Detail Information of Epigenetic Regulations
| General Information of Drug Transporter (DT) | |||||
|---|---|---|---|---|---|
| DT ID | DTD0061 Transporter Info | ||||
| Gene Name | ABCC8 | ||||
| Transporter Name | Sulfonylurea receptor 1 | ||||
| Gene ID | |||||
| UniProt ID | |||||
| Epigenetic Regulations of This DT (EGR) | |||||
|---|---|---|---|---|---|
|
Methylation |
|||||
|
Colon cancer |
12 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of ABCC8 in colon adenocarcinoma | [ 1 ] | |||
|
Location |
5'UTR (cg21200703) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.30E+00 | Statistic Test | p-value: 2.09E-03; Z-score: 2.35E+00 | ||
|
Methylation in Case |
3.89E-01 (Median) | Methylation in Control | 2.98E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of ABCC8 in colon adenocarcinoma | [ 1 ] | |||
|
Location |
TSS1500 (cg22415472) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.26E+00 | Statistic Test | p-value: 1.07E-04; Z-score: -3.34E+00 | ||
|
Methylation in Case |
6.01E-01 (Median) | Methylation in Control | 7.57E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of ABCC8 in colon adenocarcinoma | [ 1 ] | |||
|
Location |
TSS200 (cg13742513) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.44E+00 | Statistic Test | p-value: 5.33E-08; Z-score: -3.05E+00 | ||
|
Methylation in Case |
4.05E-01 (Median) | Methylation in Control | 5.84E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of ABCC8 in colon adenocarcinoma | [ 1 ] | |||
|
Location |
TSS200 (cg18624636) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 3.63E+00 | Statistic Test | p-value: 2.12E-07; Z-score: 6.98E+00 | ||
|
Methylation in Case |
5.92E-01 (Median) | Methylation in Control | 1.63E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of ABCC8 in colon adenocarcinoma | [ 1 ] | |||
|
Location |
TSS200 (cg10569606) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 3.98E+00 | Statistic Test | p-value: 6.48E-07; Z-score: 6.22E+00 | ||
|
Methylation in Case |
4.49E-01 (Median) | Methylation in Control | 1.13E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 6 |
Methylation of ABCC8 in colon adenocarcinoma | [ 1 ] | |||
|
Location |
TSS200 (cg04902729) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.79E+00 | Statistic Test | p-value: 1.61E-06; Z-score: 2.89E+00 | ||
|
Methylation in Case |
6.05E-01 (Median) | Methylation in Control | 3.39E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 7 |
Methylation of ABCC8 in colon adenocarcinoma | [ 1 ] | |||
|
Location |
TSS200 (cg16536563) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.15E+00 | Statistic Test | p-value: 6.87E-04; Z-score: -1.22E+00 | ||
|
Methylation in Case |
5.16E-01 (Median) | Methylation in Control | 5.96E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 8 |
Methylation of ABCC8 in colon adenocarcinoma | [ 1 ] | |||
|
Location |
TSS200 (cg04599612) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.14E+00 | Statistic Test | p-value: 3.63E-03; Z-score: -7.86E-01 | ||
|
Methylation in Case |
4.65E-01 (Median) | Methylation in Control | 5.29E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 9 |
Methylation of ABCC8 in colon adenocarcinoma | [ 1 ] | |||
|
Location |
Body (cg00522935) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.31E+00 | Statistic Test | p-value: 9.15E-07; Z-score: -3.09E+00 | ||
|
Methylation in Case |
4.99E-01 (Median) | Methylation in Control | 6.55E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 10 |
Methylation of ABCC8 in colon adenocarcinoma | [ 1 ] | |||
|
Location |
Body (cg25481491) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.16E+00 | Statistic Test | p-value: 4.35E-05; Z-score: -4.84E+00 | ||
|
Methylation in Case |
7.48E-01 (Median) | Methylation in Control | 8.72E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 11 |
Methylation of ABCC8 in colon adenocarcinoma | [ 1 ] | |||
|
Location |
Body (cg02334109) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.12E+00 | Statistic Test | p-value: 5.72E-05; Z-score: -3.02E+00 | ||
|
Methylation in Case |
6.88E-01 (Median) | Methylation in Control | 7.72E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 12 |
Methylation of ABCC8 in colon adenocarcinoma | [ 1 ] | |||
|
Location |
Body (cg00644103) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.26E+00 | Statistic Test | p-value: 7.43E-04; Z-score: -5.31E+00 | ||
|
Methylation in Case |
5.68E-01 (Median) | Methylation in Control | 7.17E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Bladder cancer |
20 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of ABCC8 in bladder cancer | [ 2 ] | |||
|
Location |
TSS1500 (cg14469826) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.85E+00 | Statistic Test | p-value: 1.68E-09; Z-score: -9.97E+00 | ||
|
Methylation in Case |
2.38E-01 (Median) | Methylation in Control | 4.42E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of ABCC8 in bladder cancer | [ 2 ] | |||
|
Location |
TSS1500 (cg13185308) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.30E+00 | Statistic Test | p-value: 1.47E-02; Z-score: -2.02E+00 | ||
|
Methylation in Case |
3.27E-01 (Median) | Methylation in Control | 4.27E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of ABCC8 in bladder cancer | [ 2 ] | |||
|
Location |
TSS200 (cg18097532) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.76E+00 | Statistic Test | p-value: 4.50E-04; Z-score: 3.37E+00 | ||
|
Methylation in Case |
2.12E-01 (Median) | Methylation in Control | 1.20E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of ABCC8 in bladder cancer | [ 2 ] | |||
|
Location |
TSS200 (cg17381377) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.43E+00 | Statistic Test | p-value: 9.57E-04; Z-score: 4.67E+00 | ||
|
Methylation in Case |
1.47E-01 (Median) | Methylation in Control | 1.03E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of ABCC8 in bladder cancer | [ 2 ] | |||
|
Location |
TSS200 (cg03181582) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.46E+00 | Statistic Test | p-value: 4.64E-03; Z-score: 1.91E+00 | ||
|
Methylation in Case |
1.28E-01 (Median) | Methylation in Control | 8.73E-02 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 6 |
Methylation of ABCC8 in bladder cancer | [ 2 ] | |||
|
Location |
TSS200 (cg00289429) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.17E+00 | Statistic Test | p-value: 1.06E-02; Z-score: 4.27E+00 | ||
|
Methylation in Case |
1.50E-01 (Median) | Methylation in Control | 1.29E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 7 |
Methylation of ABCC8 in bladder cancer | [ 2 ] | |||
|
Location |
TSS200 (cg22240472) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.41E+00 | Statistic Test | p-value: 2.84E-02; Z-score: 1.51E+00 | ||
|
Methylation in Case |
9.19E-02 (Median) | Methylation in Control | 6.53E-02 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 8 |
Methylation of ABCC8 in bladder cancer | [ 2 ] | |||
|
Location |
1stExon (cg10469152) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.07E+00 | Statistic Test | p-value: 4.56E-02; Z-score: 9.46E-01 | ||
|
Methylation in Case |
1.63E-01 (Median) | Methylation in Control | 1.52E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 9 |
Methylation of ABCC8 in bladder cancer | [ 2 ] | |||
|
Location |
Body (cg20222568) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.30E+00 | Statistic Test | p-value: 3.42E-07; Z-score: -8.79E+00 | ||
|
Methylation in Case |
5.87E-01 (Median) | Methylation in Control | 7.65E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 10 |
Methylation of ABCC8 in bladder cancer | [ 2 ] | |||
|
Location |
Body (cg11886949) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.32E+00 | Statistic Test | p-value: 3.85E-06; Z-score: -7.85E+00 | ||
|
Methylation in Case |
6.03E-01 (Median) | Methylation in Control | 7.99E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 11 |
Methylation of ABCC8 in bladder cancer | [ 2 ] | |||
|
Location |
Body (cg13594863) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.09E+00 | Statistic Test | p-value: 5.95E-06; Z-score: -5.82E+00 | ||
|
Methylation in Case |
7.98E-01 (Median) | Methylation in Control | 8.67E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 12 |
Methylation of ABCC8 in bladder cancer | [ 2 ] | |||
|
Location |
Body (cg06535308) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 2.35E+00 | Statistic Test | p-value: 1.12E-05; Z-score: 6.49E+00 | ||
|
Methylation in Case |
3.11E-01 (Median) | Methylation in Control | 1.32E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 13 |
Methylation of ABCC8 in bladder cancer | [ 2 ] | |||
|
Location |
Body (cg13295314) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.35E+00 | Statistic Test | p-value: 1.32E-05; Z-score: -4.15E+00 | ||
|
Methylation in Case |
4.67E-01 (Median) | Methylation in Control | 6.32E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 14 |
Methylation of ABCC8 in bladder cancer | [ 2 ] | |||
|
Location |
Body (cg24260135) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -2.28E+00 | Statistic Test | p-value: 1.34E-05; Z-score: -4.54E+00 | ||
|
Methylation in Case |
2.30E-01 (Median) | Methylation in Control | 5.24E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 15 |
Methylation of ABCC8 in bladder cancer | [ 2 ] | |||
|
Location |
Body (cg14051368) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -2.28E+00 | Statistic Test | p-value: 1.72E-04; Z-score: -3.67E+00 | ||
|
Methylation in Case |
2.10E-01 (Median) | Methylation in Control | 4.80E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 16 |
Methylation of ABCC8 in bladder cancer | [ 2 ] | |||
|
Location |
Body (cg26105227) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -2.84E+00 | Statistic Test | p-value: 2.04E-03; Z-score: -2.65E+00 | ||
|
Methylation in Case |
9.77E-02 (Median) | Methylation in Control | 2.77E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 17 |
Methylation of ABCC8 in bladder cancer | [ 2 ] | |||
|
Location |
Body (cg06342870) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.04E+00 | Statistic Test | p-value: 3.31E-03; Z-score: -2.30E+00 | ||
|
Methylation in Case |
8.74E-01 (Median) | Methylation in Control | 9.07E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 18 |
Methylation of ABCC8 in bladder cancer | [ 2 ] | |||
|
Location |
Body (cg25308976) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.02E+00 | Statistic Test | p-value: 8.84E-03; Z-score: -1.54E+00 | ||
|
Methylation in Case |
8.47E-01 (Median) | Methylation in Control | 8.62E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 19 |
Methylation of ABCC8 in bladder cancer | [ 2 ] | |||
|
Location |
Body (cg24740587) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.12E+00 | Statistic Test | p-value: 2.91E-02; Z-score: 9.37E-01 | ||
|
Methylation in Case |
8.17E-02 (Median) | Methylation in Control | 7.31E-02 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 20 |
Methylation of ABCC8 in bladder cancer | [ 2 ] | |||
|
Location |
Body (cg11981631) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.15E+00 | Statistic Test | p-value: 4.02E-02; Z-score: 9.44E-01 | ||
|
Methylation in Case |
6.77E-02 (Median) | Methylation in Control | 5.89E-02 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Breast cancer |
19 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of ABCC8 in breast cancer | [ 3 ] | |||
|
Location |
TSS1500 (cg13185308) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.14E+00 | Statistic Test | p-value: 1.27E-06; Z-score: 1.44E+00 | ||
|
Methylation in Case |
5.22E-01 (Median) | Methylation in Control | 4.58E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of ABCC8 in breast cancer | [ 3 ] | |||
|
Location |
TSS1500 (cg15683950) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.11E+00 | Statistic Test | p-value: 6.24E-04; Z-score: 9.60E-01 | ||
|
Methylation in Case |
5.50E-01 (Median) | Methylation in Control | 4.95E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of ABCC8 in breast cancer | [ 3 ] | |||
|
Location |
TSS200 (cg17381377) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.78E+00 | Statistic Test | p-value: 3.20E-10; Z-score: 2.39E+00 | ||
|
Methylation in Case |
1.76E-01 (Median) | Methylation in Control | 9.93E-02 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of ABCC8 in breast cancer | [ 3 ] | |||
|
Location |
TSS200 (cg03181582) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.71E+00 | Statistic Test | p-value: 1.04E-08; Z-score: 1.87E+00 | ||
|
Methylation in Case |
1.25E-01 (Median) | Methylation in Control | 7.34E-02 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of ABCC8 in breast cancer | [ 3 ] | |||
|
Location |
TSS200 (cg18097532) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.62E+00 | Statistic Test | p-value: 2.46E-07; Z-score: 9.89E-01 | ||
|
Methylation in Case |
1.35E-01 (Median) | Methylation in Control | 8.34E-02 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 6 |
Methylation of ABCC8 in breast cancer | [ 3 ] | |||
|
Location |
TSS200 (cg00289429) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.27E+00 | Statistic Test | p-value: 3.68E-06; Z-score: 1.16E+00 | ||
|
Methylation in Case |
1.46E-01 (Median) | Methylation in Control | 1.14E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 7 |
Methylation of ABCC8 in breast cancer | [ 3 ] | |||
|
Location |
TSS200 (cg22240472) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.47E+00 | Statistic Test | p-value: 5.04E-06; Z-score: 1.46E+00 | ||
|
Methylation in Case |
9.16E-02 (Median) | Methylation in Control | 6.24E-02 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 8 |
Methylation of ABCC8 in breast cancer | [ 3 ] | |||
|
Location |
TSS200 (cg03790908) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.62E+00 | Statistic Test | p-value: 1.52E-03; Z-score: 1.09E+00 | ||
|
Methylation in Case |
2.89E-02 (Median) | Methylation in Control | 1.78E-02 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 9 |
Methylation of ABCC8 in breast cancer | [ 3 ] | |||
|
Location |
Body (cg13295314) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.15E+00 | Statistic Test | p-value: 1.85E-11; Z-score: -2.18E+00 | ||
|
Methylation in Case |
5.99E-01 (Median) | Methylation in Control | 6.89E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 10 |
Methylation of ABCC8 in breast cancer | [ 3 ] | |||
|
Location |
Body (cg24260135) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.45E+00 | Statistic Test | p-value: 8.96E-08; Z-score: -1.75E+00 | ||
|
Methylation in Case |
3.01E-01 (Median) | Methylation in Control | 4.38E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 11 |
Methylation of ABCC8 in breast cancer | [ 3 ] | |||
|
Location |
Body (cg25308976) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.03E+00 | Statistic Test | p-value: 2.90E-06; Z-score: -9.63E-01 | ||
|
Methylation in Case |
8.19E-01 (Median) | Methylation in Control | 8.41E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 12 |
Methylation of ABCC8 in breast cancer | [ 3 ] | |||
|
Location |
Body (cg06535308) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.31E+00 | Statistic Test | p-value: 3.74E-06; Z-score: 1.19E+00 | ||
|
Methylation in Case |
3.16E-01 (Median) | Methylation in Control | 2.42E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 13 |
Methylation of ABCC8 in breast cancer | [ 3 ] | |||
|
Location |
Body (cg20222568) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.04E+00 | Statistic Test | p-value: 1.03E-04; Z-score: -9.66E-01 | ||
|
Methylation in Case |
6.73E-01 (Median) | Methylation in Control | 7.02E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 14 |
Methylation of ABCC8 in breast cancer | [ 3 ] | |||
|
Location |
Body (cg13594863) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.02E+00 | Statistic Test | p-value: 1.11E-04; Z-score: -5.69E-01 | ||
|
Methylation in Case |
8.14E-01 (Median) | Methylation in Control | 8.28E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 15 |
Methylation of ABCC8 in breast cancer | [ 3 ] | |||
|
Location |
Body (cg11886949) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.02E+00 | Statistic Test | p-value: 8.39E-04; Z-score: -7.34E-01 | ||
|
Methylation in Case |
7.71E-01 (Median) | Methylation in Control | 7.89E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 16 |
Methylation of ABCC8 in breast cancer | [ 3 ] | |||
|
Location |
Body (cg11981631) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.12E+00 | Statistic Test | p-value: 1.15E-03; Z-score: 3.73E-01 | ||
|
Methylation in Case |
7.01E-02 (Median) | Methylation in Control | 6.25E-02 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 17 |
Methylation of ABCC8 in breast cancer | [ 3 ] | |||
|
Location |
Body (cg14051368) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.09E+00 | Statistic Test | p-value: 1.88E-03; Z-score: -9.21E-01 | ||
|
Methylation in Case |
4.92E-01 (Median) | Methylation in Control | 5.38E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 18 |
Methylation of ABCC8 in breast cancer | [ 3 ] | |||
|
Location |
Body (cg24740587) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.00E+00 | Statistic Test | p-value: 3.26E-03; Z-score: 1.30E-03 | ||
|
Methylation in Case |
1.14E-01 (Median) | Methylation in Control | 1.14E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 19 |
Methylation of ABCC8 in breast cancer | [ 3 ] | |||
|
Location |
Body (cg26105227) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.19E+00 | Statistic Test | p-value: 2.32E-02; Z-score: -8.25E-01 | ||
|
Methylation in Case |
2.83E-01 (Median) | Methylation in Control | 3.38E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Renal cell carcinoma |
12 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of ABCC8 in clear cell renal cell carcinoma | [ 4 ] | |||
|
Location |
TSS1500 (cg13185308) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.08E+00 | Statistic Test | p-value: 1.35E-02; Z-score: 7.75E-01 | ||
|
Methylation in Case |
6.12E-01 (Median) | Methylation in Control | 5.69E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of ABCC8 in clear cell renal cell carcinoma | [ 4 ] | |||
|
Location |
TSS200 (cg17381377) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 2.98E+00 | Statistic Test | p-value: 2.42E-07; Z-score: 3.52E+00 | ||
|
Methylation in Case |
1.37E-01 (Median) | Methylation in Control | 4.59E-02 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of ABCC8 in clear cell renal cell carcinoma | [ 4 ] | |||
|
Location |
TSS200 (cg18097532) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 2.39E+00 | Statistic Test | p-value: 5.41E-07; Z-score: 2.69E+00 | ||
|
Methylation in Case |
1.67E-01 (Median) | Methylation in Control | 7.02E-02 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of ABCC8 in clear cell renal cell carcinoma | [ 4 ] | |||
|
Location |
TSS200 (cg03181582) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 2.29E+00 | Statistic Test | p-value: 1.35E-06; Z-score: 2.71E+00 | ||
|
Methylation in Case |
1.01E-01 (Median) | Methylation in Control | 4.40E-02 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of ABCC8 in clear cell renal cell carcinoma | [ 4 ] | |||
|
Location |
TSS200 (cg22240472) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.72E+00 | Statistic Test | p-value: 1.53E-04; Z-score: 1.57E+00 | ||
|
Methylation in Case |
5.88E-02 (Median) | Methylation in Control | 3.43E-02 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 6 |
Methylation of ABCC8 in clear cell renal cell carcinoma | [ 4 ] | |||
|
Location |
TSS200 (cg00289429) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.21E+00 | Statistic Test | p-value: 4.52E-04; Z-score: 8.53E-01 | ||
|
Methylation in Case |
8.51E-02 (Median) | Methylation in Control | 7.04E-02 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 7 |
Methylation of ABCC8 in clear cell renal cell carcinoma | [ 4 ] | |||
|
Location |
TSS200 (cg03790908) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.14E+00 | Statistic Test | p-value: 4.35E-03; Z-score: 7.49E-01 | ||
|
Methylation in Case |
2.10E-02 (Median) | Methylation in Control | 1.84E-02 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 8 |
Methylation of ABCC8 in clear cell renal cell carcinoma | [ 4 ] | |||
|
Location |
1stExon (cg10469152) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.10E+00 | Statistic Test | p-value: 4.65E-03; Z-score: 7.92E-01 | ||
|
Methylation in Case |
1.43E-01 (Median) | Methylation in Control | 1.30E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 9 |
Methylation of ABCC8 in clear cell renal cell carcinoma | [ 4 ] | |||
|
Location |
Body (cg06535308) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 3.12E+00 | Statistic Test | p-value: 7.23E-10; Z-score: 5.28E+00 | ||
|
Methylation in Case |
2.12E-01 (Median) | Methylation in Control | 6.81E-02 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 10 |
Methylation of ABCC8 in clear cell renal cell carcinoma | [ 4 ] | |||
|
Location |
Body (cg13594863) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.03E+00 | Statistic Test | p-value: 1.71E-08; Z-score: -2.91E+00 | ||
|
Methylation in Case |
9.23E-01 (Median) | Methylation in Control | 9.48E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 11 |
Methylation of ABCC8 in clear cell renal cell carcinoma | [ 4 ] | |||
|
Location |
Body (cg14051368) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.11E+00 | Statistic Test | p-value: 1.99E-04; Z-score: -1.89E+00 | ||
|
Methylation in Case |
4.82E-01 (Median) | Methylation in Control | 5.37E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 12 |
Methylation of ABCC8 in clear cell renal cell carcinoma | [ 4 ] | |||
|
Location |
Body (cg11981631) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.21E+00 | Statistic Test | p-value: 2.55E-02; Z-score: 5.38E-01 | ||
|
Methylation in Case |
2.48E-02 (Median) | Methylation in Control | 2.05E-02 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Colorectal cancer |
19 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of ABCC8 in colorectal cancer | [ 5 ] | |||
|
Location |
TSS1500 (cg13185308) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.11E+00 | Statistic Test | p-value: 4.17E-03; Z-score: 8.64E-01 | ||
|
Methylation in Case |
5.61E-01 (Median) | Methylation in Control | 5.03E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of ABCC8 in colorectal cancer | [ 5 ] | |||
|
Location |
TSS200 (cg18097532) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 3.53E+00 | Statistic Test | p-value: 1.66E-13; Z-score: 6.85E+00 | ||
|
Methylation in Case |
2.76E-01 (Median) | Methylation in Control | 7.81E-02 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of ABCC8 in colorectal cancer | [ 5 ] | |||
|
Location |
TSS200 (cg00289429) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 2.18E+00 | Statistic Test | p-value: 2.37E-12; Z-score: 7.74E+00 | ||
|
Methylation in Case |
4.11E-01 (Median) | Methylation in Control | 1.88E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of ABCC8 in colorectal cancer | [ 5 ] | |||
|
Location |
TSS200 (cg17381377) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 2.03E+00 | Statistic Test | p-value: 7.31E-12; Z-score: 5.52E+00 | ||
|
Methylation in Case |
4.93E-01 (Median) | Methylation in Control | 2.43E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of ABCC8 in colorectal cancer | [ 5 ] | |||
|
Location |
TSS200 (cg03181582) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 2.72E+00 | Statistic Test | p-value: 1.00E-09; Z-score: 4.91E+00 | ||
|
Methylation in Case |
1.71E-01 (Median) | Methylation in Control | 6.28E-02 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 6 |
Methylation of ABCC8 in colorectal cancer | [ 5 ] | |||
|
Location |
TSS200 (cg22240472) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.68E+00 | Statistic Test | p-value: 9.78E-07; Z-score: 2.16E+00 | ||
|
Methylation in Case |
8.72E-02 (Median) | Methylation in Control | 5.19E-02 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 7 |
Methylation of ABCC8 in colorectal cancer | [ 5 ] | |||
|
Location |
TSS200 (cg03790908) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.40E+00 | Statistic Test | p-value: 1.26E-04; Z-score: 1.20E+00 | ||
|
Methylation in Case |
3.20E-02 (Median) | Methylation in Control | 2.28E-02 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 8 |
Methylation of ABCC8 in colorectal cancer | [ 5 ] | |||
|
Location |
1stExon (cg10469152) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.03E+00 | Statistic Test | p-value: 8.46E-06; Z-score: 4.43E-01 | ||
|
Methylation in Case |
1.86E-01 (Median) | Methylation in Control | 1.80E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 9 |
Methylation of ABCC8 in colorectal cancer | [ 5 ] | |||
|
Location |
Body (cg06535308) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.71E+00 | Statistic Test | p-value: 4.84E-14; Z-score: 4.02E+00 | ||
|
Methylation in Case |
5.94E-01 (Median) | Methylation in Control | 3.47E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 10 |
Methylation of ABCC8 in colorectal cancer | [ 5 ] | |||
|
Location |
Body (cg24260135) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.46E+00 | Statistic Test | p-value: 2.20E-11; Z-score: -2.49E+00 | ||
|
Methylation in Case |
4.39E-01 (Median) | Methylation in Control | 6.40E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 11 |
Methylation of ABCC8 in colorectal cancer | [ 5 ] | |||
|
Location |
Body (cg11981631) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.50E+00 | Statistic Test | p-value: 1.34E-08; Z-score: 2.32E+00 | ||
|
Methylation in Case |
2.12E-01 (Median) | Methylation in Control | 1.42E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 12 |
Methylation of ABCC8 in colorectal cancer | [ 5 ] | |||
|
Location |
Body (cg24740587) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.44E+00 | Statistic Test | p-value: 9.00E-08; Z-score: 2.79E+00 | ||
|
Methylation in Case |
1.94E-01 (Median) | Methylation in Control | 1.34E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 13 |
Methylation of ABCC8 in colorectal cancer | [ 5 ] | |||
|
Location |
Body (cg20222568) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.05E+00 | Statistic Test | p-value: 2.29E-07; Z-score: -1.71E+00 | ||
|
Methylation in Case |
7.97E-01 (Median) | Methylation in Control | 8.41E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 14 |
Methylation of ABCC8 in colorectal cancer | [ 5 ] | |||
|
Location |
Body (cg11886949) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.03E+00 | Statistic Test | p-value: 1.02E-05; Z-score: -1.61E+00 | ||
|
Methylation in Case |
8.68E-01 (Median) | Methylation in Control | 8.93E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 15 |
Methylation of ABCC8 in colorectal cancer | [ 5 ] | |||
|
Location |
Body (cg14051368) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.12E+00 | Statistic Test | p-value: 6.16E-05; Z-score: -8.73E-01 | ||
|
Methylation in Case |
4.72E-01 (Median) | Methylation in Control | 5.29E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 16 |
Methylation of ABCC8 in colorectal cancer | [ 5 ] | |||
|
Location |
Body (cg25308976) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 7.40E-04; Z-score: -6.19E-01 | ||
|
Methylation in Case |
9.29E-01 (Median) | Methylation in Control | 9.34E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 17 |
Methylation of ABCC8 in colorectal cancer | [ 5 ] | |||
|
Location |
Body (cg13594863) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.00E+00 | Statistic Test | p-value: 3.56E-03; Z-score: -4.96E-01 | ||
|
Methylation in Case |
9.25E-01 (Median) | Methylation in Control | 9.29E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 18 |
Methylation of ABCC8 in colorectal cancer | [ 5 ] | |||
|
Location |
Body (cg09575421) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.00E+00 | Statistic Test | p-value: 4.05E-03; Z-score: -3.86E-01 | ||
|
Methylation in Case |
9.44E-01 (Median) | Methylation in Control | 9.48E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Hepatocellular carcinoma |
26 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of ABCC8 in hepatocellular carcinoma | [ 6 ] | |||
|
Location |
TSS1500 (cg22175856) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.48E+00 | Statistic Test | p-value: 8.98E-19; Z-score: -7.10E+00 | ||
|
Methylation in Case |
5.54E-01 (Median) | Methylation in Control | 8.20E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of ABCC8 in hepatocellular carcinoma | [ 6 ] | |||
|
Location |
TSS1500 (cg13577055) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.44E+00 | Statistic Test | p-value: 1.08E-16; Z-score: -4.44E+00 | ||
|
Methylation in Case |
4.63E-01 (Median) | Methylation in Control | 6.66E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of ABCC8 in hepatocellular carcinoma | [ 6 ] | |||
|
Location |
TSS200 (cg13453520) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 4.44E+00 | Statistic Test | p-value: 4.43E-18; Z-score: 9.73E+00 | ||
|
Methylation in Case |
4.20E-01 (Median) | Methylation in Control | 9.46E-02 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of ABCC8 in hepatocellular carcinoma | [ 6 ] | |||
|
Location |
TSS200 (cg17381377) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.92E+00 | Statistic Test | p-value: 2.94E-09; Z-score: 5.01E+00 | ||
|
Methylation in Case |
2.82E-01 (Median) | Methylation in Control | 1.47E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of ABCC8 in hepatocellular carcinoma | [ 6 ] | |||
|
Location |
TSS200 (cg00289429) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.26E+00 | Statistic Test | p-value: 1.37E-06; Z-score: 2.83E+00 | ||
|
Methylation in Case |
1.63E-01 (Median) | Methylation in Control | 1.30E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 6 |
Methylation of ABCC8 in hepatocellular carcinoma | [ 6 ] | |||
|
Location |
TSS200 (cg18097532) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.28E+00 | Statistic Test | p-value: 2.58E-04; Z-score: 9.51E-01 | ||
|
Methylation in Case |
1.94E-01 (Median) | Methylation in Control | 1.51E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 7 |
Methylation of ABCC8 in hepatocellular carcinoma | [ 6 ] | |||
|
Location |
TSS200 (cg03181582) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.15E+00 | Statistic Test | p-value: 1.83E-03; Z-score: 4.79E-01 | ||
|
Methylation in Case |
1.30E-01 (Median) | Methylation in Control | 1.12E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 8 |
Methylation of ABCC8 in hepatocellular carcinoma | [ 6 ] | |||
|
Location |
TSS200 (cg22240472) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.02E+00 | Statistic Test | p-value: 8.58E-03; Z-score: -5.69E-02 | ||
|
Methylation in Case |
8.29E-02 (Median) | Methylation in Control | 8.48E-02 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 9 |
Methylation of ABCC8 in hepatocellular carcinoma | [ 6 ] | |||
|
Location |
TSS200 (cg03790908) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.05E+00 | Statistic Test | p-value: 3.72E-02; Z-score: -8.66E-02 | ||
|
Methylation in Case |
3.23E-02 (Median) | Methylation in Control | 3.39E-02 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 10 |
Methylation of ABCC8 in hepatocellular carcinoma | [ 6 ] | |||
|
Location |
1stExon (cg15951188) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.09E+00 | Statistic Test | p-value: 1.06E-09; Z-score: 1.50E+00 | ||
|
Methylation in Case |
8.87E-01 (Median) | Methylation in Control | 8.17E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 11 |
Methylation of ABCC8 in hepatocellular carcinoma | [ 6 ] | |||
|
Location |
Body (cg12778938) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.60E+00 | Statistic Test | p-value: 3.06E-22; Z-score: -3.59E+00 | ||
|
Methylation in Case |
3.74E-01 (Median) | Methylation in Control | 6.00E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 12 |
Methylation of ABCC8 in hepatocellular carcinoma | [ 6 ] | |||
|
Location |
Body (cg26352073) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.06E+00 | Statistic Test | p-value: 4.81E-19; Z-score: -2.48E+00 | ||
|
Methylation in Case |
8.82E-01 (Median) | Methylation in Control | 9.32E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 13 |
Methylation of ABCC8 in hepatocellular carcinoma | [ 6 ] | |||
|
Location |
Body (cg27470827) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.43E+00 | Statistic Test | p-value: 2.18E-16; Z-score: -2.35E+00 | ||
|
Methylation in Case |
3.96E-01 (Median) | Methylation in Control | 5.68E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 14 |
Methylation of ABCC8 in hepatocellular carcinoma | [ 6 ] | |||
|
Location |
Body (cg16405768) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.55E+00 | Statistic Test | p-value: 6.52E-16; Z-score: -1.14E+01 | ||
|
Methylation in Case |
5.02E-01 (Median) | Methylation in Control | 7.79E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 15 |
Methylation of ABCC8 in hepatocellular carcinoma | [ 6 ] | |||
|
Location |
Body (cg07459121) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.16E+00 | Statistic Test | p-value: 6.37E-15; Z-score: 2.08E+00 | ||
|
Methylation in Case |
7.74E-01 (Median) | Methylation in Control | 6.65E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 16 |
Methylation of ABCC8 in hepatocellular carcinoma | [ 6 ] | |||
|
Location |
Body (cg18274791) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.22E+00 | Statistic Test | p-value: 6.45E-13; Z-score: -8.08E+00 | ||
|
Methylation in Case |
7.92E-01 (Median) | Methylation in Control | 9.62E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 17 |
Methylation of ABCC8 in hepatocellular carcinoma | [ 6 ] | |||
|
Location |
Body (cg26773342) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.23E+00 | Statistic Test | p-value: 7.66E-10; Z-score: -4.27E+00 | ||
|
Methylation in Case |
6.19E-01 (Median) | Methylation in Control | 7.64E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 18 |
Methylation of ABCC8 in hepatocellular carcinoma | [ 6 ] | |||
|
Location |
Body (cg14441891) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.13E+00 | Statistic Test | p-value: 8.77E-10; Z-score: -4.08E+00 | ||
|
Methylation in Case |
7.93E-01 (Median) | Methylation in Control | 8.98E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 19 |
Methylation of ABCC8 in hepatocellular carcinoma | [ 6 ] | |||
|
Location |
Body (cg13295314) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.21E+00 | Statistic Test | p-value: 2.43E-08; Z-score: -1.71E+00 | ||
|
Methylation in Case |
4.86E-01 (Median) | Methylation in Control | 5.88E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 20 |
Methylation of ABCC8 in hepatocellular carcinoma | [ 6 ] | |||
|
Location |
Body (cg06535308) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.43E+00 | Statistic Test | p-value: 8.28E-08; Z-score: 2.26E+00 | ||
|
Methylation in Case |
2.31E-01 (Median) | Methylation in Control | 1.61E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 21 |
Methylation of ABCC8 in hepatocellular carcinoma | [ 6 ] | |||
|
Location |
Body (cg25308976) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.05E+00 | Statistic Test | p-value: 6.68E-07; Z-score: -1.26E+00 | ||
|
Methylation in Case |
7.88E-01 (Median) | Methylation in Control | 8.24E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 22 |
Methylation of ABCC8 in hepatocellular carcinoma | [ 6 ] | |||
|
Location |
Body (cg06342870) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.03E+00 | Statistic Test | p-value: 3.88E-06; Z-score: -8.72E-01 | ||
|
Methylation in Case |
8.58E-01 (Median) | Methylation in Control | 8.81E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 23 |
Methylation of ABCC8 in hepatocellular carcinoma | [ 6 ] | |||
|
Location |
Body (cg20222568) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.06E+00 | Statistic Test | p-value: 3.92E-05; Z-score: -9.58E-01 | ||
|
Methylation in Case |
6.76E-01 (Median) | Methylation in Control | 7.17E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 24 |
Methylation of ABCC8 in hepatocellular carcinoma | [ 6 ] | |||
|
Location |
Body (cg09575421) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.02E+00 | Statistic Test | p-value: 4.13E-03; Z-score: -6.90E-01 | ||
|
Methylation in Case |
8.38E-01 (Median) | Methylation in Control | 8.52E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 25 |
Methylation of ABCC8 in hepatocellular carcinoma | [ 6 ] | |||
|
Location |
Body (cg26105227) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.30E+00 | Statistic Test | p-value: 4.28E-03; Z-score: -1.40E+00 | ||
|
Methylation in Case |
1.49E-01 (Median) | Methylation in Control | 1.94E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 26 |
Methylation of ABCC8 in hepatocellular carcinoma | [ 6 ] | |||
|
Location |
Body (cg11981631) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.04E+00 | Statistic Test | p-value: 7.62E-03; Z-score: -1.89E-01 | ||
|
Methylation in Case |
7.64E-02 (Median) | Methylation in Control | 7.92E-02 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Lung adenocarcinoma |
13 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of ABCC8 in lung adenocarcinoma | [ 7 ] | |||
|
Location |
TSS1500 (cg15683950) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.20E+00 | Statistic Test | p-value: 6.93E-03; Z-score: 1.56E+00 | ||
|
Methylation in Case |
6.03E-01 (Median) | Methylation in Control | 5.04E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of ABCC8 in lung adenocarcinoma | [ 7 ] | |||
|
Location |
TSS1500 (cg13185308) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.10E+00 | Statistic Test | p-value: 4.78E-02; Z-score: 9.39E-01 | ||
|
Methylation in Case |
4.88E-01 (Median) | Methylation in Control | 4.43E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of ABCC8 in lung adenocarcinoma | [ 7 ] | |||
|
Location |
TSS200 (cg18097532) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 2.12E+00 | Statistic Test | p-value: 7.85E-07; Z-score: 6.16E+00 | ||
|
Methylation in Case |
3.22E-01 (Median) | Methylation in Control | 1.52E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of ABCC8 in lung adenocarcinoma | [ 7 ] | |||
|
Location |
TSS200 (cg03181582) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.63E+00 | Statistic Test | p-value: 3.04E-03; Z-score: 6.45E+00 | ||
|
Methylation in Case |
2.10E-01 (Median) | Methylation in Control | 1.29E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of ABCC8 in lung adenocarcinoma | [ 7 ] | |||
|
Location |
TSS200 (cg17381377) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.88E+00 | Statistic Test | p-value: 3.21E-03; Z-score: 2.53E+00 | ||
|
Methylation in Case |
2.51E-01 (Median) | Methylation in Control | 1.34E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 6 |
Methylation of ABCC8 in lung adenocarcinoma | [ 7 ] | |||
|
Location |
TSS200 (cg00289429) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.27E+00 | Statistic Test | p-value: 4.31E-03; Z-score: 2.65E+00 | ||
|
Methylation in Case |
2.05E-01 (Median) | Methylation in Control | 1.61E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 7 |
Methylation of ABCC8 in lung adenocarcinoma | [ 7 ] | |||
|
Location |
TSS200 (cg22240472) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.91E+00 | Statistic Test | p-value: 6.56E-03; Z-score: 6.04E+00 | ||
|
Methylation in Case |
1.60E-01 (Median) | Methylation in Control | 8.37E-02 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 8 |
Methylation of ABCC8 in lung adenocarcinoma | [ 7 ] | |||
|
Location |
TSS200 (cg03790908) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.77E+00 | Statistic Test | p-value: 2.05E-02; Z-score: 3.43E+00 | ||
|
Methylation in Case |
6.92E-02 (Median) | Methylation in Control | 3.92E-02 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 9 |
Methylation of ABCC8 in lung adenocarcinoma | [ 7 ] | |||
|
Location |
Body (cg06535308) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 2.03E+00 | Statistic Test | p-value: 1.70E-03; Z-score: 2.35E+00 | ||
|
Methylation in Case |
3.15E-01 (Median) | Methylation in Control | 1.56E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 10 |
Methylation of ABCC8 in lung adenocarcinoma | [ 7 ] | |||
|
Location |
Body (cg13594863) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.04E+00 | Statistic Test | p-value: 8.05E-03; Z-score: -1.60E+00 | ||
|
Methylation in Case |
8.43E-01 (Median) | Methylation in Control | 8.73E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 11 |
Methylation of ABCC8 in lung adenocarcinoma | [ 7 ] | |||
|
Location |
Body (cg13295314) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.08E+00 | Statistic Test | p-value: 1.09E-02; Z-score: -1.45E+00 | ||
|
Methylation in Case |
5.57E-01 (Median) | Methylation in Control | 6.01E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 12 |
Methylation of ABCC8 in lung adenocarcinoma | [ 7 ] | |||
|
Location |
Body (cg20222568) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.06E+00 | Statistic Test | p-value: 4.62E-02; Z-score: -1.35E+00 | ||
|
Methylation in Case |
7.48E-01 (Median) | Methylation in Control | 7.95E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 13 |
Methylation of ABCC8 in lung adenocarcinoma | [ 7 ] | |||
|
Location |
Body (cg25308976) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.02E+00 | Statistic Test | p-value: 4.67E-02; Z-score: -9.23E-01 | ||
|
Methylation in Case |
8.70E-01 (Median) | Methylation in Control | 8.86E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Pancretic ductal adenocarcinoma |
17 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of ABCC8 in pancretic ductal adenocarcinoma | [ 8 ] | |||
|
Location |
TSS1500 (cg15881238) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.15E+00 | Statistic Test | p-value: 5.03E-20; Z-score: -2.82E+00 | ||
|
Methylation in Case |
7.33E-01 (Median) | Methylation in Control | 8.43E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of ABCC8 in pancretic ductal adenocarcinoma | [ 8 ] | |||
|
Location |
TSS1500 (cg26870192) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.32E+00 | Statistic Test | p-value: 8.22E-11; Z-score: 1.36E+00 | ||
|
Methylation in Case |
1.01E-01 (Median) | Methylation in Control | 7.66E-02 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of ABCC8 in pancretic ductal adenocarcinoma | [ 8 ] | |||
|
Location |
TSS1500 (cg14574037) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.29E+00 | Statistic Test | p-value: 4.56E-05; Z-score: -4.07E-01 | ||
|
Methylation in Case |
8.32E-02 (Median) | Methylation in Control | 1.08E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of ABCC8 in pancretic ductal adenocarcinoma | [ 8 ] | |||
|
Location |
TSS1500 (cg15471063) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 1.71E-04; Z-score: -4.06E-01 | ||
|
Methylation in Case |
8.82E-01 (Median) | Methylation in Control | 8.89E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of ABCC8 in pancretic ductal adenocarcinoma | [ 8 ] | |||
|
Location |
TSS200 (cg10527010) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 3.37E+00 | Statistic Test | p-value: 8.31E-11; Z-score: 2.38E+00 | ||
|
Methylation in Case |
4.20E-01 (Median) | Methylation in Control | 1.25E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 6 |
Methylation of ABCC8 in pancretic ductal adenocarcinoma | [ 8 ] | |||
|
Location |
TSS200 (cg10717290) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.20E+00 | Statistic Test | p-value: 2.77E-10; Z-score: 5.42E-01 | ||
|
Methylation in Case |
1.16E-01 (Median) | Methylation in Control | 9.74E-02 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 7 |
Methylation of ABCC8 in pancretic ductal adenocarcinoma | [ 8 ] | |||
|
Location |
TSS200 (cg26730347) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.17E+00 | Statistic Test | p-value: 1.15E-04; Z-score: -8.02E-01 | ||
|
Methylation in Case |
3.07E-01 (Median) | Methylation in Control | 3.61E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 8 |
Methylation of ABCC8 in pancretic ductal adenocarcinoma | [ 8 ] | |||
|
Location |
1stExon (cg01963297) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.11E+00 | Statistic Test | p-value: 2.57E-05; Z-score: -1.03E+00 | ||
|
Methylation in Case |
4.11E-01 (Median) | Methylation in Control | 4.56E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 9 |
Methylation of ABCC8 in pancretic ductal adenocarcinoma | [ 8 ] | |||
|
Location |
Body (cg13915754) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 3.31E+00 | Statistic Test | p-value: 1.79E-30; Z-score: 4.60E+00 | ||
|
Methylation in Case |
2.93E-01 (Median) | Methylation in Control | 8.85E-02 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 10 |
Methylation of ABCC8 in pancretic ductal adenocarcinoma | [ 8 ] | |||
|
Location |
Body (cg00737593) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.20E+00 | Statistic Test | p-value: 2.20E-13; Z-score: -2.13E+00 | ||
|
Methylation in Case |
6.64E-01 (Median) | Methylation in Control | 7.96E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 11 |
Methylation of ABCC8 in pancretic ductal adenocarcinoma | [ 8 ] | |||
|
Location |
Body (cg21602614) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.30E+00 | Statistic Test | p-value: 1.79E-11; Z-score: -2.51E+00 | ||
|
Methylation in Case |
2.83E-01 (Median) | Methylation in Control | 3.70E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 12 |
Methylation of ABCC8 in pancretic ductal adenocarcinoma | [ 8 ] | |||
|
Location |
Body (cg13418710) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.15E+00 | Statistic Test | p-value: 8.27E-07; Z-score: 1.41E+00 | ||
|
Methylation in Case |
6.83E-01 (Median) | Methylation in Control | 5.92E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 13 |
Methylation of ABCC8 in pancretic ductal adenocarcinoma | [ 8 ] | |||
|
Location |
Body (cg02242894) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.09E+00 | Statistic Test | p-value: 9.05E-07; Z-score: 1.45E+00 | ||
|
Methylation in Case |
8.82E-01 (Median) | Methylation in Control | 8.10E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 14 |
Methylation of ABCC8 in pancretic ductal adenocarcinoma | [ 8 ] | |||
|
Location |
Body (cg22772691) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.18E+00 | Statistic Test | p-value: 7.69E-05; Z-score: -1.10E+00 | ||
|
Methylation in Case |
4.35E-01 (Median) | Methylation in Control | 5.15E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 15 |
Methylation of ABCC8 in pancretic ductal adenocarcinoma | [ 8 ] | |||
|
Location |
Body (cg26327804) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.07E+00 | Statistic Test | p-value: 4.45E-04; Z-score: 5.88E-01 | ||
|
Methylation in Case |
4.36E-01 (Median) | Methylation in Control | 4.06E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 16 |
Methylation of ABCC8 in pancretic ductal adenocarcinoma | [ 8 ] | |||
|
Location |
Body (cg14326305) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.16E+00 | Statistic Test | p-value: 8.17E-03; Z-score: 6.17E-01 | ||
|
Methylation in Case |
5.28E-01 (Median) | Methylation in Control | 4.54E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 17 |
Methylation of ABCC8 in pancretic ductal adenocarcinoma | [ 8 ] | |||
|
Location |
Body (cg11713480) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.00E+00 | Statistic Test | p-value: 2.51E-02; Z-score: -2.49E-01 | ||
|
Methylation in Case |
8.92E-01 (Median) | Methylation in Control | 8.95E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Papillary thyroid cancer |
9 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of ABCC8 in papillary thyroid cancer | [ 9 ] | |||
|
Location |
TSS1500 (cg14469826) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.09E+00 | Statistic Test | p-value: 2.89E-02; Z-score: -8.07E-01 | ||
|
Methylation in Case |
5.89E-01 (Median) | Methylation in Control | 6.43E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of ABCC8 in papillary thyroid cancer | [ 9 ] | |||
|
Location |
TSS200 (cg03181582) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.16E+00 | Statistic Test | p-value: 1.35E-03; Z-score: 7.58E-01 | ||
|
Methylation in Case |
1.11E-01 (Median) | Methylation in Control | 9.61E-02 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of ABCC8 in papillary thyroid cancer | [ 9 ] | |||
|
Location |
TSS200 (cg17381377) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.25E+00 | Statistic Test | p-value: 4.66E-03; Z-score: 8.48E-01 | ||
|
Methylation in Case |
8.46E-02 (Median) | Methylation in Control | 6.76E-02 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of ABCC8 in papillary thyroid cancer | [ 9 ] | |||
|
Location |
TSS200 (cg18097532) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.06E+00 | Statistic Test | p-value: 2.87E-02; Z-score: 2.38E-01 | ||
|
Methylation in Case |
1.19E-01 (Median) | Methylation in Control | 1.12E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of ABCC8 in papillary thyroid cancer | [ 9 ] | |||
|
Location |
Body (cg13594863) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 3.48E-06; Z-score: -8.23E-01 | ||
|
Methylation in Case |
9.14E-01 (Median) | Methylation in Control | 9.28E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 6 |
Methylation of ABCC8 in papillary thyroid cancer | [ 9 ] | |||
|
Location |
Body (cg14051368) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.10E+00 | Statistic Test | p-value: 2.88E-05; Z-score: -1.03E+00 | ||
|
Methylation in Case |
6.24E-01 (Median) | Methylation in Control | 6.85E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 7 |
Methylation of ABCC8 in papillary thyroid cancer | [ 9 ] | |||
|
Location |
Body (cg06535308) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.14E+00 | Statistic Test | p-value: 5.63E-04; Z-score: 6.57E-01 | ||
|
Methylation in Case |
1.36E-01 (Median) | Methylation in Control | 1.20E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 8 |
Methylation of ABCC8 in papillary thyroid cancer | [ 9 ] | |||
|
Location |
Body (cg24740587) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.07E+00 | Statistic Test | p-value: 9.23E-03; Z-score: -3.96E-01 | ||
|
Methylation in Case |
7.00E-02 (Median) | Methylation in Control | 7.52E-02 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 9 |
Methylation of ABCC8 in papillary thyroid cancer | [ 9 ] | |||
|
Location |
Body (cg13295314) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 2.52E-02; Z-score: -3.00E-01 | ||
|
Methylation in Case |
7.51E-01 (Median) | Methylation in Control | 7.62E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Prostate cancer |
3 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of ABCC8 in prostate cancer | [ 10 ] | |||
|
Location |
TSS1500 (cg07424912) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.86E+00 | Statistic Test | p-value: 4.02E-02; Z-score: -2.03E+00 | ||
|
Methylation in Case |
3.16E-01 (Median) | Methylation in Control | 5.88E-01 (Median) | ||
|
Studied Phenotype |
Prostate cancer [ ICD-11: 2C82] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of ABCC8 in prostate cancer | [ 10 ] | |||
|
Location |
Body (cg18003583) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.11E+00 | Statistic Test | p-value: 1.89E-02; Z-score: 7.18E+00 | ||
|
Methylation in Case |
9.35E-01 (Median) | Methylation in Control | 8.42E-01 (Median) | ||
|
Studied Phenotype |
Prostate cancer [ ICD-11: 2C82] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of ABCC8 in prostate cancer | [ 10 ] | |||
|
Location |
Body (cg19773466) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.08E+00 | Statistic Test | p-value: 2.63E-02; Z-score: 1.63E+00 | ||
|
Methylation in Case |
7.10E-01 (Median) | Methylation in Control | 6.57E-01 (Median) | ||
|
Studied Phenotype |
Prostate cancer [ ICD-11: 2C82] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Depression |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of ABCC8 in depression | [ 11 ] | |||
|
Location |
TSS200 (cg03790908) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.07E+00 | Statistic Test | p-value: 3.06E-02; Z-score: 4.47E-01 | ||
|
Methylation in Case |
4.27E-02 (Median) | Methylation in Control | 4.01E-02 (Median) | ||
|
Studied Phenotype |
Depression [ ICD-11: 6A8Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
HIV infection |
12 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of ABCC8 in HIV infection | [ 12 ] | |||
|
Location |
TSS200 (cg03181582) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.62E+00 | Statistic Test | p-value: 1.43E-07; Z-score: 2.48E+00 | ||
|
Methylation in Case |
1.51E-01 (Median) | Methylation in Control | 9.31E-02 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of ABCC8 in HIV infection | [ 12 ] | |||
|
Location |
TSS200 (cg22240472) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.76E+00 | Statistic Test | p-value: 8.37E-07; Z-score: 1.86E+00 | ||
|
Methylation in Case |
9.22E-02 (Median) | Methylation in Control | 5.24E-02 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of ABCC8 in HIV infection | [ 12 ] | |||
|
Location |
TSS200 (cg18097532) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.80E+00 | Statistic Test | p-value: 1.11E-06; Z-score: 2.73E+00 | ||
|
Methylation in Case |
1.80E-01 (Median) | Methylation in Control | 9.99E-02 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of ABCC8 in HIV infection | [ 12 ] | |||
|
Location |
TSS200 (cg17381377) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.70E+00 | Statistic Test | p-value: 7.65E-06; Z-score: 2.49E+00 | ||
|
Methylation in Case |
1.76E-01 (Median) | Methylation in Control | 1.04E-01 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of ABCC8 in HIV infection | [ 12 ] | |||
|
Location |
TSS200 (cg03790908) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 2.02E+00 | Statistic Test | p-value: 2.80E-04; Z-score: 1.95E+00 | ||
|
Methylation in Case |
2.99E-02 (Median) | Methylation in Control | 1.48E-02 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 6 |
Methylation of ABCC8 in HIV infection | [ 12 ] | |||
|
Location |
TSS200 (cg00289429) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.11E+00 | Statistic Test | p-value: 4.02E-02; Z-score: 6.57E-01 | ||
|
Methylation in Case |
1.39E-01 (Median) | Methylation in Control | 1.26E-01 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 7 |
Methylation of ABCC8 in HIV infection | [ 12 ] | |||
|
Location |
1stExon (cg10469152) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.03E+00 | Statistic Test | p-value: 2.91E-02; Z-score: 3.07E-01 | ||
|
Methylation in Case |
1.42E-01 (Median) | Methylation in Control | 1.38E-01 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 8 |
Methylation of ABCC8 in HIV infection | [ 12 ] | |||
|
Location |
Body (cg09575421) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.08E+00 | Statistic Test | p-value: 5.50E-14; Z-score: 2.25E+00 | ||
|
Methylation in Case |
8.78E-01 (Median) | Methylation in Control | 8.16E-01 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 9 |
Methylation of ABCC8 in HIV infection | [ 12 ] | |||
|
Location |
Body (cg06535308) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.40E+00 | Statistic Test | p-value: 4.35E-05; Z-score: 2.08E+00 | ||
|
Methylation in Case |
1.74E-01 (Median) | Methylation in Control | 1.25E-01 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 10 |
Methylation of ABCC8 in HIV infection | [ 12 ] | |||
|
Location |
Body (cg24260135) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.36E+00 | Statistic Test | p-value: 6.47E-05; Z-score: 1.60E+00 | ||
|
Methylation in Case |
1.19E-01 (Median) | Methylation in Control | 8.73E-02 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 11 |
Methylation of ABCC8 in HIV infection | [ 12 ] | |||
|
Location |
Body (cg11981631) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.21E+00 | Statistic Test | p-value: 1.90E-03; Z-score: 6.58E-01 | ||
|
Methylation in Case |
6.92E-02 (Median) | Methylation in Control | 5.72E-02 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 12 |
Methylation of ABCC8 in HIV infection | [ 12 ] | |||
|
Location |
Body (cg20222568) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.02E+00 | Statistic Test | p-value: 7.97E-03; Z-score: -7.05E-01 | ||
|
Methylation in Case |
7.96E-01 (Median) | Methylation in Control | 8.15E-01 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Atypical teratoid rhabdoid tumor |
9 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of ABCC8 in atypical teratoid rhabdoid tumor | [ 13 ] | |||
|
Location |
1stExon (cg10469152) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.27E+00 | Statistic Test | p-value: 3.77E-20; Z-score: -3.17E+00 | ||
|
Methylation in Case |
6.82E-01 (Median) | Methylation in Control | 8.69E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of ABCC8 in atypical teratoid rhabdoid tumor | [ 13 ] | |||
|
Location |
Body (cg06342870) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.84E+00 | Statistic Test | p-value: 2.36E-03; Z-score: -9.85E-01 | ||
|
Methylation in Case |
1.66E-01 (Median) | Methylation in Control | 3.05E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of ABCC8 in atypical teratoid rhabdoid tumor | [ 13 ] | |||
|
Location |
Body (cg06535308) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.03E+00 | Statistic Test | p-value: 2.48E-03; Z-score: 6.82E-01 | ||
|
Methylation in Case |
9.26E-01 (Median) | Methylation in Control | 9.01E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of ABCC8 in atypical teratoid rhabdoid tumor | [ 13 ] | |||
|
Location |
Body (cg09575421) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.07E+00 | Statistic Test | p-value: 1.13E-02; Z-score: 6.06E-01 | ||
|
Methylation in Case |
8.16E-01 (Median) | Methylation in Control | 7.64E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of ABCC8 in atypical teratoid rhabdoid tumor | [ 13 ] | |||
|
Location |
Body (cg11886949) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.00E+00 | Statistic Test | p-value: 2.56E-02; Z-score: -3.56E-01 | ||
|
Methylation in Case |
9.72E-01 (Median) | Methylation in Control | 9.76E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 6 |
Methylation of ABCC8 in atypical teratoid rhabdoid tumor | [ 13 ] | |||
|
Location |
Body (cg11981631) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.43E+00 | Statistic Test | p-value: 2.65E-02; Z-score: -5.93E-01 | ||
|
Methylation in Case |
1.34E-01 (Median) | Methylation in Control | 1.93E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 7 |
Methylation of ABCC8 in atypical teratoid rhabdoid tumor | [ 13 ] | |||
|
Location |
Body (cg13295314) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.05E+00 | Statistic Test | p-value: 3.38E-02; Z-score: 4.22E-01 | ||
|
Methylation in Case |
8.85E-01 (Median) | Methylation in Control | 8.43E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 8 |
Methylation of ABCC8 in atypical teratoid rhabdoid tumor | [ 13 ] | |||
|
Location |
Body (cg13594863) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.02E+00 | Statistic Test | p-value: 3.73E-02; Z-score: 5.02E-01 | ||
|
Methylation in Case |
9.42E-01 (Median) | Methylation in Control | 9.26E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 9 |
Methylation of ABCC8 in atypical teratoid rhabdoid tumor | [ 13 ] | |||
|
Location |
Body (cg14051368) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.02E+00 | Statistic Test | p-value: 4.24E-02; Z-score: -4.06E-01 | ||
|
Methylation in Case |
9.01E-01 (Median) | Methylation in Control | 9.20E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Panic disorder |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of ABCC8 in panic disorder | [ 14 ] | |||
|
Location |
Body (cg11886949) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.02E+00 | Statistic Test | p-value: 2.21E-02; Z-score: 1.39E-01 | ||
|
Methylation in Case |
2.13E+00 (Median) | Methylation in Control | 2.08E+00 (Median) | ||
|
Studied Phenotype |
Panic disorder [ ICD-11: 6B01] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Systemic lupus erythematosus |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of ABCC8 in systemic lupus erythematosus | [ 15 ] | |||
|
Location |
Body (cg24260135) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.11E+00 | Statistic Test | p-value: 5.50E-04; Z-score: 3.35E-01 | ||
|
Methylation in Case |
1.66E-01 (Median) | Methylation in Control | 1.49E-01 (Median) | ||
|
Studied Phenotype |
Systemic lupus erythematosus [ ICD-11: 4A40.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Lymphoma |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Significant hypermethylation of ABCC8 in lymphoma than that in healthy individual | ||||
Studied Phenotype |
Lymphoma [ICD-11:2B30] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value: 1.69E-28; Fold-change: 0.374574679; Z-score: 4.93938088 | ||||
|
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
|
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
|
||||
|
Histone acetylation |
|||||
|
Acute myeloid leukemia |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Hypoacetylation of ABCC8 in acute myeloid leukemia (compare with valproate-treatment counterpart AML cells) | [ 16 ] | |||
|
Location |
Promoter | ||||
|
Epigenetic Type |
Histone acetylation | Experiment Method | Chromatin immunoprecipitation | ||
|
Related Molecular Changes |
Down regulation of ABCC8 | Experiment Method | RT-qPCR | ||
|
Studied Phenotype |
Acute myeloid leukemia [ ICD-11: 2A60] | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Additional Notes |
Chromatin immunoprecipitation revealed the hyperacetylation of histone proteins in the promoter regions of MRP8 on valproate treatment. | ||||
|
Promyeloblastic leukemia |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Hypoacetylation of ABCC8 in acute myeloid leukemia (compare with valproate-treatment counterpart AML cells) | [ 17 ] | |||
|
Epigenetic Type |
Histone acetylation | Experiment Method | Chromatin immunoprecipitation | ||
|
Related Molecular Changes |
Down regulation of ABCC8 | Experiment Method | RT-qPCR | ||
|
Studied Phenotype |
Promyeloblastic leukemia [ ICD-11: 2A60.0] | ||||
|
Experimental Material |
Human leukemia stem cell-like cell line (KG-1a) | ||||
|
Additional Notes |
Exposure of promyeloblastic leukemia cells for 24 h to 2 mM of the weak histone deacetylase inhibitor phenylbutyrate resulted in enhanced and marked expression of MRP8. | ||||
|
microRNA |
|||||
|
Unclear Phenotype |
2 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
miR-136 directly targets ABCC8 | [ 18 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-136 | miRNA Mature ID | miR-136-5p | ||
|
miRNA Sequence |
ACUCCAUUUGUUUUGAUGAUGGA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
miR-335 directly targets ABCC8 | [ 19 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | Microarray | ||
|
miRNA Stemloop ID |
miR-335 | miRNA Mature ID | miR-335-5p | ||
|
miRNA Sequence |
UCAAGAGCAAUAACGAAAAAUGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.