Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID DTD0056 Transporter Info
Gene Name ABCC10
Transporter Name Multidrug resistance-associated protein 7
Gene ID
89845
UniProt ID
Q5T3U5
Epigenetic Regulations of This DT (EGR)

Methylation

  Bladder cancer

            4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of ABCC10 in bladder cancer [ 1 ]

Location

 TSS1500 (cg25545088)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.22E+00 Statistic Test p-value: 2.62E-03; Z-score: 2.21E+00

Methylation in Case

 7.51E-01 (Median) Methylation in Control 6.16E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of ABCC10 in bladder cancer [ 1 ]

Location

 TSS200 (cg26511326)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.17E+00 Statistic Test p-value: 1.58E-07; Z-score: -6.61E+00

Methylation in Case

 7.07E-01 (Median) Methylation in Control 8.24E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of ABCC10 in bladder cancer [ 1 ]

Location

 Body (cg00050375)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.69E+00 Statistic Test p-value: 1.99E-06; Z-score: -5.96E+00

Methylation in Case

 2.71E-01 (Median) Methylation in Control 4.57E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of ABCC10 in bladder cancer [ 1 ]

Location

 3'UTR (cg08073652)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.02E+00 Statistic Test p-value: 7.17E-03; Z-score: 1.96E+00

Methylation in Case

 8.76E-01 (Median) Methylation in Control 8.55E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Breast cancer

            3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of ABCC10 in breast cancer [ 2 ]

Location

 TSS1500 (cg25545088)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.11E+00 Statistic Test p-value: 8.07E-09; Z-score: 1.14E+00

Methylation in Case

 7.38E-01 (Median) Methylation in Control 6.63E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of ABCC10 in breast cancer [ 2 ]

Location

 TSS1500 (cg12572677)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.04E+00 Statistic Test p-value: 4.65E-05; Z-score: 9.79E-01

Methylation in Case

 8.46E-01 (Median) Methylation in Control 8.17E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of ABCC10 in breast cancer [ 2 ]

Location

 Body (cg00050375)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.14E+00 Statistic Test p-value: 1.08E-02; Z-score: 1.11E+00

Methylation in Case

 5.82E-01 (Median) Methylation in Control 5.09E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Lung adenocarcinoma

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of ABCC10 in lung adenocarcinoma [ 3 ]

Location

 TSS1500 (cg25545088)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.05E+00 Statistic Test p-value: 1.18E-02; Z-score: 1.17E+00

Methylation in Case

 8.08E-01 (Median) Methylation in Control 7.66E-01 (Median)

Studied Phenotype

 Lung adenocarcinoma [ ICD-11: 2C25.0]

Experimental Material

 Patient tissue samples

  Pancretic ductal adenocarcinoma

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of ABCC10 in pancretic ductal adenocarcinoma [ 4 ]

Location

 TSS1500 (cg14479139)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.12E+00 Statistic Test p-value: 1.46E-07; Z-score: 1.46E+00

Methylation in Case

 7.93E-01 (Median) Methylation in Control 7.05E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of ABCC10 in pancretic ductal adenocarcinoma [ 4 ]

Location

 Body (cg18256640)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.06E+00 Statistic Test p-value: 2.30E-03; Z-score: 5.97E-01

Methylation in Case

 8.85E-01 (Median) Methylation in Control 8.37E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Papillary thyroid cancer

            3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of ABCC10 in papillary thyroid cancer [ 5 ]

Location

 TSS1500 (cg25545088)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.03E+00 Statistic Test p-value: 3.04E-03; Z-score: 8.99E-01

Methylation in Case

 8.53E-01 (Median) Methylation in Control 8.26E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of ABCC10 in papillary thyroid cancer [ 5 ]

Location

 Body (cg00050375)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.10E+00 Statistic Test p-value: 1.06E-02; Z-score: 7.10E-01

Methylation in Case

 5.56E-01 (Median) Methylation in Control 5.04E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of ABCC10 in papillary thyroid cancer [ 5 ]

Location

 3'UTR (cg08073652)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.00E+00 Statistic Test p-value: 4.14E-02; Z-score: -4.14E-01

Methylation in Case

 9.38E-01 (Median) Methylation in Control 9.42E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Prostate cancer

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of ABCC10 in prostate cancer [ 6 ]

Location

 TSS1500 (cg13116946)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.05E+00 Statistic Test p-value: 3.91E-02; Z-score: 1.72E+00

Methylation in Case

 9.49E-01 (Median) Methylation in Control 9.00E-01 (Median)

Studied Phenotype

 Prostate cancer [ ICD-11: 2C82]

Experimental Material

 Patient tissue samples

  Systemic lupus erythematosus

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of ABCC10 in systemic lupus erythematosus [ 7 ]

Location

 TSS1500 (cg23781719)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.01E+00 Statistic Test p-value: 4.36E-02; Z-score: -1.11E-01

Methylation in Case

 8.75E-01 (Median) Methylation in Control 8.80E-01 (Median)

Studied Phenotype

 Systemic lupus erythematosus [ ICD-11: 4A40.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of ABCC10 in systemic lupus erythematosus [ 7 ]

Location

 TSS200 (cg26511326)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.01E+00 Statistic Test p-value: 1.70E-02; Z-score: -1.82E-01

Methylation in Case

 8.50E-01 (Median) Methylation in Control 8.55E-01 (Median)

Studied Phenotype

 Systemic lupus erythematosus [ ICD-11: 4A40.0]

Experimental Material

 Patient tissue samples

  Colorectal cancer

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of ABCC10 in colorectal cancer [ 8 ]

Location

 TSS200 (cg26511326)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.04E+00 Statistic Test p-value: 5.38E-09; Z-score: -1.96E+00

Methylation in Case

 8.74E-01 (Median) Methylation in Control 9.10E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Hepatocellular carcinoma

            4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of ABCC10 in hepatocellular carcinoma [ 9 ]

Location

 TSS200 (cg26511326)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.03E+00 Statistic Test p-value: 2.71E-05; Z-score: -7.88E-01

Methylation in Case

 8.55E-01 (Median) Methylation in Control 8.81E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of ABCC10 in hepatocellular carcinoma [ 9 ]

Location

 Body (cg22203323)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.58E+00 Statistic Test p-value: 1.06E-14; Z-score: -2.99E+00

Methylation in Case

 5.13E-01 (Median) Methylation in Control 8.08E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of ABCC10 in hepatocellular carcinoma [ 9 ]

Location

 Body (cg00050375)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.19E+00 Statistic Test p-value: 4.38E-08; Z-score: -2.48E+00

Methylation in Case

 6.16E-01 (Median) Methylation in Control 7.32E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of ABCC10 in hepatocellular carcinoma [ 9 ]

Location

 3'UTR (cg08073652)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.01E+00 Statistic Test p-value: 2.92E-04; Z-score: -4.94E-01

Methylation in Case

 8.73E-01 (Median) Methylation in Control 8.81E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Atypical teratoid rhabdoid tumor

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of ABCC10 in atypical teratoid rhabdoid tumor [ 10 ]

Location

 Body (cg00050375)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.21E+00 Statistic Test p-value: 1.58E-05; Z-score: 1.28E+00

Methylation in Case

 8.54E-01 (Median) Methylation in Control 7.06E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of ABCC10 in atypical teratoid rhabdoid tumor [ 10 ]

Location

 3'UTR (cg08073652)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.85E+00 Statistic Test p-value: 3.25E-13; Z-score: -2.12E+00

Methylation in Case

 2.16E-01 (Median) Methylation in Control 4.01E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

microRNA

  Unclear Phenotype

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 miR-183 directly targets ABCC10 [ 11 ]

Epigenetic Type

 microRNA Experiment Method CLASH

miRNA Stemloop ID

 miR-183 miRNA Mature ID miR-183-5p

miRNA Sequence

 UAUGGCACUGGUAGAAUUCACU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)
References
1 DNA Methylation Dynamics in Urological Tumors.
2 Genome-wide Scan for Methylation Profiles in Breast Cancer
3 DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
4 Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
5 Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
6 Reducing the risk of false discovery enabling identification of biologically significant genome-wide methylation status using the HumanMethylation450 array. BMC Genomics. 2014 Jan 22;15:51.
7 Genome-wide DNA methylation analysis of systemic lupus erythematosus reveals persistent hypomethylation of interferon genes and compositional changes to CD4+ T-cell populations. PLoS Genet. 2013;9(8):e1003678.
8 Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
9 Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
10 Atypical Teratoid/Rhabdoid Tumors Are Comprised of Three Epigenetic Subgroups with Distinct Enhancer Landscapes. Cancer Cell. 2016 Mar 14;29(3):379-393.
11 Mapping the human miRNA interactome by CLASH reveals frequent noncanonical binding. Cell. 2013 Apr 25;153(3):654-65.

If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.