Detail Information of Epigenetic Regulations
General Information of Drug Transporter (DT) | |||||
---|---|---|---|---|---|
DT ID | DTD0065 Transporter Info | ||||
Gene Name | ABCD3 | ||||
Transporter Name | ATP-binding cassette sub-family D member 3 | ||||
Gene ID | |||||
UniProt ID | |||||
Epigenetic Regulations of This DT (EGR) | |||||
---|---|---|---|---|---|
Methylation |
|||||
Pancretic ductal adenocarcinoma |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon 1 |
Methylation of ABCD3 in pancretic ductal adenocarcinoma | [ 1 ] | |||
Location |
Body (cg12099423) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: 1.15E+00 | Statistic Test | p-value: 7.26E-09; Z-score: 1.61E+00 | ||
Methylation in Case |
6.95E-01 (Median) | Methylation in Control | 6.03E-01 (Median) | ||
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
Experimental Material |
Patient tissue samples | ||||
Breast cancer |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon 1 |
Methylation of ABCD3 in breast cancer | [ 2 ] | |||
Location |
3'UTR (cg11689700) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: -1.05E+00 | Statistic Test | p-value: 1.52E-05; Z-score: -9.97E-01 | ||
Methylation in Case |
8.08E-01 (Median) | Methylation in Control | 8.50E-01 (Median) | ||
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
Experimental Material |
Patient tissue samples | ||||
Colorectal cancer |
2 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon 1 |
Methylation of ABCD3 in colorectal cancer | [ 3 ] | |||
Location |
3'UTR (cg11689700) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: 1.07E+00 | Statistic Test | p-value: 8.01E-04; Z-score: 7.53E-01 | ||
Methylation in Case |
8.65E-01 (Median) | Methylation in Control | 8.11E-01 (Median) | ||
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
Experimental Material |
Patient tissue samples | ||||
Panic disorder |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon 1 |
Methylation of ABCD3 in panic disorder | [ 4 ] | |||
Location |
3'UTR (cg11689700) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: -7.09E-01 | Statistic Test | p-value: 7.96E-04; Z-score: -3.04E-01 | ||
Methylation in Case |
-5.13E-01 (Median) | Methylation in Control | -3.64E-01 (Median) | ||
Studied Phenotype |
Panic disorder [ ICD-11: 6B01] | ||||
Experimental Material |
Patient tissue samples | ||||
microRNA |
|||||
Unclear Phenotype |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon 1 |
miR-21 directly targets ABCD3 | [ 5 ] | |||
Epigenetic Type |
microRNA | Experiment Method | Microarray | ||
miRNA Stemloop ID |
miR-21 | miRNA Mature ID | miR-21-5p | ||
miRNA Sequence |
UAGCUUAUCAGACUGAUGUUGA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Patient tissue samples | ||||
If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.