Detail Information of Epigenetic Regulations
General Information of Drug Transporter (DT) | |||||
---|---|---|---|---|---|
DT ID | DTD0066 Transporter Info | ||||
Gene Name | ABCD4 | ||||
Transporter Name | Peroxisomal membrane protein 1-like | ||||
Gene ID | |||||
UniProt ID | |||||
Epigenetic Regulations of This DT (EGR) | |||||
---|---|---|---|---|---|
microRNA |
|||||
Unclear Phenotype |
2 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon 1 |
miR-26b directly targets ABCD4 | [ 1 ] | |||
Epigenetic Type |
microRNA | Experiment Method | Microarray | ||
miRNA Stemloop ID |
miR-26b | miRNA Mature ID | miR-26b-5p | ||
miRNA Sequence |
UUCAAGUAAUUCAGGAUAGGU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human cervical cancer cell line (Hela) | ||||
Epigenetic Phenomenon 2 |
miR-484 directly targets ABCD4 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | CLASH | ||
miRNA Stemloop ID |
miR-484 | miRNA Mature ID | miR-484 | ||
miRNA Sequence |
UCAGGCUCAGUCCCCUCCCGAU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Methylation |
|||||
If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.