Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID DTD0063 Transporter Info
Gene Name ABCD1
Transporter Name Adrenoleukodystrophy protein
Gene ID
215
UniProt ID
P33897
Epigenetic Regulations of This DT (EGR)

Methylation

  Pancretic ductal adenocarcinoma

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of ABCD1 in pancretic ductal adenocarcinoma [ 1 ]

Location

 TSS200 (cg23649004)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.08E+00 Statistic Test p-value: 1.00E-04; Z-score: 2.72E-01

Methylation in Case

 8.22E-02 (Median) Methylation in Control 7.64E-02 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Bladder cancer

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of ABCD1 in bladder cancer [ 2 ]

Location

 Body (cg22534545)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.29E+00 Statistic Test p-value: 5.28E-07; Z-score: -1.11E+01

Methylation in Case

 5.92E-01 (Median) Methylation in Control 7.64E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of ABCD1 in bladder cancer [ 2 ]

Location

 Body (cg02772106)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.78E+00 Statistic Test p-value: 1.36E-03; Z-score: 7.22E+00

Methylation in Case

 2.16E-01 (Median) Methylation in Control 1.21E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Breast cancer

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of ABCD1 in breast cancer [ 3 ]

Location

 Body (cg22534545)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.14E+00 Statistic Test p-value: 1.38E-03; Z-score: -1.04E+00

Methylation in Case

 6.98E-01 (Median) Methylation in Control 7.95E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Colorectal cancer

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of ABCD1 in colorectal cancer [ 4 ]

Location

 Body (cg22534545)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.02E+00 Statistic Test p-value: 3.91E-02; Z-score: -4.95E-01

Methylation in Case

 8.33E-01 (Median) Methylation in Control 8.53E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of ABCD1 in colorectal cancer [ 4 ]

Location

 3'UTR (cg27024381)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.04E+00 Statistic Test p-value: 2.06E-04; Z-score: -1.25E+00

Methylation in Case

 6.88E-01 (Median) Methylation in Control 7.15E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Hepatocellular carcinoma

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of ABCD1 in hepatocellular carcinoma [ 5 ]

Location

 Body (cg22534545)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.03E+00 Statistic Test p-value: 1.15E-04; Z-score: -6.24E-01

Methylation in Case

 7.92E-01 (Median) Methylation in Control 8.13E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of ABCD1 in hepatocellular carcinoma [ 5 ]

Location

 3'UTR (cg27024381)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.16E+00 Statistic Test p-value: 4.61E-06; Z-score: -1.68E+00

Methylation in Case

 4.20E-01 (Median) Methylation in Control 4.85E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

microRNA

  Unclear Phenotype

            4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 miR-23a directly targets ABCD1 [ 6 ]

Epigenetic Type

 microRNA Experiment Method CLASH

miRNA Stemloop ID

 miR-23a miRNA Mature ID miR-23a-3p

miRNA Sequence

 AUCACAUUGCCAGGGAUUUCC

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 2

 miR-26b directly targets ABCD1 [ 7 ]

Epigenetic Type

 microRNA Experiment Method Microarray

miRNA Stemloop ID

 miR-26b miRNA Mature ID miR-26b-5p

miRNA Sequence

 UUCAAGUAAUUCAGGAUAGGU

miRNA Target Type

 Direct

Experimental Material

 Human cervical cancer cell line (Hela)

  Epigenetic Phenomenon 3

 miR-615 directly targets ABCD1 [ 6 ]

Epigenetic Type

 microRNA Experiment Method CLASH

miRNA Stemloop ID

 miR-615 miRNA Mature ID miR-615-3p

miRNA Sequence

 UCCGAGCCUGGGUCUCCCUCUU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 4

 miR-96 directly targets ABCD1 [ 8 ]

Epigenetic Type

 microRNA Experiment Method Microarray

miRNA Stemloop ID

 miR-96 miRNA Mature ID miR-96-5p

miRNA Sequence

 UUUGGCACUAGCACAUUUUUGCU

miRNA Target Type

 Direct

Experimental Material

 Human ovarian carcinoma cell line (SKOV3)
References
1 Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
2 DNA Methylation Dynamics in Urological Tumors.
3 Genome-wide Scan for Methylation Profiles in Breast Cancer
4 Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
5 Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
6 Mapping the human miRNA interactome by CLASH reveals frequent noncanonical binding. Cell. 2013 Apr 25;153(3):654-65.
7 MicroRNA target prediction by expression analysis of host genes. Genome Res. 2009 Mar;19(3):481-90.
8 Dysregulation of miR-106a and miR-591 confers paclitaxel resistance to ovarian cancer. Br J Cancer. 2013 Jul 23;109(2):452-61.

If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.