Detail Information of Epigenetic Regulations
General Information of Drug Transporter (DT) | |||||
---|---|---|---|---|---|
DT ID | DTD0078 Transporter Info | ||||
Gene Name | SLC10A6 | ||||
Transporter Name | Sodium-dependent organic anion transporter | ||||
Gene ID | |||||
UniProt ID | |||||
Epigenetic Regulations of This DT (EGR) | |||||
---|---|---|---|---|---|
Methylation |
|||||
Bladder cancer |
5 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon 1 |
Methylation of SLC10A6 in bladder cancer | [ 1 ] | |||
Location |
TSS1500 (cg13119182) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: -2.26E+00 | Statistic Test | p-value: 9.11E-04; Z-score: -3.36E+00 | ||
Methylation in Case |
2.95E-01 (Median) | Methylation in Control | 6.67E-01 (Median) | ||
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon 2 |
Methylation of SLC10A6 in bladder cancer | [ 1 ] | |||
Location |
TSS1500 (cg15881238) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: -1.80E+00 | Statistic Test | p-value: 1.68E-03; Z-score: -2.51E+00 | ||
Methylation in Case |
3.50E-01 (Median) | Methylation in Control | 6.30E-01 (Median) | ||
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon 3 |
Methylation of SLC10A6 in bladder cancer | [ 1 ] | |||
Location |
TSS200 (cg17691545) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: -1.40E+00 | Statistic Test | p-value: 1.44E-02; Z-score: -1.40E+00 | ||
Methylation in Case |
3.61E-01 (Median) | Methylation in Control | 5.07E-01 (Median) | ||
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon 4 |
Methylation of SLC10A6 in bladder cancer | [ 1 ] | |||
Location |
1stExon (cg25177139) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: -1.16E+00 | Statistic Test | p-value: 3.83E-05; Z-score: -1.50E+01 | ||
Methylation in Case |
7.74E-01 (Median) | Methylation in Control | 9.01E-01 (Median) | ||
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon 5 |
Methylation of SLC10A6 in bladder cancer | [ 1 ] | |||
Location |
Body (cg18860310) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: -2.01E+00 | Statistic Test | p-value: 2.25E-09; Z-score: -1.06E+01 | ||
Methylation in Case |
2.35E-01 (Median) | Methylation in Control | 4.73E-01 (Median) | ||
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
Experimental Material |
Patient tissue samples | ||||
Breast cancer |
4 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon 1 |
Methylation of SLC10A6 in breast cancer | [ 2 ] | |||
Location |
TSS1500 (cg13119182) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: 1.18E+00 | Statistic Test | p-value: 3.03E-06; Z-score: 1.24E+00 | ||
Methylation in Case |
6.36E-01 (Median) | Methylation in Control | 5.37E-01 (Median) | ||
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon 2 |
Methylation of SLC10A6 in breast cancer | [ 2 ] | |||
Location |
TSS1500 (cg15881238) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: 1.16E+00 | Statistic Test | p-value: 8.51E-05; Z-score: 8.76E-01 | ||
Methylation in Case |
6.38E-01 (Median) | Methylation in Control | 5.51E-01 (Median) | ||
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon 3 |
Methylation of SLC10A6 in breast cancer | [ 2 ] | |||
Location |
TSS200 (cg17691545) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: 1.26E+00 | Statistic Test | p-value: 1.25E-04; Z-score: 1.29E+00 | ||
Methylation in Case |
5.47E-01 (Median) | Methylation in Control | 4.35E-01 (Median) | ||
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon 4 |
Methylation of SLC10A6 in breast cancer | [ 2 ] | |||
Location |
Body (cg18860310) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: -1.02E+00 | Statistic Test | p-value: 6.50E-03; Z-score: -1.79E-01 | ||
Methylation in Case |
4.41E-01 (Median) | Methylation in Control | 4.50E-01 (Median) | ||
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
Experimental Material |
Patient tissue samples | ||||
Colorectal cancer |
6 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon 1 |
Methylation of SLC10A6 in colorectal cancer | [ 3 ] | |||
Location |
TSS1500 (cg13119182) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: -1.11E+00 | Statistic Test | p-value: 3.68E-10; Z-score: -2.73E+00 | ||
Methylation in Case |
8.26E-01 (Median) | Methylation in Control | 9.17E-01 (Median) | ||
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon 2 |
Methylation of SLC10A6 in colorectal cancer | [ 3 ] | |||
Location |
TSS1500 (cg15881238) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: -1.13E+00 | Statistic Test | p-value: 1.45E-09; Z-score: -2.36E+00 | ||
Methylation in Case |
7.94E-01 (Median) | Methylation in Control | 8.97E-01 (Median) | ||
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon 3 |
Methylation of SLC10A6 in colorectal cancer | [ 3 ] | |||
Location |
TSS200 (cg17691545) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: -1.07E+00 | Statistic Test | p-value: 3.60E-07; Z-score: -2.08E+00 | ||
Methylation in Case |
8.13E-01 (Median) | Methylation in Control | 8.71E-01 (Median) | ||
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon 4 |
Methylation of SLC10A6 in colorectal cancer | [ 3 ] | |||
Location |
1stExon (cg25177139) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: -1.00E+00 | Statistic Test | p-value: 1.79E-02; Z-score: -7.53E-02 | ||
Methylation in Case |
9.48E-01 (Median) | Methylation in Control | 9.49E-01 (Median) | ||
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon 5 |
Methylation of SLC10A6 in colorectal cancer | [ 3 ] | |||
Location |
Body (cg18860310) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: -1.36E+00 | Statistic Test | p-value: 4.90E-10; Z-score: -2.15E+00 | ||
Methylation in Case |
6.02E-01 (Median) | Methylation in Control | 8.22E-01 (Median) | ||
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
Experimental Material |
Patient tissue samples | ||||
Lung adenocarcinoma |
2 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon 1 |
Methylation of SLC10A6 in lung adenocarcinoma | [ 4 ] | |||
Location |
TSS1500 (cg15881238) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: 1.08E+00 | Statistic Test | p-value: 8.56E-03; Z-score: 1.59E+00 | ||
Methylation in Case |
8.29E-01 (Median) | Methylation in Control | 7.66E-01 (Median) | ||
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon 2 |
Methylation of SLC10A6 in lung adenocarcinoma | [ 4 ] | |||
Location |
TSS1500 (cg13119182) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: 1.08E+00 | Statistic Test | p-value: 4.01E-02; Z-score: 1.18E+00 | ||
Methylation in Case |
8.35E-01 (Median) | Methylation in Control | 7.70E-01 (Median) | ||
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
Experimental Material |
Patient tissue samples | ||||
Pancretic ductal adenocarcinoma |
4 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon 1 |
Methylation of SLC10A6 in pancretic ductal adenocarcinoma | [ 5 ] | |||
Location |
TSS1500 (cg16703956) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: 2.96E+00 | Statistic Test | p-value: 1.02E-06; Z-score: 1.63E+00 | ||
Methylation in Case |
5.01E-01 (Median) | Methylation in Control | 1.69E-01 (Median) | ||
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon 2 |
Methylation of SLC10A6 in pancretic ductal adenocarcinoma | [ 5 ] | |||
Location |
Body (cg26213155) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: 1.16E+00 | Statistic Test | p-value: 2.28E-11; Z-score: 2.10E+00 | ||
Methylation in Case |
5.89E-01 (Median) | Methylation in Control | 5.08E-01 (Median) | ||
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon 3 |
Methylation of SLC10A6 in pancretic ductal adenocarcinoma | [ 5 ] | |||
Location |
Body (cg14254480) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: -1.10E+00 | Statistic Test | p-value: 5.00E-07; Z-score: -1.54E+00 | ||
Methylation in Case |
7.99E-01 (Median) | Methylation in Control | 8.77E-01 (Median) | ||
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon 4 |
Methylation of SLC10A6 in pancretic ductal adenocarcinoma | [ 5 ] | |||
Location |
Body (cg13775996) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: 1.03E+00 | Statistic Test | p-value: 1.20E-03; Z-score: 5.44E-01 | ||
Methylation in Case |
8.01E-01 (Median) | Methylation in Control | 7.79E-01 (Median) | ||
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
Experimental Material |
Patient tissue samples | ||||
Papillary thyroid cancer |
4 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon 1 |
Methylation of SLC10A6 in papillary thyroid cancer | [ 6 ] | |||
Location |
TSS1500 (cg15881238) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: 1.11E+00 | Statistic Test | p-value: 1.08E-02; Z-score: 2.89E-01 | ||
Methylation in Case |
2.76E-01 (Median) | Methylation in Control | 2.48E-01 (Median) | ||
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon 2 |
Methylation of SLC10A6 in papillary thyroid cancer | [ 6 ] | |||
Location |
TSS200 (cg17691545) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: 1.18E+00 | Statistic Test | p-value: 2.81E-02; Z-score: 5.11E-01 | ||
Methylation in Case |
3.13E-01 (Median) | Methylation in Control | 2.65E-01 (Median) | ||
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon 3 |
Methylation of SLC10A6 in papillary thyroid cancer | [ 6 ] | |||
Location |
1stExon (cg25177139) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: 1.02E+00 | Statistic Test | p-value: 2.62E-04; Z-score: 5.64E-01 | ||
Methylation in Case |
8.92E-01 (Median) | Methylation in Control | 8.78E-01 (Median) | ||
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon 4 |
Methylation of SLC10A6 in papillary thyroid cancer | [ 6 ] | |||
Location |
Body (cg18860310) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: -1.13E+00 | Statistic Test | p-value: 3.19E-02; Z-score: -4.94E-01 | ||
Methylation in Case |
2.57E-01 (Median) | Methylation in Control | 2.90E-01 (Median) | ||
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
Experimental Material |
Patient tissue samples | ||||
Hepatocellular carcinoma |
2 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon 1 |
Methylation of SLC10A6 in hepatocellular carcinoma | [ 7 ] | |||
Location |
TSS200 (cg24217844) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: 8.04E+00 | Statistic Test | p-value: 2.04E-10; Z-score: 9.26E+00 | ||
Methylation in Case |
1.60E-01 (Median) | Methylation in Control | 1.98E-02 (Median) | ||
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon 2 |
Methylation of SLC10A6 in hepatocellular carcinoma | [ 7 ] | |||
Location |
Body (cg04860674) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: -1.46E+00 | Statistic Test | p-value: 9.99E-16; Z-score: -4.60E+00 | ||
Methylation in Case |
5.80E-01 (Median) | Methylation in Control | 8.47E-01 (Median) | ||
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
Experimental Material |
Patient tissue samples | ||||
Liver cancer |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon 1 |
Significant/significant hypermethylation of SLC10A6 in liver cancer than that in healthy individual/adjacent tissue | ||||
Studied Phenotype |
Liver cancer [ICD-11:2C12] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value: 5.02E-06; Fold-change: -0.449765518; Z-score: -1.223422083 | ||||
The Methylation Level of Disease Section Compare with the Adjacent Tissue |
p-value: 4.99E-28; Fold-change: -0.518867745; Z-score: -10.02879959 | ||||
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue adjacent to the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
DT methylation level in tissue other than the diseased tissue of patients
|
|||||
![]() |
![]() |
||||
Atypical teratoid rhabdoid tumour |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon 1 |
Moderate hypermethylation of SLC10A6 in atypical teratoid rhabdoid tumour than that in healthy individual | ||||
Studied Phenotype |
Atypical teratoid rhabdoid tumour [ICD-11:2A00.1Y] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value: 4.98E-06; Fold-change: 0.226849949; Z-score: 0.696629737 | ||||
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
![]() |
![]() |
||||
Melanocytoma |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon 1 |
Moderate hypermethylation of SLC10A6 in melanocytoma than that in healthy individual | ||||
Studied Phenotype |
Melanocytoma [ICD-11:2F36.2] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value: 9.98E-06; Fold-change: 0.244377617; Z-score: 0.724110197 | ||||
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
![]() |
![]() |
||||
Mixed neuronal-glial tumour |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon 1 |
Moderate hypermethylation of SLC10A6 in mixed neuronal-glial tumour than that in healthy individual | ||||
Studied Phenotype |
Mixed neuronal-glial tumour [ICD-11:2A00.21] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value: 8.44E-10; Fold-change: 0.230838877; Z-score: 0.783165477 | ||||
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
![]() |
![]() |
||||
Myxopapillary ependymoma |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon 1 |
Moderate hypermethylation of SLC10A6 in myxopapillary ependymoma than that in healthy individual | ||||
Studied Phenotype |
Myxopapillary ependymoma [ICD-11:2A00.5] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value: 3.31E-05; Fold-change: 0.231424784; Z-score: 0.73470077 | ||||
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
![]() |
![]() |
||||
Oligodendroglioma |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon 1 |
Moderate hypermethylation of SLC10A6 in oligodendroglioma than that in healthy individual | ||||
Studied Phenotype |
Oligodendroglioma [ICD-11:2A00.0Y] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value: 1.17E-12; Fold-change: 0.23316317; Z-score: 0.843544835 | ||||
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
![]() |
![]() |
||||
Prostate cancer |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon 1 |
Moderate hypermethylation of SLC10A6 in prostate cancer than that in healthy individual | ||||
Studied Phenotype |
Prostate cancer [ICD-11:2C82] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value: 0.000569453; Fold-change: 0.2997758; Z-score: 1.57156148 | ||||
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
![]() |
![]() |
||||
Spinal ependymoma |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon 1 |
Moderate hypermethylation of SLC10A6 in spinal ependymoma than that in healthy individual | ||||
Studied Phenotype |
Spinal ependymoma [ICD-11:2A00.0Y] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value: 0.003296118; Fold-change: 0.220485436; Z-score: 0.694226295 | ||||
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
![]() |
![]() |
||||
Brain neuroepithelial tumour |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon 1 |
Significant hypomethylation of SLC10A6 in brain neuroepithelial tumour than that in healthy individual | ||||
Studied Phenotype |
Brain neuroepithelial tumour [ICD-11:2A00.2Y] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value: 6.16E-18; Fold-change: -0.658974125; Z-score: -2.39401903 | ||||
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
![]() |
![]() |
||||
Central neurocytoma |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon 1 |
Significant hypomethylation of SLC10A6 in central neurocytoma than that in healthy individual | ||||
Studied Phenotype |
Central neurocytoma [ICD-11:2A00.3] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value: 0.000868731; Fold-change: -0.388478197; Z-score: -1.132195824 | ||||
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
![]() |
![]() |
||||
Cerebellar liponeurocytoma |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon 1 |
Significant hypomethylation of SLC10A6 in cerebellar liponeurocytoma than that in healthy individual | ||||
Studied Phenotype |
Cerebellar liponeurocytoma [ICD-11:2A00.0Y] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value: 0.000171315; Fold-change: -0.620644032; Z-score: -1.701965013 | ||||
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
![]() |
![]() |
||||
Craniopharyngioma |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon 1 |
Significant hypomethylation of SLC10A6 in craniopharyngioma than that in healthy individual | ||||
Studied Phenotype |
Craniopharyngioma [ICD-11:2F9A] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value: 0.000127256; Fold-change: -0.403849341; Z-score: -1.199725541 | ||||
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
![]() |
![]() |
||||
Glioblastoma |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon 1 |
Significant hypomethylation of SLC10A6 in glioblastoma than that in healthy individual | ||||
Studied Phenotype |
Glioblastoma [ICD-11:2A00.00] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value: 0.008556755; Fold-change: -0.326447812; Z-score: -0.94050967 | ||||
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
![]() |
![]() |
||||
Lymphoma |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon 1 |
Significant hypomethylation of SLC10A6 in lymphoma than that in healthy individual | ||||
Studied Phenotype |
Lymphoma [ICD-11:2B30] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value: 3.78E-07; Fold-change: -0.316094332; Z-score: -1.142915477 | ||||
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
![]() |
![]() |
||||
Posterior fossa ependymoma |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon 1 |
Significant hypomethylation of SLC10A6 in posterior fossa ependymoma than that in healthy individual | ||||
Studied Phenotype |
Posterior fossa ependymoma [ICD-11:2D50.2] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value: 3.27E-38; Fold-change: -0.334529489; Z-score: -1.600292092 | ||||
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
![]() |
![]() |
||||
RELA YAP fusion ependymoma |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon 1 |
Significant hypomethylation of SLC10A6 in rela yap fusion ependymoma than that in healthy individual | ||||
Studied Phenotype |
RELA YAP fusion ependymoma [ICD-11:2A00.0Y] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value: 4.32E-18; Fold-change: -0.400491022; Z-score: -1.69115592 | ||||
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
![]() |
![]() |
||||
Lung cancer |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon 1 |
Significant hypomethylation of SLC10A6 in lung cancer than that in adjacent tissue | ||||
Studied Phenotype |
Lung cancer [ICD-11:2C25] | ||||
The Methylation Level of Disease Section Compare with the Adjacent Tissue |
p-value: 1.16E-12; Fold-change: -0.587801395; Z-score: -7.931521734 | ||||
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
DT methylation level in tissue other than the diseased tissue of patients
|
|||||
microRNA |
|||||
Unclear Phenotype |
101 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon 1 |
miR-1253 directly targets SLC10A6 | [ 8 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-1253 | miRNA Mature ID | miR-1253 | ||
miRNA Sequence |
AGAGAAGAAGAUCAGCCUGCA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 2 |
miR-1255a directly targets SLC10A6 | [ 9 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-1255a | miRNA Mature ID | miR-1255a | ||
miRNA Sequence |
AGGAUGAGCAAAGAAAGUAGAUU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 3 |
miR-1273h directly targets SLC10A6 | [ 10 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-1273h | miRNA Mature ID | miR-1273h-5p | ||
miRNA Sequence |
CUGGGAGGUCAAGGCUGCAGU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 4 |
miR-1281 directly targets SLC10A6 | [ 10 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-1281 | miRNA Mature ID | miR-1281 | ||
miRNA Sequence |
UCGCCUCCUCCUCUCCC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 5 |
miR-1288 directly targets SLC10A6 | [ 10 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-1288 | miRNA Mature ID | miR-1288-5p | ||
miRNA Sequence |
GCAGAUCAGGACUGUAACUCACC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 6 |
miR-1304 directly targets SLC10A6 | [ 10 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-1304 | miRNA Mature ID | miR-1304-3p | ||
miRNA Sequence |
UCUCACUGUAGCCUCGAACCCC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 7 |
miR-1307 directly targets SLC10A6 | [ 10 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-1307 | miRNA Mature ID | miR-1307-3p | ||
miRNA Sequence |
ACUCGGCGUGGCGUCGGUCGUG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 8 |
miR-1343 directly targets SLC10A6 | [ 10 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-1343 | miRNA Mature ID | miR-1343-3p | ||
miRNA Sequence |
CUCCUGGGGCCCGCACUCUCGC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 9 |
miR-1343 directly targets SLC10A6 | [ 8 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-1343 | miRNA Mature ID | miR-1343-5p | ||
miRNA Sequence |
UGGGGAGCGGCCCCCGGGUGGG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 10 |
miR-149 directly targets SLC10A6 | [ 10 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-149 | miRNA Mature ID | miR-149-3p | ||
miRNA Sequence |
AGGGAGGGACGGGGGCUGUGC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 11 |
miR-193a directly targets SLC10A6 | [ 8 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-193a | miRNA Mature ID | miR-193a-3p | ||
miRNA Sequence |
AACUGGCCUACAAAGUCCCAGU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 12 |
miR-193b directly targets SLC10A6 | [ 8 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-193b | miRNA Mature ID | miR-193b-3p | ||
miRNA Sequence |
AACUGGCCCUCAAAGUCCCGCU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 13 |
miR-219b directly targets SLC10A6 | [ 8 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-219b | miRNA Mature ID | miR-219b-3p | ||
miRNA Sequence |
AGAAUUGCGUUUGGACAAUCAGU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 14 |
miR-23a directly targets SLC10A6 | [ 10 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-23a | miRNA Mature ID | miR-23a-5p | ||
miRNA Sequence |
GGGGUUCCUGGGGAUGGGAUUU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 15 |
miR-23b directly targets SLC10A6 | [ 10 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-23b | miRNA Mature ID | miR-23b-5p | ||
miRNA Sequence |
UGGGUUCCUGGCAUGCUGAUUU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 16 |
miR-25 directly targets SLC10A6 | [ 9 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-25 | miRNA Mature ID | miR-25-5p | ||
miRNA Sequence |
AGGCGGAGACUUGGGCAAUUG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 17 |
miR-302f directly targets SLC10A6 | [ 8 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-302f | miRNA Mature ID | miR-302f | ||
miRNA Sequence |
UAAUUGCUUCCAUGUUU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 18 |
miR-30b directly targets SLC10A6 | [ 10 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-30b | miRNA Mature ID | miR-30b-3p | ||
miRNA Sequence |
CUGGGAGGUGGAUGUUUACUUC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 19 |
miR-30c-1 directly targets SLC10A6 | [ 10 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-30c-1 | miRNA Mature ID | miR-30c-1-3p | ||
miRNA Sequence |
CUGGGAGAGGGUUGUUUACUCC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 20 |
miR-30c-2 directly targets SLC10A6 | [ 10 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-30c-2 | miRNA Mature ID | miR-30c-2-3p | ||
miRNA Sequence |
CUGGGAGAAGGCUGUUUACUCU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 21 |
miR-3116 directly targets SLC10A6 | [ 9 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-3116 | miRNA Mature ID | miR-3116 | ||
miRNA Sequence |
UGCCUGGAACAUAGUAGGGACU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 22 |
miR-3122 directly targets SLC10A6 | [ 10 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-3122 | miRNA Mature ID | miR-3122 | ||
miRNA Sequence |
GUUGGGACAAGAGGACGGUCUU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 23 |
miR-3160 directly targets SLC10A6 | [ 9 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-3160 | miRNA Mature ID | miR-3160-3p | ||
miRNA Sequence |
AGAGCUGAGACUAGAAAGCCCA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 24 |
miR-3175 directly targets SLC10A6 | [ 8 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-3175 | miRNA Mature ID | miR-3175 | ||
miRNA Sequence |
CGGGGAGAGAACGCAGUGACGU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 25 |
miR-3190 directly targets SLC10A6 | [ 8 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-3190 | miRNA Mature ID | miR-3190-5p | ||
miRNA Sequence |
UCUGGCCAGCUACGUCCCCA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 26 |
miR-3197 directly targets SLC10A6 | [ 10 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-3197 | miRNA Mature ID | miR-3197 | ||
miRNA Sequence |
GGAGGCGCAGGCUCGGAAAGGCG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 27 |
miR-3202 directly targets SLC10A6 | [ 9 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-3202 | miRNA Mature ID | miR-3202 | ||
miRNA Sequence |
UGGAAGGGAGAAGAGCUUUAAU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 28 |
miR-3614 directly targets SLC10A6 | [ 10 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-3614 | miRNA Mature ID | miR-3614-5p | ||
miRNA Sequence |
CCACUUGGAUCUGAAGGCUGCCC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 29 |
miR-3672 directly targets SLC10A6 | [ 10 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-3672 | miRNA Mature ID | miR-3672 | ||
miRNA Sequence |
AUGAGACUCAUGUAAAACAUCUU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 30 |
miR-3675 directly targets SLC10A6 | [ 8 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-3675 | miRNA Mature ID | miR-3675-3p | ||
miRNA Sequence |
CAUCUCUAAGGAACUCCCCCAA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 31 |
miR-3689a directly targets SLC10A6 | [ 10 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-3689a | miRNA Mature ID | miR-3689a-3p | ||
miRNA Sequence |
CUGGGAGGUGUGAUAUCGUGGU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 32 |
miR-3689b directly targets SLC10A6 | [ 10 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-3689b | miRNA Mature ID | miR-3689b-3p | ||
miRNA Sequence |
CUGGGAGGUGUGAUAUUGUGGU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 33 |
miR-3689c directly targets SLC10A6 | [ 10 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-3689c | miRNA Mature ID | miR-3689c | ||
miRNA Sequence |
CUGGGAGGUGUGAUAUUGUGGU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 34 |
miR-383 directly targets SLC10A6 | [ 10 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-383 | miRNA Mature ID | miR-383-3p | ||
miRNA Sequence |
ACAGCACUGCCUGGUCAGA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 35 |
miR-3913 directly targets SLC10A6 | [ 10 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-3913 | miRNA Mature ID | miR-3913-5p | ||
miRNA Sequence |
UUUGGGACUGAUCUUGAUGUCU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 36 |
miR-3926 directly targets SLC10A6 | [ 8 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-3926 | miRNA Mature ID | miR-3926 | ||
miRNA Sequence |
UGGCCAAAAAGCAGGCAGAGA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 37 |
miR-3929 directly targets SLC10A6 | [ 10 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-3929 | miRNA Mature ID | miR-3929 | ||
miRNA Sequence |
GAGGCUGAUGUGAGUAGACCACU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 38 |
miR-4434 directly targets SLC10A6 | [ 8 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-4434 | miRNA Mature ID | miR-4434 | ||
miRNA Sequence |
AGGAGAAGUAAAGUAGAA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 39 |
miR-4463 directly targets SLC10A6 | [ 8 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-4463 | miRNA Mature ID | miR-4463 | ||
miRNA Sequence |
GAGACUGGGGUGGGGCC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 40 |
miR-4478 directly targets SLC10A6 | [ 10 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-4478 | miRNA Mature ID | miR-4478 | ||
miRNA Sequence |
GAGGCUGAGCUGAGGAG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 41 |
miR-4485 directly targets SLC10A6 | [ 10 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-4485 | miRNA Mature ID | miR-4485-5p | ||
miRNA Sequence |
ACCGCCUGCCCAGUGA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 42 |
miR-4487 directly targets SLC10A6 | [ 9 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-4487 | miRNA Mature ID | miR-4487 | ||
miRNA Sequence |
AGAGCUGGCUGAAGGGCAG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 43 |
miR-4516 directly targets SLC10A6 | [ 8 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-4516 | miRNA Mature ID | miR-4516 | ||
miRNA Sequence |
GGGAGAAGGGUCGGGGC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 44 |
miR-4533 directly targets SLC10A6 | [ 9 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-4533 | miRNA Mature ID | miR-4533 | ||
miRNA Sequence |
UGGAAGGAGGUUGCCGGACGCU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 45 |
miR-455 directly targets SLC10A6 | [ 9 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-455 | miRNA Mature ID | miR-455-3p | ||
miRNA Sequence |
GCAGUCCAUGGGCAUAUACAC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 46 |
miR-4638 directly targets SLC10A6 | [ 10 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-4638 | miRNA Mature ID | miR-4638-5p | ||
miRNA Sequence |
ACUCGGCUGCGGUGGACAAGU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 47 |
miR-4649 directly targets SLC10A6 | [ 10 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-4649 | miRNA Mature ID | miR-4649-3p | ||
miRNA Sequence |
UCUGAGGCCUGCCUCUCCCCA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 48 |
miR-4667 directly targets SLC10A6 | [ 8 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-4667 | miRNA Mature ID | miR-4667-5p | ||
miRNA Sequence |
ACUGGGGAGCAGAAGGAGAACC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 49 |
miR-4684 directly targets SLC10A6 | [ 8 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-4684 | miRNA Mature ID | miR-4684-5p | ||
miRNA Sequence |
CUCUCUACUGACUUGCAACAUA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 50 |
miR-4700 directly targets SLC10A6 | [ 8 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-4700 | miRNA Mature ID | miR-4700-5p | ||
miRNA Sequence |
UCUGGGGAUGAGGACAGUGUGU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 51 |
miR-4722 directly targets SLC10A6 | [ 8 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-4722 | miRNA Mature ID | miR-4722-5p | ||
miRNA Sequence |
GGCAGGAGGGCUGUGCCAGGUUG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 52 |
miR-4728 directly targets SLC10A6 | [ 10 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-4728 | miRNA Mature ID | miR-4728-5p | ||
miRNA Sequence |
UGGGAGGGGAGAGGCAGCAAGCA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 53 |
miR-4768 directly targets SLC10A6 | [ 8 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-4768 | miRNA Mature ID | miR-4768-3p | ||
miRNA Sequence |
CCAGGAGAUCCAGAGAGAAU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 54 |
miR-4772 directly targets SLC10A6 | [ 10 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-4772 | miRNA Mature ID | miR-4772-3p | ||
miRNA Sequence |
CCUGCAACUUUGCCUGAUCAGA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 55 |
miR-4786 directly targets SLC10A6 | [ 10 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-4786 | miRNA Mature ID | miR-4786-5p | ||
miRNA Sequence |
UGAGACCAGGACUGGAUGCACC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 56 |
miR-485 directly targets SLC10A6 | [ 10 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-485 | miRNA Mature ID | miR-485-5p | ||
miRNA Sequence |
AGAGGCUGGCCGUGAUGAAUUC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 57 |
miR-490 directly targets SLC10A6 | [ 9 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-490 | miRNA Mature ID | miR-490-3p | ||
miRNA Sequence |
CAACCUGGAGGACUCCAUGCUG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 58 |
miR-548s directly targets SLC10A6 | [ 8 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-548s | miRNA Mature ID | miR-548s | ||
miRNA Sequence |
AUGGCCAAAACUGCAGUUAUUUU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 59 |
miR-558 directly targets SLC10A6 | [ 9 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-558 | miRNA Mature ID | miR-558 | ||
miRNA Sequence |
UGAGCUGCUGUACCAAAAU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 60 |
miR-5703 directly targets SLC10A6 | [ 8 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-5703 | miRNA Mature ID | miR-5703 | ||
miRNA Sequence |
AGGAGAAGUCGGGAAGGU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 61 |
miR-619 directly targets SLC10A6 | [ 9 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-619 | miRNA Mature ID | miR-619-3p | ||
miRNA Sequence |
GACCUGGACAUGUUUGUGCCCAGU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 62 |
miR-6499 directly targets SLC10A6 | [ 9 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-6499 | miRNA Mature ID | miR-6499-3p | ||
miRNA Sequence |
AGCAGUGUUUGUUUUGCCCACA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 63 |
miR-6500 directly targets SLC10A6 | [ 10 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-6500 | miRNA Mature ID | miR-6500-3p | ||
miRNA Sequence |
ACACUUGUUGGGAUGACCUGC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 64 |
miR-6513 directly targets SLC10A6 | [ 10 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-6513 | miRNA Mature ID | miR-6513-5p | ||
miRNA Sequence |
UUUGGGAUUGACGCCACAUGUCU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 65 |
miR-6516 directly targets SLC10A6 | [ 9 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-6516 | miRNA Mature ID | miR-6516-5p | ||
miRNA Sequence |
UUUGCAGUAACAGGUGUGAGCA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 66 |
miR-658 directly targets SLC10A6 | [ 9 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-658 | miRNA Mature ID | miR-658 | ||
miRNA Sequence |
GGCGGAGGGAAGUAGGUCCGUUGGU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 67 |
miR-660 directly targets SLC10A6 | [ 10 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-660 | miRNA Mature ID | miR-660-3p | ||
miRNA Sequence |
ACCUCCUGUGUGCAUGGAUUA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 68 |
miR-665 directly targets SLC10A6 | [ 8 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-665 | miRNA Mature ID | miR-665 | ||
miRNA Sequence |
ACCAGGAGGCUGAGGCCCCU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 69 |
miR-6741 directly targets SLC10A6 | [ 10 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-6741 | miRNA Mature ID | miR-6741-3p | ||
miRNA Sequence |
UCGGCUCUCUCCCUCACCCUAG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 70 |
miR-6742 directly targets SLC10A6 | [ 10 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-6742 | miRNA Mature ID | miR-6742-3p | ||
miRNA Sequence |
ACCUGGGUUGUCCCCUCUAG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 71 |
miR-6744 directly targets SLC10A6 | [ 9 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-6744 | miRNA Mature ID | miR-6744-5p | ||
miRNA Sequence |
UGGAUGACAGUGGAGGCCU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 72 |
miR-6763 directly targets SLC10A6 | [ 8 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-6763 | miRNA Mature ID | miR-6763-5p | ||
miRNA Sequence |
CUGGGGAGUGGCUGGGGAG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 73 |
miR-6765 directly targets SLC10A6 | [ 10 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-6765 | miRNA Mature ID | miR-6765-5p | ||
miRNA Sequence |
GUGAGGCGGGGCCAGGAGGGUGUGU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 74 |
miR-6771 directly targets SLC10A6 | [ 8 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-6771 | miRNA Mature ID | miR-6771-3p | ||
miRNA Sequence |
CAAACCCCUGUCUACCCGCAG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 75 |
miR-6779 directly targets SLC10A6 | [ 10 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-6779 | miRNA Mature ID | miR-6779-5p | ||
miRNA Sequence |
CUGGGAGGGGCUGGGUUUGGC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 76 |
miR-6780a directly targets SLC10A6 | [ 10 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-6780a | miRNA Mature ID | miR-6780a-5p | ||
miRNA Sequence |
UUGGGAGGGAAGACAGCUGGAGA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 77 |
miR-6783 directly targets SLC10A6 | [ 10 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-6783 | miRNA Mature ID | miR-6783-3p | ||
miRNA Sequence |
UUCCUGGGCUUCUCCUCUGUAG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 78 |
miR-6785 directly targets SLC10A6 | [ 10 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-6785 | miRNA Mature ID | miR-6785-5p | ||
miRNA Sequence |
UGGGAGGGCGUGGAUGAUGGUG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 79 |
miR-6788 directly targets SLC10A6 | [ 10 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-6788 | miRNA Mature ID | miR-6788-5p | ||
miRNA Sequence |
CUGGGAGAAGAGUGGUGAAGA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 80 |
miR-6791 directly targets SLC10A6 | [ 10 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-6791 | miRNA Mature ID | miR-6791-3p | ||
miRNA Sequence |
UGCCUCCUUGGUCUCCGGCAG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 81 |
miR-6799 directly targets SLC10A6 | [ 10 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-6799 | miRNA Mature ID | miR-6799-5p | ||
miRNA Sequence |
GGGGAGGUGUGCAGGGCUGG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 82 |
miR-6808 directly targets SLC10A6 | [ 8 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-6808 | miRNA Mature ID | miR-6808-5p | ||
miRNA Sequence |
CAGGCAGGGAGGUGGGACCAUG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 83 |
miR-6825 directly targets SLC10A6 | [ 8 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-6825 | miRNA Mature ID | miR-6825-5p | ||
miRNA Sequence |
UGGGGAGGUGUGGAGUCAGCAU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 84 |
miR-6829 directly targets SLC10A6 | [ 10 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-6829 | miRNA Mature ID | miR-6829-3p | ||
miRNA Sequence |
UGCCUCCUCCGUGGCCUCAG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 85 |
miR-6852 directly targets SLC10A6 | [ 10 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-6852 | miRNA Mature ID | miR-6852-5p | ||
miRNA Sequence |
CCCUGGGGUUCUGAGGACAUG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 86 |
miR-6864 directly targets SLC10A6 | [ 10 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-6864 | miRNA Mature ID | miR-6864-3p | ||
miRNA Sequence |
GUGAGACUUCUCUCCCUUCAG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 87 |
miR-6883 directly targets SLC10A6 | [ 10 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-6883 | miRNA Mature ID | miR-6883-5p | ||
miRNA Sequence |
AGGGAGGGUGUGGUAUGGAUGU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 88 |
miR-6884 directly targets SLC10A6 | [ 10 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-6884 | miRNA Mature ID | miR-6884-5p | ||
miRNA Sequence |
AGAGGCUGAGAAGGUGAUGUUG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 89 |
miR-6890 directly targets SLC10A6 | [ 10 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-6890 | miRNA Mature ID | miR-6890-3p | ||
miRNA Sequence |
CCACUGCCUAUGCCCCACAG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 90 |
miR-6893 directly targets SLC10A6 | [ 8 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-6893 | miRNA Mature ID | miR-6893-5p | ||
miRNA Sequence |
CAGGCAGGUGUAGGGUGGAGC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 91 |
miR-7106 directly targets SLC10A6 | [ 10 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-7106 | miRNA Mature ID | miR-7106-5p | ||
miRNA Sequence |
UGGGAGGAGGGGAUCUUGGG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 92 |
miR-7112 directly targets SLC10A6 | [ 10 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-7112 | miRNA Mature ID | miR-7112-5p | ||
miRNA Sequence |
ACGGGCAGGGCAGUGCACCCUG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 93 |
miR-7160 directly targets SLC10A6 | [ 10 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-7160 | miRNA Mature ID | miR-7160-5p | ||
miRNA Sequence |
UGCUGAGGUCCGGGCUGUGCC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 94 |
miR-769 directly targets SLC10A6 | [ 10 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-769 | miRNA Mature ID | miR-769-5p | ||
miRNA Sequence |
UGAGACCUCUGGGUUCUGAGCU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 95 |
miR-7977 directly targets SLC10A6 | [ 10 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-7977 | miRNA Mature ID | miR-7977 | ||
miRNA Sequence |
UUCCCAGCCAACGCACCA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 96 |
miR-8087 directly targets SLC10A6 | [ 9 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-8087 | miRNA Mature ID | miR-8087 | ||
miRNA Sequence |
GAAGACUUCUUGGAUUACAGGGG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 97 |
miR-8089 directly targets SLC10A6 | [ 8 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-8089 | miRNA Mature ID | miR-8089 | ||
miRNA Sequence |
CCUGGGGACAGGGGAUUGGGGCAG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 98 |
miR-887 directly targets SLC10A6 | [ 10 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-887 | miRNA Mature ID | miR-887-5p | ||
miRNA Sequence |
CUUGGGAGCCCUGUUAGACUC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 99 |
miR-939 directly targets SLC10A6 | [ 10 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-939 | miRNA Mature ID | miR-939-3p | ||
miRNA Sequence |
CCCUGGGCCUCUGCUCCCCAG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 100 |
miR-939 directly targets SLC10A6 | [ 8 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-939 | miRNA Mature ID | miR-939-5p | ||
miRNA Sequence |
UGGGGAGCUGAGGCUCUGGGGGUG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 101 |
miR-940 directly targets SLC10A6 | [ 8 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-940 | miRNA Mature ID | miR-940 | ||
miRNA Sequence |
AAGGCAGGGCCCCCGCUCCCC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.