Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID DTD0079 Transporter Info
Gene Name SLC10A7
Transporter Name Sodium/bile acid cotransporter 7
Gene ID
84068
UniProt ID
Q0GE19
Epigenetic Regulations of This DT (EGR)

Methylation

  Atypical teratoid rhabdoid tumor

            5 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC10A7 in atypical teratoid rhabdoid tumor [ 1 ]

Location

 Body (cg05477920)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.51E+00 Statistic Test p-value: 1.50E-03; Z-score: -8.70E-01

Methylation in Case

 2.40E-01 (Median) Methylation in Control 3.63E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC10A7 in atypical teratoid rhabdoid tumor [ 1 ]

Location

 Body (cg05701706)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.07E+00 Statistic Test p-value: 1.64E-03; Z-score: 6.70E-01

Methylation in Case

 8.87E-01 (Median) Methylation in Control 8.28E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC10A7 in atypical teratoid rhabdoid tumor [ 1 ]

Location

 Body (cg09564802)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.47E+00 Statistic Test p-value: 1.11E-02; Z-score: -1.01E+00

Methylation in Case

 2.81E-01 (Median) Methylation in Control 4.14E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC10A7 in atypical teratoid rhabdoid tumor [ 1 ]

Location

 Body (cg10559407)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.06E+00 Statistic Test p-value: 1.54E-02; Z-score: -6.62E-01

Methylation in Case

 7.80E-01 (Median) Methylation in Control 8.29E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC10A7 in atypical teratoid rhabdoid tumor [ 1 ]

Location

 3'UTR (cg11875744)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.24E+00 Statistic Test p-value: 1.12E-11; Z-score: -1.76E+00

Methylation in Case

 5.09E-01 (Median) Methylation in Control 6.34E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Bladder cancer

            4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC10A7 in bladder cancer [ 2 ]

Location

 Body (cg09564802)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.13E+00 Statistic Test p-value: 1.26E-05; Z-score: -7.90E+00

Methylation in Case

 7.21E-01 (Median) Methylation in Control 8.13E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC10A7 in bladder cancer [ 2 ]

Location

 Body (cg10559407)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.06E+00 Statistic Test p-value: 8.82E-03; Z-score: -1.40E+00

Methylation in Case

 7.49E-01 (Median) Methylation in Control 7.92E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC10A7 in bladder cancer [ 2 ]

Location

 Body (cg05477920)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.05E+00 Statistic Test p-value: 4.02E-02; Z-score: -1.73E+00

Methylation in Case

 8.25E-01 (Median) Methylation in Control 8.64E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC10A7 in bladder cancer [ 2 ]

Location

 3'UTR (cg11875744)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.20E+00 Statistic Test p-value: 2.64E-03; Z-score: -2.21E+00

Methylation in Case

 5.56E-01 (Median) Methylation in Control 6.69E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Breast cancer

            3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC10A7 in breast cancer [ 3 ]

Location

 Body (cg10559407)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.09E+00 Statistic Test p-value: 1.44E-04; Z-score: -1.09E+00

Methylation in Case

 7.49E-01 (Median) Methylation in Control 8.20E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC10A7 in breast cancer [ 3 ]

Location

 Body (cg05477920)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.03E+00 Statistic Test p-value: 4.03E-04; Z-score: -6.74E-01

Methylation in Case

 8.53E-01 (Median) Methylation in Control 8.75E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC10A7 in breast cancer [ 3 ]

Location

 Body (cg09564802)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.10E+00 Statistic Test p-value: 3.41E-02; Z-score: -6.62E-01

Methylation in Case

 7.79E-01 (Median) Methylation in Control 8.53E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Colorectal cancer

            5 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC10A7 in colorectal cancer [ 4 ]

Location

 Body (cg10559407)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.03E+00 Statistic Test p-value: 3.64E-06; Z-score: -1.31E+00

Methylation in Case

 9.14E-01 (Median) Methylation in Control 9.42E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC10A7 in colorectal cancer [ 4 ]

Location

 Body (cg05477920)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.02E+00 Statistic Test p-value: 1.37E-05; Z-score: -1.40E+00

Methylation in Case

 9.16E-01 (Median) Methylation in Control 9.31E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC10A7 in colorectal cancer [ 4 ]

Location

 Body (cg05701706)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.02E+00 Statistic Test p-value: 1.53E-05; Z-score: 1.49E+00

Methylation in Case

 9.42E-01 (Median) Methylation in Control 9.22E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC10A7 in colorectal cancer [ 4 ]

Location

 Body (cg09564802)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.02E+00 Statistic Test p-value: 1.12E-04; Z-score: -1.10E+00

Methylation in Case

 8.90E-01 (Median) Methylation in Control 9.10E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Hepatocellular carcinoma

            3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC10A7 in hepatocellular carcinoma [ 5 ]

Location

 Body (cg09564802)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.02E+00 Statistic Test p-value: 2.74E-03; Z-score: -4.60E-01

Methylation in Case

 8.36E-01 (Median) Methylation in Control 8.53E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC10A7 in hepatocellular carcinoma [ 5 ]

Location

 Body (cg10559407)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.03E+00 Statistic Test p-value: 1.24E-02; Z-score: -2.51E-01

Methylation in Case

 8.21E-01 (Median) Methylation in Control 8.49E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC10A7 in hepatocellular carcinoma [ 5 ]

Location

 Body (cg05477920)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.01E+00 Statistic Test p-value: 2.76E-02; Z-score: -3.88E-01

Methylation in Case

 8.62E-01 (Median) Methylation in Control 8.73E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  HIV infection

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC10A7 in HIV infection [ 6 ]

Location

 Body (cg09564802)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.03E+00 Statistic Test p-value: 1.06E-02; Z-score: -6.30E-01

Methylation in Case

 8.31E-01 (Median) Methylation in Control 8.53E-01 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Pancretic ductal adenocarcinoma

            3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC10A7 in pancretic ductal adenocarcinoma [ 7 ]

Location

 Body (cg03525467)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.17E+00 Statistic Test p-value: 1.25E-06; Z-score: -1.49E+00

Methylation in Case

 5.92E-01 (Median) Methylation in Control 6.91E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC10A7 in pancretic ductal adenocarcinoma [ 7 ]

Location

 Body (cg00157228)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.02E+00 Statistic Test p-value: 1.15E-05; Z-score: -4.13E-01

Methylation in Case

 7.68E-01 (Median) Methylation in Control 7.84E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC10A7 in pancretic ductal adenocarcinoma [ 7 ]

Location

 3'UTR (cg03670302)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.01E+00 Statistic Test p-value: 1.46E-02; Z-score: 3.34E-01

Methylation in Case

 8.46E-01 (Median) Methylation in Control 8.37E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Panic disorder

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC10A7 in panic disorder [ 8 ]

Location

 Body (cg10559407)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.14E+00 Statistic Test p-value: 1.33E-05; Z-score: -7.15E-01

Methylation in Case

 1.59E+00 (Median) Methylation in Control 1.81E+00 (Median)

Studied Phenotype

 Panic disorder [ ICD-11: 6B01]

Experimental Material

 Patient tissue samples

  Papillary thyroid cancer

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC10A7 in papillary thyroid cancer [ 9 ]

Location

 Body (cg05701706)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.06E+00 Statistic Test p-value: 1.02E-03; Z-score: 1.88E+00

Methylation in Case

 9.21E-01 (Median) Methylation in Control 8.66E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Systemic lupus erythematosus

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC10A7 in systemic lupus erythematosus [ 10 ]

Location

 Body (cg05701706)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.00E+00 Statistic Test p-value: 2.91E-02; Z-score: -1.23E-01

Methylation in Case

 9.35E-01 (Median) Methylation in Control 9.37E-01 (Median)

Studied Phenotype

 Systemic lupus erythematosus [ ICD-11: 4A40.0]

Experimental Material

 Patient tissue samples

  Posterior fossa ependymoma

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Moderate hypomethylation of SLC10A7 in posterior fossa ependymoma than that in healthy individual

Studied Phenotype

 Posterior fossa ependymoma [ICD-11:2D50.2]

The Methylation Level of Disease Section Compare with the Healthy Individual

 p-value: 6.88E-41; Fold-change: -0.289912779; Z-score: -1.632504638
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue
Download DT methylation data in the tissue of healthy individual

microRNA

  Unclear Phenotype

          66 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 let-7a directly targets SLC10A7 [ 11 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 let-7a miRNA Mature ID let-7a-5p

miRNA Sequence

 UGAGGUAGUAGGUUGUAUAGUU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 2

 let-7b directly targets SLC10A7 [ 11 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 let-7b miRNA Mature ID let-7b-5p

miRNA Sequence

 UGAGGUAGUAGGUUGUGUGGUU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 3

 let-7c directly targets SLC10A7 [ 11 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 let-7c miRNA Mature ID let-7c-5p

miRNA Sequence

 UGAGGUAGUAGGUUGUAUGGUU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 4

 let-7d directly targets SLC10A7 [ 12 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 let-7d miRNA Mature ID let-7d-5p

miRNA Sequence

 AGAGGUAGUAGGUUGCAUAGUU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 5

 let-7e directly targets SLC10A7 [ 11 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 let-7e miRNA Mature ID let-7e-5p

miRNA Sequence

 UGAGGUAGGAGGUUGUAUAGUU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 6

 let-7f directly targets SLC10A7 [ 11 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 let-7f miRNA Mature ID let-7f-5p

miRNA Sequence

 UGAGGUAGUAGAUUGUAUAGUU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 7

 let-7g directly targets SLC10A7 [ 11 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 let-7g miRNA Mature ID let-7g-5p

miRNA Sequence

 UGAGGUAGUAGUUUGUACAGUU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 8

 let-7i directly targets SLC10A7 [ 11 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 let-7i miRNA Mature ID let-7i-5p

miRNA Sequence

 UGAGGUAGUAGUUUGUGCUGUU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 9

 miR-106b directly targets SLC10A7 [ 13 ]

Epigenetic Type

 microRNA Experiment Method CLASH

miRNA Stemloop ID

 miR-106b miRNA Mature ID miR-106b-5p

miRNA Sequence

 UAAAGUGCUGACAGUGCAGAU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 10

 miR-1237 directly targets SLC10A7 [ 11 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-1237 miRNA Mature ID miR-1237-5p

miRNA Sequence

 CGGGGGCGGGGCCGAAGCGCG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 11

 miR-1275 directly targets SLC10A7 [ 11 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-1275 miRNA Mature ID miR-1275

miRNA Sequence

 GUGGGGGAGAGGCUGUC

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 12

 miR-1306 directly targets SLC10A7 [ 14 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-1306 miRNA Mature ID miR-1306-5p

miRNA Sequence

 CCACCUCCCCUGCAAACGUCCA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 13

 miR-132 directly targets SLC10A7 [ 15 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-132 miRNA Mature ID miR-132-3p

miRNA Sequence

 UAACAGUCUACAGCCAUGGUCG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 14

 miR-181a directly targets SLC10A7 [ 16 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-181a miRNA Mature ID miR-181a-5p

miRNA Sequence

 AACAUUCAACGCUGUCGGUGAGU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 15

 miR-181b directly targets SLC10A7 [ 16 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-181b miRNA Mature ID miR-181b-5p

miRNA Sequence

 AACAUUCAUUGCUGUCGGUGGGU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 16

 miR-181c directly targets SLC10A7 [ 16 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-181c miRNA Mature ID miR-181c-5p

miRNA Sequence

 AACAUUCAACCUGUCGGUGAGU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 17

 miR-181d directly targets SLC10A7 [ 16 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-181d miRNA Mature ID miR-181d-5p

miRNA Sequence

 AACAUUCAUUGUUGUCGGUGGGU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 18

 miR-187 directly targets SLC10A7 [ 14 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-187 miRNA Mature ID miR-187-5p

miRNA Sequence

 GGCUACAACACAGGACCCGGGC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 19

 miR-1908 directly targets SLC10A7 [ 11 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-1908 miRNA Mature ID miR-1908-5p

miRNA Sequence

 CGGCGGGGACGGCGAUUGGUC

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 20

 miR-192 directly targets SLC10A7 [ 17 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-192 miRNA Mature ID miR-192-3p

miRNA Sequence

 CUGCCAAUUCCAUAGGUCACAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 21

 miR-196a directly targets SLC10A7 [ 11 ]

Epigenetic Type

 microRNA Experiment Method Sequencing

miRNA Stemloop ID

 miR-196a miRNA Mature ID miR-196a-5p

miRNA Sequence

 UAGGUAGUUUCAUGUUGUUGGG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 22

 miR-212 directly targets SLC10A7 [ 15 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-212 miRNA Mature ID miR-212-3p

miRNA Sequence

 UAACAGUCUCCAGUCACGGCC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 23

 miR-218 directly targets SLC10A7 [ 18 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-218 miRNA Mature ID miR-218-5p

miRNA Sequence

 UUGUGCUUGAUCUAACCAUGU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 24

 miR-221 directly targets SLC10A7 [ 14 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-221 miRNA Mature ID miR-221-3p

miRNA Sequence

 AGCUACAUUGUCUGCUGGGUUUC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 25

 miR-222 directly targets SLC10A7 [ 14 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-222 miRNA Mature ID miR-222-3p

miRNA Sequence

 AGCUACAUCUGGCUACUGGGU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 26

 miR-3121 directly targets SLC10A7 [ 14 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-3121 miRNA Mature ID miR-3121-5p

miRNA Sequence

 UCCUUUGCCUAUUCUAUUUAAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 27

 miR-3177 directly targets SLC10A7 [ 15 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-3177 miRNA Mature ID miR-3177-5p

miRNA Sequence

 UGUGUACACACGUGCCAGGCGCU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 28

 miR-3180 directly targets SLC10A7 [ 11 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-3180 miRNA Mature ID miR-3180

miRNA Sequence

 UGGGGCGGAGCUUCCGGAG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 29

 miR-3180 directly targets SLC10A7 [ 11 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-3180 miRNA Mature ID miR-3180-3p

miRNA Sequence

 UGGGGCGGAGCUUCCGGAGGCC

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 30

 miR-3196 directly targets SLC10A7 [ 11 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-3196 miRNA Mature ID miR-3196

miRNA Sequence

 CGGGGCGGCAGGGGCCUC

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 31

 miR-32 directly targets SLC10A7 [ 16 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-32 miRNA Mature ID miR-32-5p

miRNA Sequence

 UAUUGCACAUUACUAAGUUGCA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 32

 miR-335 directly targets SLC10A7 [ 19 ]

Epigenetic Type

 microRNA Experiment Method Microarray

miRNA Stemloop ID

 miR-335 miRNA Mature ID miR-335-5p

miRNA Sequence

 UCAAGAGCAAUAACGAAAAAUGU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 33

 miR-382 directly targets SLC10A7 [ 11 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-382 miRNA Mature ID miR-382-5p

miRNA Sequence

 GAAGUUGUUCGUGGUGGAUUCG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 34

 miR-3927 directly targets SLC10A7 [ 11 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-3927 miRNA Mature ID miR-3927-3p

miRNA Sequence

 CAGGUAGAUAUUUGAUAGGCAU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 35

 miR-3935 directly targets SLC10A7 [ 11 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-3935 miRNA Mature ID miR-3935

miRNA Sequence

 UGUAGAUACGAGCACCAGCCAC

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 36

 miR-4259 directly targets SLC10A7 [ 11 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4259 miRNA Mature ID miR-4259

miRNA Sequence

 CAGUUGGGUCUAGGGGUCAGGA

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 37

 miR-4282 directly targets SLC10A7 [ 15 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4282 miRNA Mature ID miR-4282

miRNA Sequence

 UAAAAUUUGCAUCCAGGA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 38

 miR-4302 directly targets SLC10A7 [ 15 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4302 miRNA Mature ID miR-4302

miRNA Sequence

 CCAGUGUGGCUCAGCGAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 39

 miR-4458 directly targets SLC10A7 [ 11 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4458 miRNA Mature ID miR-4458

miRNA Sequence

 AGAGGUAGGUGUGGAAGAA

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 40

 miR-4488 directly targets SLC10A7 [ 11 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4488 miRNA Mature ID miR-4488

miRNA Sequence

 AGGGGGCGGGCUCCGGCG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 41

 miR-4500 directly targets SLC10A7 [ 11 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4500 miRNA Mature ID miR-4500

miRNA Sequence

 UGAGGUAGUAGUUUCUU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 42

 miR-4665 directly targets SLC10A7 [ 11 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4665 miRNA Mature ID miR-4665-5p

miRNA Sequence

 CUGGGGGACGCGUGAGCGCGAGC

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 43

 miR-4697 directly targets SLC10A7 [ 11 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4697 miRNA Mature ID miR-4697-5p

miRNA Sequence

 AGGGGGCGCAGUCACUGACGUG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 44

 miR-4706 directly targets SLC10A7 [ 11 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4706 miRNA Mature ID miR-4706

miRNA Sequence

 AGCGGGGAGGAAGUGGGCGCUGCUU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 45

 miR-4749 directly targets SLC10A7 [ 11 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4749 miRNA Mature ID miR-4749-5p

miRNA Sequence

 UGCGGGGACAGGCCAGGGCAUC

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 46

 miR-4799 directly targets SLC10A7 [ 17 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4799 miRNA Mature ID miR-4799-5p

miRNA Sequence

 AUCUAAAUGCAGCAUGCCAGUC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 47

 miR-484 directly targets SLC10A7 [ 13 ]

Epigenetic Type

 microRNA Experiment Method CLASH

miRNA Stemloop ID

 miR-484 miRNA Mature ID miR-484

miRNA Sequence

 UCAGGCUCAGUCCCCUCCCGAU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 48

 miR-495 directly targets SLC10A7 [ 11 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-495 miRNA Mature ID miR-495-5p

miRNA Sequence

 GAAGUUGCCCAUGUUAUUUUCG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 49

 miR-5089 directly targets SLC10A7 [ 14 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-5089 miRNA Mature ID miR-5089-3p

miRNA Sequence

 AUGCUACUCGGAAAUCCCACUGA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 50

 miR-5189 directly targets SLC10A7 [ 17 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-5189 miRNA Mature ID miR-5189-3p

miRNA Sequence

 UGCCAACCGUCAGAGCCCAGA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 51

 miR-548v directly targets SLC10A7 [ 14 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-548v miRNA Mature ID miR-548v

miRNA Sequence

 AGCUACAGUUACUUUUGCACCA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 52

 miR-577 directly targets SLC10A7 [ 11 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-577 miRNA Mature ID miR-577

miRNA Sequence

 UAGAUAAAAUAUUGGUACCUG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 53

 miR-6507 directly targets SLC10A7 [ 14 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6507 miRNA Mature ID miR-6507-3p

miRNA Sequence

 CAAAGUCCUUCCUAUUUUUCCC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 54

 miR-663a directly targets SLC10A7 [ 11 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-663a miRNA Mature ID miR-663a

miRNA Sequence

 AGGCGGGGCGCCGCGGGACCGC

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 55

 miR-6751 directly targets SLC10A7 [ 11 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6751 miRNA Mature ID miR-6751-5p

miRNA Sequence

 UUGGGGGUGAGGUUGGUGUCUGG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 56

 miR-6787 directly targets SLC10A7 [ 11 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6787 miRNA Mature ID miR-6787-5p

miRNA Sequence

 UGGCGGGGGUAGAGCUGGCUGC

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 57

 miR-6803 directly targets SLC10A7 [ 11 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6803 miRNA Mature ID miR-6803-5p

miRNA Sequence

 CUGGGGGUGGGGGGCUGGGCGU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 58

 miR-6816 directly targets SLC10A7 [ 11 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6816 miRNA Mature ID miR-6816-5p

miRNA Sequence

 UGGGGCGGGGCAGGUCCCUGC

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 59

 miR-6831 directly targets SLC10A7 [ 11 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6831 miRNA Mature ID miR-6831-5p

miRNA Sequence

 UAGGUAGAGUGUGAGGAGGAGGUC

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 60

 miR-6846 directly targets SLC10A7 [ 11 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6846 miRNA Mature ID miR-6846-5p

miRNA Sequence

 UGGGGGCUGGAUGGGGUAGAGU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 61

 miR-6848 directly targets SLC10A7 [ 11 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6848 miRNA Mature ID miR-6848-5p

miRNA Sequence

 UGGGGGCUGGGAUGGGCCAUGGU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 62

 miR-6856 directly targets SLC10A7 [ 15 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6856 miRNA Mature ID miR-6856-3p

miRNA Sequence

 UACAGCCCUGUGAUCUUUCCAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 63

 miR-7109 directly targets SLC10A7 [ 11 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-7109 miRNA Mature ID miR-7109-5p

miRNA Sequence

 CUGGGGGGAGGAGACCCUGCU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 64

 miR-92a directly targets SLC10A7 [ 16 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-92a miRNA Mature ID miR-92a-3p

miRNA Sequence

 UAUUGCACUUGUCCCGGCCUGU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 65

 miR-92b directly targets SLC10A7 [ 16 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-92b miRNA Mature ID miR-92b-3p

miRNA Sequence

 UAUUGCACUCGUCCCGGCCUCC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 66

 miR-98 directly targets SLC10A7 [ 11 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-98 miRNA Mature ID miR-98-5p

miRNA Sequence

 UGAGGUAGUAAGUUGUAUUGUU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)
References
1 Atypical Teratoid/Rhabdoid Tumors Are Comprised of Three Epigenetic Subgroups with Distinct Enhancer Landscapes. Cancer Cell. 2016 Mar 14;29(3):379-393.
2 DNA Methylation Dynamics in Urological Tumors.
3 Genome-wide Scan for Methylation Profiles in Breast Cancer
4 Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
5 Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
6 HIV-1 Infection Accelerates Age According to the Epigenetic Clock. J Infect Dis. 2015 Nov 15;212(10):1563-73.
7 Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
8 DNA Methylation signatures in panic disorder. Transl Psychiatry. 2017 Dec 18;7(12):1287.
9 Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
10 Genome-wide DNA methylation analysis of systemic lupus erythematosus reveals persistent hypomethylation of interferon genes and compositional changes to CD4+ T-cell populations. PLoS Genet. 2013;9(8):e1003678.
11 Transcriptome-wide identification of RNA-binding protein and microRNA target sites by PAR-CLIP. Cell. 2010 Apr 2;141(1):129-41.
12 A quantitative analysis of CLIP methods for identifying binding sites of RNA-binding proteins. Nat Methods. 2011 May 15;8(7):559-64.
13 Mapping the human miRNA interactome by CLASH reveals frequent noncanonical binding. Cell. 2013 Apr 25;153(3):654-65.
14 Remodeling of Ago2-mRNA interactions upon cellular stress reflects miRNA complementarity and correlates with altered translation rates. Genes Dev. 2013 Jul 15;27(14):1624-32.
15 The Landscape of microRNA Targeting in Prostate Cancer Defined by AGO-PAR-CLIP. Neoplasia. 2016 Jun;18(6):356-70.
16 EBV and human microRNAs co-target oncogenic and apoptotic viral and human genes during latency. EMBO J. 2012 May 2;31(9):2207-21.
17 Viral microRNA targetome of KSHV-infected primary effusion lymphoma cell lines. Cell Host Microbe. 2011 Nov 17;10(5):515-26.
18 MicroRNA 218 acts as a tumor suppressor by targeting multiple cancer phenotype-associated genes in medulloblastoma. J Biol Chem. 2013 Jan 18;288(3):1918-28.
19 Endogenous human microRNAs that suppress breast cancer metastasis. Nature. 2008 Jan 10;451(7175):147-52.

If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.