Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID	DTD0080 Transporter Info
Gene Name	SLC11A1
Transporter Name	Natural resistance-associated macrophage protein 1
Gene ID	6556
UniProt ID	P49279

Epigenetic Regulations of This DT (EGR)
Methylation
Colon cancer	8 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC11A1 in colon adenocarcinoma			[ 1 ]
Location	5'UTR (cg26870567)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.17E+00	Statistic Test	p-value: 5.48E-06; Z-score: -2.90E+00
Methylation in Case	6.51E-01 (Median)	Methylation in Control	7.62E-01 (Median)
Studied Phenotype	Colon cancer [ ICD-11: 2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC11A1 in colon adenocarcinoma			[ 1 ]
Location	TSS200 (cg16857852)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.33E+00	Statistic Test	p-value: 1.14E-05; Z-score: -1.67E+00
Methylation in Case	3.83E-01 (Median)	Methylation in Control	5.09E-01 (Median)
Studied Phenotype	Colon cancer [ ICD-11: 2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC11A1 in colon adenocarcinoma			[ 1 ]
Location	Body (cg14788003)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.37E+00	Statistic Test	p-value: 1.04E-06; Z-score: -5.42E+00
Methylation in Case	5.36E-01 (Median)	Methylation in Control	7.34E-01 (Median)
Studied Phenotype	Colon cancer [ ICD-11: 2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC11A1 in colon adenocarcinoma			[ 1 ]
Location	Body (cg14260073)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.12E+00	Statistic Test	p-value: 9.68E-06; Z-score: 8.85E-01
Methylation in Case	5.54E-01 (Median)	Methylation in Control	4.93E-01 (Median)
Studied Phenotype	Colon cancer [ ICD-11: 2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC11A1 in colon adenocarcinoma			[ 1 ]
Location	Body (cg19115882)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.19E+00	Statistic Test	p-value: 5.18E-05; Z-score: -2.10E+00
Methylation in Case	5.79E-01 (Median)	Methylation in Control	6.90E-01 (Median)
Studied Phenotype	Colon cancer [ ICD-11: 2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC11A1 in colon adenocarcinoma			[ 1 ]
Location	Body (cg08490220)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.25E+00	Statistic Test	p-value: 8.79E-05; Z-score: -3.58E+00
Methylation in Case	5.40E-01 (Median)	Methylation in Control	6.73E-01 (Median)
Studied Phenotype	Colon cancer [ ICD-11: 2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC11A1 in colon adenocarcinoma			[ 1 ]
Location	Body (cg23516560)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.11E+00	Statistic Test	p-value: 9.75E-04; Z-score: -1.62E+00
Methylation in Case	6.72E-01 (Median)	Methylation in Control	7.46E-01 (Median)
Studied Phenotype	Colon cancer [ ICD-11: 2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of SLC11A1 in colon adenocarcinoma			[ 1 ]
Location	Body (cg11244695)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.02E+00	Statistic Test	p-value: 3.36E-03; Z-score: -9.18E-01
Methylation in Case	8.61E-01 (Median)	Methylation in Control	8.77E-01 (Median)
Studied Phenotype	Colon cancer [ ICD-11: 2B90]
Experimental Material	Patient tissue samples
Pancretic ductal adenocarcinoma	15 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC11A1 in pancretic ductal adenocarcinoma			[ 2 ]
Location	5'UTR (cg01289541)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.59E+00	Statistic Test	p-value: 7.47E-07; Z-score: -1.55E+00
Methylation in Case	3.94E-01 (Median)	Methylation in Control	6.27E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC11A1 in pancretic ductal adenocarcinoma			[ 2 ]
Location	TSS1500 (cg02313331)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.53E+00	Statistic Test	p-value: 1.03E-06; Z-score: -1.29E+00
Methylation in Case	2.41E-01 (Median)	Methylation in Control	3.68E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC11A1 in pancretic ductal adenocarcinoma			[ 2 ]
Location	TSS1500 (cg07583503)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.09E+00	Statistic Test	p-value: 2.89E-04; Z-score: 3.27E-01
Methylation in Case	2.55E-01 (Median)	Methylation in Control	2.34E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC11A1 in pancretic ductal adenocarcinoma			[ 2 ]
Location	TSS1500 (cg11455040)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.15E+00	Statistic Test	p-value: 2.64E-03; Z-score: -3.80E-01
Methylation in Case	7.51E-02 (Median)	Methylation in Control	8.64E-02 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC11A1 in pancretic ductal adenocarcinoma			[ 2 ]
Location	TSS200 (cg19616230)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.31E+00	Statistic Test	p-value: 3.57E-11; Z-score: -2.04E+00
Methylation in Case	2.10E-01 (Median)	Methylation in Control	2.75E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC11A1 in pancretic ductal adenocarcinoma			[ 2 ]
Location	TSS200 (cg02615599)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.33E+00	Statistic Test	p-value: 1.32E-07; Z-score: -1.53E+00
Methylation in Case	1.48E-01 (Median)	Methylation in Control	1.97E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC11A1 in pancretic ductal adenocarcinoma			[ 2 ]
Location	TSS200 (cg10881110)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.10E+00	Statistic Test	p-value: 1.96E-03; Z-score: 6.00E-01
Methylation in Case	5.95E-01 (Median)	Methylation in Control	5.43E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of SLC11A1 in pancretic ductal adenocarcinoma			[ 2 ]
Location	1stExon (cg10671668)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 3.72E+00	Statistic Test	p-value: 2.65E-13; Z-score: 2.70E+00
Methylation in Case	4.88E-01 (Median)	Methylation in Control	1.31E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 9	Methylation of SLC11A1 in pancretic ductal adenocarcinoma			[ 2 ]
Location	Body (cg04106903)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.22E+00	Statistic Test	p-value: 4.01E-05; Z-score: -1.17E+00
Methylation in Case	1.66E-01 (Median)	Methylation in Control	2.02E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 10	Methylation of SLC11A1 in pancretic ductal adenocarcinoma			[ 2 ]
Location	Body (cg13224075)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.04E+00	Statistic Test	p-value: 1.53E-04; Z-score: 9.23E-01
Methylation in Case	9.36E-01 (Median)	Methylation in Control	9.02E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 11	Methylation of SLC11A1 in pancretic ductal adenocarcinoma			[ 2 ]
Location	Body (cg17172593)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.13E+00	Statistic Test	p-value: 3.27E-03; Z-score: -7.74E-01
Methylation in Case	4.86E-01 (Median)	Methylation in Control	5.48E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 12	Methylation of SLC11A1 in pancretic ductal adenocarcinoma			[ 2 ]
Location	Body (cg05561775)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.02E+00	Statistic Test	p-value: 9.85E-03; Z-score: 5.63E-01
Methylation in Case	8.77E-01 (Median)	Methylation in Control	8.62E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 13	Methylation of SLC11A1 in pancretic ductal adenocarcinoma			[ 2 ]
Location	Body (cg04900941)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.02E+00	Statistic Test	p-value: 1.35E-02; Z-score: -3.17E-01
Methylation in Case	7.62E-01 (Median)	Methylation in Control	7.78E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 14	Methylation of SLC11A1 in pancretic ductal adenocarcinoma			[ 2 ]
Location	Body (cg01977413)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.20E+00	Statistic Test	p-value: 1.50E-02; Z-score: -4.97E-01
Methylation in Case	1.26E-01 (Median)	Methylation in Control	1.51E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 15	Methylation of SLC11A1 in pancretic ductal adenocarcinoma			[ 2 ]
Location	Body (cg25423829)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.02E+00	Statistic Test	p-value: 3.54E-02; Z-score: -6.04E-01
Methylation in Case	8.43E-01 (Median)	Methylation in Control	8.57E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Bladder cancer	13 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC11A1 in bladder cancer			[ 3 ]
Location	TSS1500 (cg15099037)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.69E+00	Statistic Test	p-value: 7.10E-13; Z-score: -1.50E+01
Methylation in Case	3.44E-01 (Median)	Methylation in Control	5.82E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC11A1 in bladder cancer			[ 3 ]
Location	TSS1500 (cg13802355)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.54E+00	Statistic Test	p-value: 7.32E-06; Z-score: -4.42E+00
Methylation in Case	3.14E-01 (Median)	Methylation in Control	4.82E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC11A1 in bladder cancer			[ 3 ]
Location	TSS1500 (cg09617319)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.12E+00	Statistic Test	p-value: 5.41E-05; Z-score: -1.19E+01
Methylation in Case	7.37E-01 (Median)	Methylation in Control	8.24E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC11A1 in bladder cancer			[ 3 ]
Location	TSS200 (cg18329052)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.94E+00	Statistic Test	p-value: 2.44E-10; Z-score: -1.11E+01
Methylation in Case	3.41E-01 (Median)	Methylation in Control	6.61E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC11A1 in bladder cancer			[ 3 ]
Location	TSS200 (cg07719512)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.41E+00	Statistic Test	p-value: 4.65E-10; Z-score: -8.21E+00
Methylation in Case	3.89E-01 (Median)	Methylation in Control	5.48E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC11A1 in bladder cancer			[ 3 ]
Location	Body (cg16926316)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -2.06E+00	Statistic Test	p-value: 1.33E-16; Z-score: -2.12E+01
Methylation in Case	4.26E-01 (Median)	Methylation in Control	8.78E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC11A1 in bladder cancer			[ 3 ]
Location	Body (cg23212579)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -2.01E+00	Statistic Test	p-value: 3.54E-15; Z-score: -1.12E+02
Methylation in Case	4.87E-01 (Median)	Methylation in Control	9.78E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of SLC11A1 in bladder cancer			[ 3 ]
Location	Body (cg17130789)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -2.12E+00	Statistic Test	p-value: 5.06E-15; Z-score: -1.59E+01
Methylation in Case	3.65E-01 (Median)	Methylation in Control	7.74E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 9	Methylation of SLC11A1 in bladder cancer			[ 3 ]
Location	Body (cg11378979)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -2.08E+00	Statistic Test	p-value: 7.76E-10; Z-score: -8.87E+00
Methylation in Case	3.34E-01 (Median)	Methylation in Control	6.95E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 10	Methylation of SLC11A1 in bladder cancer			[ 3 ]
Location	Body (cg04337188)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.28E+00	Statistic Test	p-value: 7.93E-08; Z-score: -1.33E+01
Methylation in Case	6.13E-01 (Median)	Methylation in Control	7.87E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 11	Methylation of SLC11A1 in bladder cancer			[ 3 ]
Location	Body (cg01520853)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.08E+00	Statistic Test	p-value: 1.02E-06; Z-score: -5.55E+00
Methylation in Case	7.87E-01 (Median)	Methylation in Control	8.51E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 12	Methylation of SLC11A1 in bladder cancer			[ 3 ]
Location	Body (cg17010118)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.13E+00	Statistic Test	p-value: 1.35E-06; Z-score: -1.19E+01
Methylation in Case	7.92E-01 (Median)	Methylation in Control	8.94E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 13	Methylation of SLC11A1 in bladder cancer			[ 3 ]
Location	3'UTR (cg24007161)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.07E+00	Statistic Test	p-value: 7.95E-03; Z-score: -1.32E+00
Methylation in Case	5.64E-02 (Median)	Methylation in Control	6.04E-02 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Breast cancer	16 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC11A1 in breast cancer			[ 4 ]
Location	TSS1500 (cg15099037)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.25E+00	Statistic Test	p-value: 1.35E-06; Z-score: -1.45E+00
Methylation in Case	4.98E-01 (Median)	Methylation in Control	6.23E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC11A1 in breast cancer			[ 4 ]
Location	TSS1500 (cg13802355)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.15E+00	Statistic Test	p-value: 2.50E-03; Z-score: -6.01E-01
Methylation in Case	3.66E-01 (Median)	Methylation in Control	4.20E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC11A1 in breast cancer			[ 4 ]
Location	TSS1500 (cg09617319)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.04E+00	Statistic Test	p-value: 3.22E-02; Z-score: -5.31E-01
Methylation in Case	7.88E-01 (Median)	Methylation in Control	8.18E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC11A1 in breast cancer			[ 4 ]
Location	TSS200 (cg07719512)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.11E+00	Statistic Test	p-value: 7.85E-04; Z-score: -1.15E+00
Methylation in Case	5.66E-01 (Median)	Methylation in Control	6.31E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC11A1 in breast cancer			[ 4 ]
Location	TSS200 (cg18329052)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.13E+00	Statistic Test	p-value: 1.77E-03; Z-score: -8.31E-01
Methylation in Case	6.63E-01 (Median)	Methylation in Control	7.51E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC11A1 in breast cancer			[ 4 ]
Location	Body (cg07015784)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.13E+00	Statistic Test	p-value: 5.26E-15; Z-score: 2.40E+00
Methylation in Case	9.04E-01 (Median)	Methylation in Control	7.97E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC11A1 in breast cancer			[ 4 ]
Location	Body (cg11378979)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.10E+00	Statistic Test	p-value: 1.93E-12; Z-score: -2.72E+00
Methylation in Case	7.43E-01 (Median)	Methylation in Control	8.17E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of SLC11A1 in breast cancer			[ 4 ]
Location	Body (cg17130789)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.06E+00	Statistic Test	p-value: 3.33E-06; Z-score: -1.28E+00
Methylation in Case	7.43E-01 (Median)	Methylation in Control	7.85E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 9	Methylation of SLC11A1 in breast cancer			[ 4 ]
Location	Body (cg04337188)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.17E+00	Statistic Test	p-value: 4.48E-05; Z-score: -1.13E+00
Methylation in Case	6.68E-01 (Median)	Methylation in Control	7.81E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 10	Methylation of SLC11A1 in breast cancer			[ 4 ]
Location	Body (cg17010118)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.04E+00	Statistic Test	p-value: 9.77E-05; Z-score: -1.14E+00
Methylation in Case	8.58E-01 (Median)	Methylation in Control	8.94E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 11	Methylation of SLC11A1 in breast cancer			[ 4 ]
Location	Body (cg00634542)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.05E+00	Statistic Test	p-value: 1.26E-04; Z-score: -1.08E+00
Methylation in Case	8.06E-01 (Median)	Methylation in Control	8.50E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 12	Methylation of SLC11A1 in breast cancer			[ 4 ]
Location	Body (cg23212579)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.02E+00	Statistic Test	p-value: 9.47E-03; Z-score: -5.02E-01
Methylation in Case	9.64E-01 (Median)	Methylation in Control	9.79E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 13	Methylation of SLC11A1 in breast cancer			[ 4 ]
Location	Body (cg01520853)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.02E+00	Statistic Test	p-value: 1.19E-02; Z-score: -6.64E-01
Methylation in Case	8.42E-01 (Median)	Methylation in Control	8.59E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 14	Methylation of SLC11A1 in breast cancer			[ 4 ]
Location	Body (cg03710889)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.06E+00	Statistic Test	p-value: 1.34E-02; Z-score: 4.36E-01
Methylation in Case	5.91E-01 (Median)	Methylation in Control	5.59E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 15	Methylation of SLC11A1 in breast cancer			[ 4 ]
Location	Body (cg16926316)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.06E+00	Statistic Test	p-value: 2.61E-02; Z-score: -5.15E-01
Methylation in Case	8.38E-01 (Median)	Methylation in Control	8.84E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 16	Methylation of SLC11A1 in breast cancer			[ 4 ]
Location	Body (cg04656051)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.05E+00	Statistic Test	p-value: 3.49E-02; Z-score: 2.82E-01
Methylation in Case	4.47E-01 (Median)	Methylation in Control	4.25E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Colorectal cancer	14 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC11A1 in colorectal cancer			[ 5 ]
Location	TSS1500 (cg15099037)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.16E+00	Statistic Test	p-value: 2.24E-11; Z-score: -2.30E+00
Methylation in Case	6.42E-01 (Median)	Methylation in Control	7.44E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC11A1 in colorectal cancer			[ 5 ]
Location	TSS1500 (cg09617319)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.02E+00	Statistic Test	p-value: 2.99E-06; Z-score: -1.52E+00
Methylation in Case	9.02E-01 (Median)	Methylation in Control	9.22E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC11A1 in colorectal cancer			[ 5 ]
Location	TSS1500 (cg13802355)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.12E+00	Statistic Test	p-value: 1.56E-02; Z-score: 7.06E-01
Methylation in Case	5.74E-01 (Median)	Methylation in Control	5.15E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC11A1 in colorectal cancer			[ 5 ]
Location	TSS200 (cg07719512)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.19E+00	Statistic Test	p-value: 2.08E-14; Z-score: -3.07E+00
Methylation in Case	6.51E-01 (Median)	Methylation in Control	7.78E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC11A1 in colorectal cancer			[ 5 ]
Location	TSS200 (cg18329052)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.13E+00	Statistic Test	p-value: 4.19E-04; Z-score: -9.35E-01
Methylation in Case	7.58E-01 (Median)	Methylation in Control	8.58E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC11A1 in colorectal cancer			[ 5 ]
Location	Body (cg04337188)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.10E+00	Statistic Test	p-value: 2.46E-10; Z-score: -4.85E+00
Methylation in Case	8.08E-01 (Median)	Methylation in Control	8.85E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC11A1 in colorectal cancer			[ 5 ]
Location	Body (cg00634542)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.20E+00	Statistic Test	p-value: 1.82E-08; Z-score: -2.10E+00
Methylation in Case	6.88E-01 (Median)	Methylation in Control	8.24E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of SLC11A1 in colorectal cancer			[ 5 ]
Location	Body (cg17130789)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.04E+00	Statistic Test	p-value: 2.98E-08; Z-score: -2.10E+00
Methylation in Case	8.50E-01 (Median)	Methylation in Control	8.82E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 9	Methylation of SLC11A1 in colorectal cancer			[ 5 ]
Location	Body (cg16926316)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.03E+00	Statistic Test	p-value: 3.42E-06; Z-score: -1.49E+00
Methylation in Case	8.79E-01 (Median)	Methylation in Control	9.07E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 10	Methylation of SLC11A1 in colorectal cancer			[ 5 ]
Location	Body (cg23212579)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.01E+00	Statistic Test	p-value: 1.19E-03; Z-score: -1.16E+00
Methylation in Case	9.67E-01 (Median)	Methylation in Control	9.74E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 11	Methylation of SLC11A1 in colorectal cancer			[ 5 ]
Location	Body (cg01520853)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.01E+00	Statistic Test	p-value: 1.77E-03; Z-score: -5.17E-01
Methylation in Case	9.28E-01 (Median)	Methylation in Control	9.33E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 12	Methylation of SLC11A1 in colorectal cancer			[ 5 ]
Location	3'UTR (cg24007161)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.17E+00	Statistic Test	p-value: 3.73E-05; Z-score: -1.05E+00
Methylation in Case	1.09E-01 (Median)	Methylation in Control	1.28E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 13	Methylation of SLC11A1 in colorectal cancer			[ 5 ]
Location	3'UTR (cg01379701)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.27E+00	Statistic Test	p-value: 1.22E-03; Z-score: -1.00E+00
Methylation in Case	2.52E-02 (Median)	Methylation in Control	3.18E-02 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 14	Moderate hypomethylation of SLC11A1 in colorectal cancer than that in healthy individual
Studied Phenotype	Colorectal cancer [ICD-11:2B91]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 2.09E-18; Fold-change: -0.204270851; Z-score: -1.734780754
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue adjacent to the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data of patients in the normal section of the tissue adjacent to the disease section Download DT methylation data in the tissue of healthy individual
Hepatocellular carcinoma	16 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC11A1 in hepatocellular carcinoma			[ 6 ]
Location	TSS1500 (cg15099037)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.23E+00	Statistic Test	p-value: 5.81E-09; Z-score: -2.21E+00
Methylation in Case	4.46E-01 (Median)	Methylation in Control	5.50E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC11A1 in hepatocellular carcinoma			[ 6 ]
Location	TSS1500 (cg09617319)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.16E+00	Statistic Test	p-value: 1.01E-08; Z-score: -1.06E+00
Methylation in Case	7.21E-01 (Median)	Methylation in Control	8.33E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC11A1 in hepatocellular carcinoma			[ 6 ]
Location	TSS1500 (cg13802355)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.03E+00	Statistic Test	p-value: 1.25E-02; Z-score: -1.10E-01
Methylation in Case	3.85E-01 (Median)	Methylation in Control	3.98E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC11A1 in hepatocellular carcinoma			[ 6 ]
Location	TSS200 (cg08706670)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 6.20E+00	Statistic Test	p-value: 2.78E-14; Z-score: 9.33E+00
Methylation in Case	3.82E-01 (Median)	Methylation in Control	6.16E-02 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC11A1 in hepatocellular carcinoma			[ 6 ]
Location	TSS200 (cg26482893)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.97E+00	Statistic Test	p-value: 6.27E-13; Z-score: 2.26E+00
Methylation in Case	6.41E-01 (Median)	Methylation in Control	3.25E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC11A1 in hepatocellular carcinoma			[ 6 ]
Location	TSS200 (cg07719512)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.09E+00	Statistic Test	p-value: 6.56E-05; Z-score: -9.56E-01
Methylation in Case	5.44E-01 (Median)	Methylation in Control	5.93E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC11A1 in hepatocellular carcinoma			[ 6 ]
Location	Body (cg00712593)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.62E+00	Statistic Test	p-value: 5.57E-18; Z-score: -6.08E+00
Methylation in Case	5.05E-01 (Median)	Methylation in Control	8.17E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of SLC11A1 in hepatocellular carcinoma			[ 6 ]
Location	Body (cg17780246)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.63E+00	Statistic Test	p-value: 6.46E-16; Z-score: 2.86E+00
Methylation in Case	5.42E-01 (Median)	Methylation in Control	3.33E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 9	Methylation of SLC11A1 in hepatocellular carcinoma			[ 6 ]
Location	Body (cg19807207)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.18E+00	Statistic Test	p-value: 1.12E-10; Z-score: -3.47E+00
Methylation in Case	6.73E-01 (Median)	Methylation in Control	7.92E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 10	Methylation of SLC11A1 in hepatocellular carcinoma			[ 6 ]
Location	Body (cg04337188)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.11E+00	Statistic Test	p-value: 1.36E-08; Z-score: -2.26E+00
Methylation in Case	7.15E-01 (Median)	Methylation in Control	7.97E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 11	Methylation of SLC11A1 in hepatocellular carcinoma			[ 6 ]
Location	Body (cg11378979)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.04E+00	Statistic Test	p-value: 8.59E-07; Z-score: -1.43E+00
Methylation in Case	7.91E-01 (Median)	Methylation in Control	8.21E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 12	Methylation of SLC11A1 in hepatocellular carcinoma			[ 6 ]
Location	Body (cg17130789)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.03E+00	Statistic Test	p-value: 7.66E-06; Z-score: -1.01E+00
Methylation in Case	7.91E-01 (Median)	Methylation in Control	8.13E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 13	Methylation of SLC11A1 in hepatocellular carcinoma			[ 6 ]
Location	Body (cg00634542)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.06E+00	Statistic Test	p-value: 3.05E-04; Z-score: -6.07E-01
Methylation in Case	7.51E-01 (Median)	Methylation in Control	7.95E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 14	Methylation of SLC11A1 in hepatocellular carcinoma			[ 6 ]
Location	Body (cg23212579)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.00E+00	Statistic Test	p-value: 1.81E-03; Z-score: -5.76E-01
Methylation in Case	9.78E-01 (Median)	Methylation in Control	9.82E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 15	Methylation of SLC11A1 in hepatocellular carcinoma			[ 6 ]
Location	Body (cg07015784)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.01E+00	Statistic Test	p-value: 6.95E-03; Z-score: 6.26E-01
Methylation in Case	9.49E-01 (Median)	Methylation in Control	9.36E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 16	Methylation of SLC11A1 in hepatocellular carcinoma			[ 6 ]
Location	3'UTR (cg22234897)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 2.68E+00	Statistic Test	p-value: 3.22E-10; Z-score: 2.49E+00
Methylation in Case	1.88E-01 (Median)	Methylation in Control	6.99E-02 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Lung adenocarcinoma	7 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC11A1 in lung adenocarcinoma			[ 7 ]
Location	TSS1500 (cg15099037)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.11E+00	Statistic Test	p-value: 1.35E-02; Z-score: -1.33E+00
Methylation in Case	5.78E-01 (Median)	Methylation in Control	6.44E-01 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC11A1 in lung adenocarcinoma			[ 7 ]
Location	Body (cg03291396)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.44E+00	Statistic Test	p-value: 3.59E-04; Z-score: 2.91E+00
Methylation in Case	2.99E-01 (Median)	Methylation in Control	2.08E-01 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC11A1 in lung adenocarcinoma			[ 7 ]
Location	Body (cg14645545)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.47E+00	Statistic Test	p-value: 4.41E-03; Z-score: 2.78E+00
Methylation in Case	3.52E-01 (Median)	Methylation in Control	2.39E-01 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC11A1 in lung adenocarcinoma			[ 7 ]
Location	Body (cg04337188)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.04E+00	Statistic Test	p-value: 7.99E-03; Z-score: -1.72E+00
Methylation in Case	7.85E-01 (Median)	Methylation in Control	8.18E-01 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC11A1 in lung adenocarcinoma			[ 7 ]
Location	Body (cg07015784)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.03E+00	Statistic Test	p-value: 2.05E-02; Z-score: -3.06E+00
Methylation in Case	9.10E-01 (Median)	Methylation in Control	9.37E-01 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC11A1 in lung adenocarcinoma			[ 7 ]
Location	Body (cg03710889)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.16E+00	Statistic Test	p-value: 3.76E-02; Z-score: 1.41E+00
Methylation in Case	6.52E-01 (Median)	Methylation in Control	5.63E-01 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC11A1 in lung adenocarcinoma			[ 7 ]
Location	Body (cg17010118)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.01E+00	Statistic Test	p-value: 4.20E-02; Z-score: -6.00E-01
Methylation in Case	8.93E-01 (Median)	Methylation in Control	9.00E-01 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Panic disorder	4 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC11A1 in panic disorder			[ 8 ]
Location	TSS1500 (cg13802355)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 9.49E-01	Statistic Test	p-value: 2.30E-02; Z-score: 3.36E-01
Methylation in Case	-1.09E+00 (Median)	Methylation in Control	-1.14E+00 (Median)
Studied Phenotype	Panic disorder [ ICD-11: 6B01]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC11A1 in panic disorder			[ 8 ]
Location	Body (cg00634542)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.38E+00	Statistic Test	p-value: 7.71E-03; Z-score: -4.00E-01
Methylation in Case	5.34E-01 (Median)	Methylation in Control	7.39E-01 (Median)
Studied Phenotype	Panic disorder [ ICD-11: 6B01]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC11A1 in panic disorder			[ 8 ]
Location	Body (cg04656051)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -8.98E-01	Statistic Test	p-value: 1.19E-02; Z-score: -4.29E-01
Methylation in Case	-2.20E+00 (Median)	Methylation in Control	-1.98E+00 (Median)
Studied Phenotype	Panic disorder [ ICD-11: 6B01]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC11A1 in panic disorder			[ 8 ]
Location	3'UTR (cg24007161)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 9.82E-01	Statistic Test	p-value: 4.83E-02; Z-score: 3.39E-01
Methylation in Case	-4.97E+00 (Median)	Methylation in Control	-5.07E+00 (Median)
Studied Phenotype	Panic disorder [ ICD-11: 6B01]
Experimental Material	Patient tissue samples
Papillary thyroid cancer	13 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC11A1 in papillary thyroid cancer			[ 9 ]
Location	TSS1500 (cg15099037)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.43E+00	Statistic Test	p-value: 3.34E-16; Z-score: -3.70E+00
Methylation in Case	4.61E-01 (Median)	Methylation in Control	6.59E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC11A1 in papillary thyroid cancer			[ 9 ]
Location	TSS200 (cg07719512)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.04E+00	Statistic Test	p-value: 1.79E-02; Z-score: -5.16E-01
Methylation in Case	6.38E-01 (Median)	Methylation in Control	6.61E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC11A1 in papillary thyroid cancer			[ 9 ]
Location	Body (cg01520853)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.01E+00	Statistic Test	p-value: 6.93E-05; Z-score: -7.92E-01
Methylation in Case	9.20E-01 (Median)	Methylation in Control	9.31E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC11A1 in papillary thyroid cancer			[ 9 ]
Location	Body (cg04656051)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.16E+00	Statistic Test	p-value: 7.63E-05; Z-score: 9.77E-01
Methylation in Case	3.62E-01 (Median)	Methylation in Control	3.13E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC11A1 in papillary thyroid cancer			[ 9 ]
Location	Body (cg17130789)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.02E+00	Statistic Test	p-value: 2.01E-04; Z-score: -7.86E-01
Methylation in Case	8.46E-01 (Median)	Methylation in Control	8.67E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC11A1 in papillary thyroid cancer			[ 9 ]
Location	Body (cg11378979)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.01E+00	Statistic Test	p-value: 3.45E-04; Z-score: -6.58E-01
Methylation in Case	9.02E-01 (Median)	Methylation in Control	9.13E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC11A1 in papillary thyroid cancer			[ 9 ]
Location	Body (cg14645545)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.14E+00	Statistic Test	p-value: 3.93E-04; Z-score: 7.05E-01
Methylation in Case	3.27E-01 (Median)	Methylation in Control	2.87E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of SLC11A1 in papillary thyroid cancer			[ 9 ]
Location	Body (cg03291396)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.16E+00	Statistic Test	p-value: 6.28E-04; Z-score: 6.60E-01
Methylation in Case	2.16E-01 (Median)	Methylation in Control	1.86E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 9	Methylation of SLC11A1 in papillary thyroid cancer			[ 9 ]
Location	Body (cg00634542)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.02E+00	Statistic Test	p-value: 9.11E-04; Z-score: -8.01E-01
Methylation in Case	9.27E-01 (Median)	Methylation in Control	9.41E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 10	Methylation of SLC11A1 in papillary thyroid cancer			[ 9 ]
Location	Body (cg03710889)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.11E+00	Statistic Test	p-value: 2.45E-03; Z-score: 9.53E-01
Methylation in Case	6.77E-01 (Median)	Methylation in Control	6.11E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 11	Methylation of SLC11A1 in papillary thyroid cancer			[ 9 ]
Location	Body (cg23212579)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.00E+00	Statistic Test	p-value: 3.24E-03; Z-score: -2.29E-01
Methylation in Case	9.65E-01 (Median)	Methylation in Control	9.66E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 12	Methylation of SLC11A1 in papillary thyroid cancer			[ 9 ]
Location	Body (cg16926316)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.01E+00	Statistic Test	p-value: 4.16E-02; Z-score: -3.08E-01
Methylation in Case	8.48E-01 (Median)	Methylation in Control	8.53E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 13	Methylation of SLC11A1 in papillary thyroid cancer			[ 9 ]
Location	3'UTR (cg24007161)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.17E+00	Statistic Test	p-value: 8.88E-05; Z-score: -7.98E-01
Methylation in Case	4.14E-02 (Median)	Methylation in Control	4.82E-02 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Prostate cancer	3 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC11A1 in prostate cancer			[ 10 ]
Location	TSS200 (cg02595219)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 2.43E+00	Statistic Test	p-value: 1.01E-03; Z-score: 1.22E+01
Methylation in Case	7.45E-01 (Median)	Methylation in Control	3.06E-01 (Median)
Studied Phenotype	Prostate cancer [ ICD-11: 2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC11A1 in prostate cancer			[ 10 ]
Location	TSS200 (cg09408768)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 2.22E+00	Statistic Test	p-value: 1.48E-02; Z-score: 8.03E+00
Methylation in Case	3.07E-01 (Median)	Methylation in Control	1.38E-01 (Median)
Studied Phenotype	Prostate cancer [ ICD-11: 2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC11A1 in prostate cancer			[ 10 ]
Location	Body (cg19854293)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.27E+00	Statistic Test	p-value: 8.84E-03; Z-score: 3.63E+00
Methylation in Case	8.33E-01 (Median)	Methylation in Control	6.53E-01 (Median)
Studied Phenotype	Prostate cancer [ ICD-11: 2C82]
Experimental Material	Patient tissue samples
Renal cell carcinoma	9 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC11A1 in clear cell renal cell carcinoma			[ 11 ]
Location	Body (cg00634542)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.05E+00	Statistic Test	p-value: 6.62E-07; Z-score: -3.05E+00
Methylation in Case	9.13E-01 (Median)	Methylation in Control	9.56E-01 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC11A1 in clear cell renal cell carcinoma			[ 11 ]
Location	Body (cg14645545)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 2.41E+00	Statistic Test	p-value: 6.98E-06; Z-score: 1.93E+00
Methylation in Case	2.10E-01 (Median)	Methylation in Control	8.72E-02 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC11A1 in clear cell renal cell carcinoma			[ 11 ]
Location	Body (cg04337188)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.03E+00	Statistic Test	p-value: 1.55E-05; Z-score: -1.58E+00
Methylation in Case	9.00E-01 (Median)	Methylation in Control	9.29E-01 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC11A1 in clear cell renal cell carcinoma			[ 11 ]
Location	Body (cg03291396)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.91E+00	Statistic Test	p-value: 1.82E-05; Z-score: 1.01E+00
Methylation in Case	1.26E-01 (Median)	Methylation in Control	6.57E-02 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC11A1 in clear cell renal cell carcinoma			[ 11 ]
Location	Body (cg17010118)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.01E+00	Statistic Test	p-value: 1.78E-04; Z-score: -1.52E+00
Methylation in Case	9.74E-01 (Median)	Methylation in Control	9.80E-01 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC11A1 in clear cell renal cell carcinoma			[ 11 ]
Location	Body (cg17130789)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.02E+00	Statistic Test	p-value: 3.72E-04; Z-score: -1.41E+00
Methylation in Case	8.78E-01 (Median)	Methylation in Control	8.99E-01 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC11A1 in clear cell renal cell carcinoma			[ 11 ]
Location	Body (cg07015784)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.00E+00	Statistic Test	p-value: 2.28E-02; Z-score: 1.70E-02
Methylation in Case	9.64E-01 (Median)	Methylation in Control	9.64E-01 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of SLC11A1 in clear cell renal cell carcinoma			[ 11 ]
Location	Body (cg16926316)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.01E+00	Statistic Test	p-value: 4.33E-02; Z-score: -5.92E-01
Methylation in Case	9.10E-01 (Median)	Methylation in Control	9.19E-01 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 9	Methylation of SLC11A1 in clear cell renal cell carcinoma			[ 11 ]
Location	3'UTR (cg01379701)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.04E+00	Statistic Test	p-value: 6.11E-03; Z-score: 2.44E-01
Methylation in Case	1.87E-02 (Median)	Methylation in Control	1.80E-02 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Obesity	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Moderate hypermethylation of SLC11A1 in obesity than that in healthy individual
Studied Phenotype	Obesity [ICD-11:5B81]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 7.27E-20; Fold-change: 0.277008523; Z-score: 2.907798559
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Anaplastic pilocytic astrocytoma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Moderate hypomethylation of SLC11A1 in anaplastic pilocytic astrocytoma than that in healthy individual
Studied Phenotype	Anaplastic pilocytic astrocytoma [ICD-11:2A00.0Y]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 8.14E-08; Fold-change: -0.218390547; Z-score: -1.416137848
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Anaplastic pleomorphic xanthoastrocytoma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Moderate hypomethylation of SLC11A1 in anaplastic pleomorphic xanthoastrocytoma than that in healthy individual
Studied Phenotype	Anaplastic pleomorphic xanthoastrocytoma [ICD-11:2A00.0Y]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 0.001164993; Fold-change: -0.23154836; Z-score: -1.299217618
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Cerebral hemispheric glioma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Moderate hypomethylation of SLC11A1 in cerebral hemispheric glioma than that in healthy individual
Studied Phenotype	Cerebral hemispheric glioma [ICD-11:2A00.5]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 0.00128614; Fold-change: -0.28786962; Z-score: -1.711180215
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Chordoma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Moderate hypomethylation of SLC11A1 in chordoma than that in healthy individual
Studied Phenotype	Chordoma [ICD-11:5A61.0]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 0.000724679; Fold-change: -0.279618904; Z-score: -2.474746527
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Craniopharyngioma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Moderate hypomethylation of SLC11A1 in craniopharyngioma than that in healthy individual
Studied Phenotype	Craniopharyngioma [ICD-11:2F9A]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 2.12E-05; Fold-change: -0.22221579; Z-score: -1.325712884
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Diffuse midline glioma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Moderate hypomethylation of SLC11A1 in diffuse midline glioma than that in healthy individual
Studied Phenotype	Diffuse midline glioma [ICD-11:2A00.0Z]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 7.27E-19; Fold-change: -0.252639361; Z-score: -1.397814588
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
RELA YAP fusion ependymoma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Moderate hypomethylation of SLC11A1 in rela yap fusion ependymoma than that in healthy individual
Studied Phenotype	RELA YAP fusion ependymoma [ICD-11:2A00.0Y]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 9.69E-11; Fold-change: -0.21659148; Z-score: -1.361411235
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Brain neuroblastoma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Significant hypomethylation of SLC11A1 in brain neuroblastoma than that in healthy individual
Studied Phenotype	Brain neuroblastoma [ICD-11:2A00.11]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 1.33E-13; Fold-change: -0.374098079; Z-score: -2.355102323
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Brain neuroepithelial tumour	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Significant hypomethylation of SLC11A1 in brain neuroepithelial tumour than that in healthy individual
Studied Phenotype	Brain neuroepithelial tumour [ICD-11:2A00.2Y]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 1.66E-13; Fold-change: -0.442569994; Z-score: -2.875966396
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Cerebellar liponeurocytoma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Significant hypomethylation of SLC11A1 in cerebellar liponeurocytoma than that in healthy individual
Studied Phenotype	Cerebellar liponeurocytoma [ICD-11:2A00.0Y]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 3.33E-10; Fold-change: -0.59127381; Z-score: -3.485579053
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Glioblastoma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Significant hypomethylation of SLC11A1 in glioblastoma than that in healthy individual
Studied Phenotype	Glioblastoma [ICD-11:2A00.00]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 6.50E-13; Fold-change: -0.3668635; Z-score: -2.131240355
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Lymphoma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Significant hypomethylation of SLC11A1 in lymphoma than that in healthy individual
Studied Phenotype	Lymphoma [ICD-11:2B30]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 7.26E-33; Fold-change: -0.597484731; Z-score: -3.960907715
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Multilayered rosettes embryonal tumour	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Significant hypomethylation of SLC11A1 in multilayered rosettes embryonal tumour than that in healthy individual
Studied Phenotype	Multilayered rosettes embryonal tumour [ICD-11:2A00.1]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 1.32E-22; Fold-change: -0.512063328; Z-score: -3.287101202
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Posterior fossa ependymoma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Significant hypomethylation of SLC11A1 in posterior fossa ependymoma than that in healthy individual
Studied Phenotype	Posterior fossa ependymoma [ICD-11:2D50.2]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 1.00E-86; Fold-change: -0.57869342; Z-score: -3.242845843
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
microRNA
Unclear Phenotype	18 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	miR-1199 directly targets SLC11A1			[ 12 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-1199	miRNA Mature ID	miR-1199-3p
miRNA Sequence	UGCGGCCGGUGCUCAACCUGC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 2	miR-1233 directly targets SLC11A1			[ 12 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-1233	miRNA Mature ID	miR-1233-5p
miRNA Sequence	AGUGGGAGGCCAGGGCACGGCA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 3	miR-182 directly targets SLC11A1			[ 13 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-182	miRNA Mature ID	miR-182-5p
miRNA Sequence	UUUGGCAAUGGUAGAACUCACACU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 4	miR-1908 directly targets SLC11A1			[ 12 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-1908	miRNA Mature ID	miR-1908-3p
miRNA Sequence	CCGGCCGCCGGCUCCGCCCCG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 5	miR-196a directly targets SLC11A1			[ 13 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-196a	miRNA Mature ID	miR-196a-3p
miRNA Sequence	CGGCAACAAGAAACUGCCUGAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 6	miR-339 directly targets SLC11A1			[ 13 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-339	miRNA Mature ID	miR-339-5p
miRNA Sequence	UCCCUGUCCUCCAGGAGCUCACG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 7	miR-4446 directly targets SLC11A1			[ 13 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4446	miRNA Mature ID	miR-4446-5p
miRNA Sequence	AUUUCCCUGCCAUUCCCUUGGC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 8	miR-4510 directly targets SLC11A1			[ 13 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4510	miRNA Mature ID	miR-4510
miRNA Sequence	UGAGGGAGUAGGAUGUAUGGUU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 9	miR-4755 directly targets SLC11A1			[ 13 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4755	miRNA Mature ID	miR-4755-5p
miRNA Sequence	UUUCCCUUCAGAGCCUGGCUUU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 10	miR-5006 directly targets SLC11A1			[ 13 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-5006	miRNA Mature ID	miR-5006-3p
miRNA Sequence	UUUCCCUUUCCAUCCUGGCAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 11	miR-6127 directly targets SLC11A1			[ 13 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6127	miRNA Mature ID	miR-6127
miRNA Sequence	UGAGGGAGUGGGUGGGAGG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 12	miR-6129 directly targets SLC11A1			[ 13 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6129	miRNA Mature ID	miR-6129
miRNA Sequence	UGAGGGAGUUGGGUGUAUA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 13	miR-6130 directly targets SLC11A1			[ 13 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6130	miRNA Mature ID	miR-6130
miRNA Sequence	UGAGGGAGUGGAUUGUAUG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 14	miR-6133 directly targets SLC11A1			[ 13 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6133	miRNA Mature ID	miR-6133
miRNA Sequence	UGAGGGAGGAGGUUGGGUA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 15	miR-6760 directly targets SLC11A1			[ 13 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6760	miRNA Mature ID	miR-6760-5p
miRNA Sequence	CAGGGAGAAGGUGGAAGUGCAGA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 16	miR-6778 directly targets SLC11A1			[ 12 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-6778	miRNA Mature ID	miR-6778-5p
miRNA Sequence	AGUGGGAGGACAGGAGGCAGGU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 17	miR-6853 directly targets SLC11A1			[ 12 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-6853	miRNA Mature ID	miR-6853-5p
miRNA Sequence	AGCGUGGGAUGUCCAUGAAGUCAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 18	miR-6873 directly targets SLC11A1			[ 13 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6873	miRNA Mature ID	miR-6873-5p
miRNA Sequence	CAGAGGGAAUACAGAGGGCAAU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human

References
1	Genome-scale analysis of DNA methylation in colorectal cancer using Infinium HumanMethylation450 BeadChips. Epigenetics. 2013 Sep;8(9):921-34.
2	Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
3	DNA Methylation Dynamics in Urological Tumors.
4	Genome-wide Scan for Methylation Profiles in Breast Cancer
5	Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
6	Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
7	DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
8	DNA Methylation signatures in panic disorder. Transl Psychiatry. 2017 Dec 18;7(12):1287.
9	Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
10	Reducing the risk of false discovery enabling identification of biologically significant genome-wide methylation status using the HumanMethylation450 array. BMC Genomics. 2014 Jan 22;15:51.
11	A CpG-methylation-based assay to predict survival in clear cell renal cell carcinoma. Nat Commun. 2015 Oct 30;6:8699.
12	In-depth analysis of the interaction of HIV-1 with cellular microRNA biogenesis and effector mechanisms. MBio. 2013 Apr 16;4(2):e000193.
13	Remodeling of Ago2-mRNA interactions upon cellular stress reflects miRNA complementarity and correlates with altered translation rates. Genes Dev. 2013 Jul 15;27(14):1624-32.

If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.

Detail Information of Epigenetic Regulations

Visitor Map

Correspondence