 1.16E-05; Z-score: -6.93E-01

Methylation in Case

 8.21E-01 (Median) Methylation in Control 8.40E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  HIV infection

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of ABCB9 in HIV infection [ 5 ]

Location

 5'UTR (cg16314862)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.00E+00 Statistic Test p-value: 3.69E-02; Z-score: 2.53E-01

Methylation in Case

 9.50E-01 (Median) Methylation in Control 9.46E-01 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Pancretic ductal adenocarcinoma

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of ABCB9 in pancretic ductal adenocarcinoma [ 6 ]

Location

 5'UTR (cg13323097)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.34E+00 Statistic Test p-value: 1.11E-17; Z-score: -2.90E+00

Methylation in Case

 1.97E-01 (Median) Methylation in Control 2.64E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Parkinson's disease

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Hypomethylation of ABCB9 in parkinson's disease [ 7 ]

Location

 Body (cg04772575)

Epigenetic Type

 Methylation Experiment Method HumanMethylation450 BeadChip

Studied Phenotype

 Parkinson's disease [ ICD-11: 8A00.0]

Experimental Material

 Patient tissue samples

Additional Notes

 Hypomethylation in parkison's disease cases can be observed for a highly significant CpGs in immune-related genes cg04772575 in ABCB9 (p =?4.3??1010).

microRNA

  Breast cancer

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Higher expression of miR-24 in breast cancer (compare with paclitaxel-resistant counterpart cells) [ 8 ]

Epigenetic Type

 microRNA Experiment Method Luciferase reporter assay

Related Molecular Changes

 Down regulation of ABCB9 Experiment Method Western Blot

miRNA Stemloop ID

 miR-24 miRNA Mature ID miR-24-3p

miRNA Sequence

 UGGCUCAGUUCAGCAGGAACAG

miRNA Target Type

 Direct

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Human breast adenocarcinoma cell line (MCF-7); Patient tissue samples

Additional Notes

 miR-24 overexpression may increase the sensitivity of breast cancer cells to paclitaxel by targeting ABCB9.

  Non-small cell lung cancer

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Lower expression of miR-31 in non-small cell lung cancer (compare with cisplatin-resistant cells) [ 9 ]

Epigenetic Type

 microRNA Experiment Method Luciferase reporter assay

Related Molecular Changes

 Down regulation of ABCB9 Experiment Method RT-qPCR

miRNA Stemloop ID

 miR-31 miRNA Mature ID miR-31-5p

miRNA Sequence

 AGGCAAGAUGCUGGCAUAGCU

miRNA Target Type

 Direct

Studied Phenotype

 Non-small cell lung cancer [ ICD-11: 2C25.4]

Experimental Material

 Multiple cell lines of human

Additional Notes

 miR-31 overexpression may induced the resistance of non-small cell lung cancer cells to paclitaxel by targeting ABCB9.

  Unclear Phenotype

            4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 miR-24 directly targets ABCB9 [ 8 ]

Epigenetic Type

 microRNA Experiment Method Luciferase reporter assay//qRT-PCR//Western blot

miRNA Stemloop ID

 miR-24 miRNA Mature ID miR-24-3p

miRNA Sequence

 UGGCUCAGUUCAGCAGGAACAG

miRNA Target Type

 Direct

Experimental Material

 Human breast adenocarcinoma cell line (MCF-7); Patient tissue samples

  Epigenetic Phenomenon 2

 miR-26a directly targets ABCB9 [ 10 ]

Epigenetic Type

 microRNA Experiment Method CLASH

miRNA Stemloop ID

 miR-26a miRNA Mature ID miR-26a-5p

miRNA Sequence

 UUCAAGUAAUCCAGGAUAGGCU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 3

 miR-31 directly targets ABCB9 [ 9 ]

Epigenetic Type

 microRNA Experiment Method Luciferase reporter assay//qRT-PCR//Western blot

miRNA Stemloop ID

 miR-31 miRNA Mature ID miR-31-5p

miRNA Sequence

 AGGCAAGAUGCUGGCAUAGCU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 4

 miR-335 directly targets ABCB9 [ 11 ]

Epigenetic Type

 microRNA Experiment Method Microarray

miRNA Stemloop ID

 miR-335 miRNA Mature ID miR-335-5p

miRNA Sequence

 UCAAGAGCAAUAACGAAAAAUGU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human
References
1 Atypical Teratoid/Rhabdoid Tumors Are Comprised of Three Epigenetic Subgroups with Distinct Enhancer Landscapes. Cancer Cell. 2016 Mar 14;29(3):379-393.
2 Genome-wide Scan for Methylation Profiles in Breast Cancer
3 Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
4 Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
5 HIV-1 Infection Accelerates Age According to the Epigenetic Clock. J Infect Dis. 2015 Nov 15;212(10):1563-73.
6 Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
7 Parkinson's disease is associated with DNA methylation levels in human blood and saliva. Genome Med. 2017 Aug 30;9(1):76.
8 Overexpression of microRNA-24 increases the sensitivity to paclitaxel in drug-resistant breast carcinoma cell lines via targeting ABCB9. Oncol Lett. 2016 Nov;12(5):3905-3911.
9 MicroRNA-31 inhibits cisplatin-induced apoptosis in non-small cell lung cancer cells by regulating the drug transporter ABCB9. Cancer Lett. 2014 Feb 28;343(2):249-57.
10 Mapping the human miRNA interactome by CLASH reveals frequent noncanonical binding. Cell. 2013 Apr 25;153(3):654-65.
11 Endogenous human microRNAs that suppress breast cancer metastasis. Nature. 2008 Jan 10;451(7175):147-52.

If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.