Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID	DTD0081 Transporter Info
Gene Name	SLC11A2
Transporter Name	Natural resistance-associated macrophage protein 2
Gene ID	4891
UniProt ID	P49281

Epigenetic Regulations of This DT (EGR)
Methylation
Atypical teratoid rhabdoid tumor	5 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC11A2 in atypical teratoid rhabdoid tumor			[ 1 ]
Location	5'UTR (cg01043320)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.12E+00	Statistic Test	p-value: 8.22E-09; Z-score: -1.62E+00
Methylation in Case	7.92E-01 (Median)	Methylation in Control	8.84E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC11A2 in atypical teratoid rhabdoid tumor			[ 1 ]
Location	5'UTR (cg20632143)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.39E+00	Statistic Test	p-value: 4.79E-06; Z-score: 1.77E+00
Methylation in Case	8.62E-01 (Median)	Methylation in Control	6.22E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC11A2 in atypical teratoid rhabdoid tumor			[ 1 ]
Location	5'UTR (cg21570220)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.22E+00	Statistic Test	p-value: 5.20E-06; Z-score: -1.04E+00
Methylation in Case	5.03E-01 (Median)	Methylation in Control	6.14E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC11A2 in atypical teratoid rhabdoid tumor			[ 1 ]
Location	5'UTR (cg22789605)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.26E+00	Statistic Test	p-value: 6.50E-06; Z-score: 1.29E+00
Methylation in Case	8.12E-01 (Median)	Methylation in Control	6.45E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC11A2 in atypical teratoid rhabdoid tumor			[ 1 ]
Location	3'UTR (cg20872692)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.07E+00	Statistic Test	p-value: 4.67E-10; Z-score: -1.28E+00
Methylation in Case	7.97E-01 (Median)	Methylation in Control	8.52E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Bladder cancer	8 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC11A2 in bladder cancer			[ 2 ]
Location	5'UTR (cg20632143)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.20E+00	Statistic Test	p-value: 1.35E-04; Z-score: 3.32E+00
Methylation in Case	5.83E-01 (Median)	Methylation in Control	4.84E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC11A2 in bladder cancer			[ 2 ]
Location	5'UTR (cg22789605)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.83E+00	Statistic Test	p-value: 1.71E-03; Z-score: -2.64E+00
Methylation in Case	7.12E-02 (Median)	Methylation in Control	1.30E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC11A2 in bladder cancer			[ 2 ]
Location	5'UTR (cg01043320)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.65E+00	Statistic Test	p-value: 4.15E-02; Z-score: -1.47E+00
Methylation in Case	4.60E-02 (Median)	Methylation in Control	7.59E-02 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC11A2 in bladder cancer			[ 2 ]
Location	TSS1500 (cg25493658)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -2.99E+00	Statistic Test	p-value: 2.57E-15; Z-score: -2.38E+01
Methylation in Case	2.71E-01 (Median)	Methylation in Control	8.10E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC11A2 in bladder cancer			[ 2 ]
Location	TSS1500 (cg14830815)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.25E+00	Statistic Test	p-value: 4.68E-07; Z-score: -4.72E+00
Methylation in Case	3.20E-01 (Median)	Methylation in Control	4.01E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC11A2 in bladder cancer			[ 2 ]
Location	TSS1500 (cg22826226)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.20E+00	Statistic Test	p-value: 2.53E-06; Z-score: -1.18E+01
Methylation in Case	7.34E-01 (Median)	Methylation in Control	8.79E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC11A2 in bladder cancer			[ 2 ]
Location	TSS1500 (cg16362133)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.68E+00	Statistic Test	p-value: 7.52E-06; Z-score: -5.37E+00
Methylation in Case	6.51E-02 (Median)	Methylation in Control	1.09E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of SLC11A2 in bladder cancer			[ 2 ]
Location	Body (cg14688905)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.62E+00	Statistic Test	p-value: 7.53E-05; Z-score: 4.73E+00
Methylation in Case	8.10E-01 (Median)	Methylation in Control	5.00E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Breast cancer	10 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC11A2 in breast cancer			[ 3 ]
Location	5'UTR (cg22789605)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.83E+00	Statistic Test	p-value: 1.52E-15; Z-score: -1.99E+00
Methylation in Case	9.47E-02 (Median)	Methylation in Control	1.74E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC11A2 in breast cancer			[ 3 ]
Location	5'UTR (cg20632143)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.11E+00	Statistic Test	p-value: 1.49E-02; Z-score: -6.01E-01
Methylation in Case	5.13E-01 (Median)	Methylation in Control	5.72E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC11A2 in breast cancer			[ 3 ]
Location	TSS1500 (cg25493658)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.35E+00	Statistic Test	p-value: 6.33E-08; Z-score: -1.59E+00
Methylation in Case	5.20E-01 (Median)	Methylation in Control	7.00E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC11A2 in breast cancer			[ 3 ]
Location	TSS1500 (cg22826226)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.14E+00	Statistic Test	p-value: 2.79E-06; Z-score: -1.32E+00
Methylation in Case	6.97E-01 (Median)	Methylation in Control	7.93E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC11A2 in breast cancer			[ 3 ]
Location	TSS1500 (cg14830815)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.06E+00	Statistic Test	p-value: 3.35E-03; Z-score: -6.79E-01
Methylation in Case	3.52E-01 (Median)	Methylation in Control	3.74E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC11A2 in breast cancer			[ 3 ]
Location	TSS1500 (cg16362133)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.08E+00	Statistic Test	p-value: 9.17E-03; Z-score: 2.59E-01
Methylation in Case	6.98E-02 (Median)	Methylation in Control	6.44E-02 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC11A2 in breast cancer			[ 3 ]
Location	TSS200 (cg03403662)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.17E+00	Statistic Test	p-value: 7.96E-03; Z-score: -5.67E-01
Methylation in Case	6.62E-02 (Median)	Methylation in Control	7.75E-02 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of SLC11A2 in breast cancer			[ 3 ]
Location	Body (cg14688905)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.07E+00	Statistic Test	p-value: 4.71E-03; Z-score: -8.12E-01
Methylation in Case	6.86E-01 (Median)	Methylation in Control	7.37E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 9	Methylation of SLC11A2 in breast cancer			[ 3 ]
Location	Body (cg21574681)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.07E+00	Statistic Test	p-value: 7.91E-03; Z-score: -4.15E-01
Methylation in Case	5.68E-01 (Median)	Methylation in Control	6.06E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 10	Methylation of SLC11A2 in breast cancer			[ 3 ]
Location	3'UTR (cg20872692)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.38E+00	Statistic Test	p-value: 1.53E-34; Z-score: 4.43E+00
Methylation in Case	8.02E-01 (Median)	Methylation in Control	5.81E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Renal cell carcinoma	4 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC11A2 in clear cell renal cell carcinoma			[ 4 ]
Location	5'UTR (cg22789605)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.48E+00	Statistic Test	p-value: 6.66E-06; Z-score: -1.43E+00
Methylation in Case	8.64E-02 (Median)	Methylation in Control	1.28E-01 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC11A2 in clear cell renal cell carcinoma			[ 4 ]
Location	TSS1500 (cg16362133)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.15E+00	Statistic Test	p-value: 2.99E-03; Z-score: 2.90E-01
Methylation in Case	7.89E-02 (Median)	Methylation in Control	6.86E-02 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC11A2 in clear cell renal cell carcinoma			[ 4 ]
Location	TSS1500 (cg22826226)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.02E+00	Statistic Test	p-value: 3.84E-02; Z-score: -9.34E-01
Methylation in Case	9.05E-01 (Median)	Methylation in Control	9.22E-01 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC11A2 in clear cell renal cell carcinoma			[ 4 ]
Location	TSS200 (cg03403662)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.18E+00	Statistic Test	p-value: 3.87E-04; Z-score: 9.02E-01
Methylation in Case	3.69E-02 (Median)	Methylation in Control	3.13E-02 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Colon cancer	3 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC11A2 in colon adenocarcinoma			[ 5 ]
Location	5'UTR (cg04063166)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.42E+00	Statistic Test	p-value: 5.39E-06; Z-score: -1.30E+00
Methylation in Case	2.28E-01 (Median)	Methylation in Control	3.24E-01 (Median)
Studied Phenotype	Colon cancer [ ICD-11: 2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC11A2 in colon adenocarcinoma			[ 5 ]
Location	TSS200 (cg11267955)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 3.98E+00	Statistic Test	p-value: 4.87E-04; Z-score: 8.18E+00
Methylation in Case	2.93E-01 (Median)	Methylation in Control	7.37E-02 (Median)
Studied Phenotype	Colon cancer [ ICD-11: 2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC11A2 in colon adenocarcinoma			[ 5 ]
Location	Body (cg00948664)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.19E+00	Statistic Test	p-value: 9.11E-05; Z-score: -8.66E-01
Methylation in Case	3.23E-01 (Median)	Methylation in Control	3.85E-01 (Median)
Studied Phenotype	Colon cancer [ ICD-11: 2B90]
Experimental Material	Patient tissue samples
Colorectal cancer	11 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC11A2 in colorectal cancer			[ 6 ]
Location	5'UTR (cg21570220)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.18E+00	Statistic Test	p-value: 8.04E-03; Z-score: -4.88E-01
Methylation in Case	6.70E-02 (Median)	Methylation in Control	7.90E-02 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC11A2 in colorectal cancer			[ 6 ]
Location	5'UTR (cg20632143)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.21E+00	Statistic Test	p-value: 3.38E-02; Z-score: 9.24E-01
Methylation in Case	5.59E-01 (Median)	Methylation in Control	4.62E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC11A2 in colorectal cancer			[ 6 ]
Location	TSS1500 (cg25493658)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.08E+00	Statistic Test	p-value: 2.51E-06; Z-score: -1.50E+00
Methylation in Case	8.00E-01 (Median)	Methylation in Control	8.60E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC11A2 in colorectal cancer			[ 6 ]
Location	TSS1500 (cg14830815)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.13E+00	Statistic Test	p-value: 2.70E-04; Z-score: -9.55E-01
Methylation in Case	3.37E-01 (Median)	Methylation in Control	3.81E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC11A2 in colorectal cancer			[ 6 ]
Location	TSS1500 (cg16362133)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.08E+00	Statistic Test	p-value: 1.58E-02; Z-score: -1.80E-01
Methylation in Case	1.47E-01 (Median)	Methylation in Control	1.58E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC11A2 in colorectal cancer			[ 6 ]
Location	TSS1500 (cg22826226)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.01E+00	Statistic Test	p-value: 1.79E-02; Z-score: -4.17E-01
Methylation in Case	9.01E-01 (Median)	Methylation in Control	9.14E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC11A2 in colorectal cancer			[ 6 ]
Location	TSS200 (cg26360533)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.07E+00	Statistic Test	p-value: 3.29E-03; Z-score: 9.37E-01
Methylation in Case	1.32E-01 (Median)	Methylation in Control	1.23E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of SLC11A2 in colorectal cancer			[ 6 ]
Location	Body (cg14688905)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.11E+00	Statistic Test	p-value: 2.59E-04; Z-score: -1.02E+00
Methylation in Case	7.56E-01 (Median)	Methylation in Control	8.38E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 9	Methylation of SLC11A2 in colorectal cancer			[ 6 ]
Location	Body (cg21574681)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.02E+00	Statistic Test	p-value: 3.83E-04; Z-score: -1.43E+00
Methylation in Case	9.15E-01 (Median)	Methylation in Control	9.30E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 10	Methylation of SLC11A2 in colorectal cancer			[ 6 ]
Location	3'UTR (cg20872692)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.21E+00	Statistic Test	p-value: 5.62E-03; Z-score: 1.22E+00
Methylation in Case	7.94E-01 (Median)	Methylation in Control	6.58E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Hepatocellular carcinoma	5 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC11A2 in hepatocellular carcinoma			[ 7 ]
Location	5'UTR (cg22789605)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.36E+00	Statistic Test	p-value: 4.98E-07; Z-score: -1.31E+00
Methylation in Case	9.68E-02 (Median)	Methylation in Control	1.32E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC11A2 in hepatocellular carcinoma			[ 7 ]
Location	TSS1500 (cg14830815)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.04E+00	Statistic Test	p-value: 1.35E-02; Z-score: -4.32E-01
Methylation in Case	4.51E-01 (Median)	Methylation in Control	4.68E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC11A2 in hepatocellular carcinoma			[ 7 ]
Location	TSS1500 (cg22826226)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.02E+00	Statistic Test	p-value: 2.95E-02; Z-score: -2.56E-01
Methylation in Case	7.73E-01 (Median)	Methylation in Control	7.85E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC11A2 in hepatocellular carcinoma			[ 7 ]
Location	Body (cg21574681)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.01E+00	Statistic Test	p-value: 6.96E-04; Z-score: -3.94E-01
Methylation in Case	8.43E-01 (Median)	Methylation in Control	8.50E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC11A2 in hepatocellular carcinoma			[ 7 ]
Location	3'UTR (cg20872692)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.14E+00	Statistic Test	p-value: 1.33E-05; Z-score: -1.51E+00
Methylation in Case	6.78E-01 (Median)	Methylation in Control	7.70E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Pancretic ductal adenocarcinoma	8 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC11A2 in pancretic ductal adenocarcinoma			[ 8 ]
Location	5'UTR (cg04242577)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.19E+00	Statistic Test	p-value: 4.60E-04; Z-score: 1.32E+00
Methylation in Case	5.77E-01 (Median)	Methylation in Control	4.84E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC11A2 in pancretic ductal adenocarcinoma			[ 8 ]
Location	TSS200 (cg03603951)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 4.11E+00	Statistic Test	p-value: 1.64E-42; Z-score: 1.86E+01
Methylation in Case	3.52E-01 (Median)	Methylation in Control	8.58E-02 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC11A2 in pancretic ductal adenocarcinoma			[ 8 ]
Location	TSS200 (cg19069553)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.09E+00	Statistic Test	p-value: 1.56E-03; Z-score: -5.66E-01
Methylation in Case	3.12E-01 (Median)	Methylation in Control	3.40E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC11A2 in pancretic ductal adenocarcinoma			[ 8 ]
Location	TSS200 (cg19524810)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.23E+00	Statistic Test	p-value: 1.88E-03; Z-score: -8.19E-01
Methylation in Case	4.39E-02 (Median)	Methylation in Control	5.41E-02 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC11A2 in pancretic ductal adenocarcinoma			[ 8 ]
Location	Body (cg11742667)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.03E+00	Statistic Test	p-value: 1.50E-11; Z-score: -1.38E+00
Methylation in Case	8.22E-01 (Median)	Methylation in Control	8.47E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC11A2 in pancretic ductal adenocarcinoma			[ 8 ]
Location	Body (cg04486885)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.12E+00	Statistic Test	p-value: 8.42E-04; Z-score: 9.20E-01
Methylation in Case	7.47E-01 (Median)	Methylation in Control	6.68E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC11A2 in pancretic ductal adenocarcinoma			[ 8 ]
Location	Body (cg08220872)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.06E+00	Statistic Test	p-value: 1.53E-03; Z-score: -8.13E-01
Methylation in Case	7.77E-01 (Median)	Methylation in Control	8.21E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of SLC11A2 in pancretic ductal adenocarcinoma			[ 8 ]
Location	Body (cg15837383)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.05E+00	Statistic Test	p-value: 3.88E-03; Z-score: 8.19E-01
Methylation in Case	8.46E-01 (Median)	Methylation in Control	8.05E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Papillary thyroid cancer	4 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC11A2 in papillary thyroid cancer			[ 9 ]
Location	5'UTR (cg20632143)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.33E+00	Statistic Test	p-value: 1.70E-11; Z-score: -1.95E+00
Methylation in Case	5.28E-01 (Median)	Methylation in Control	7.02E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC11A2 in papillary thyroid cancer			[ 9 ]
Location	5'UTR (cg22789605)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.27E+00	Statistic Test	p-value: 1.55E-10; Z-score: -1.10E+00
Methylation in Case	1.11E-01 (Median)	Methylation in Control	1.41E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC11A2 in papillary thyroid cancer			[ 9 ]
Location	TSS200 (cg03403662)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.03E+00	Statistic Test	p-value: 4.89E-02; Z-score: 1.99E-01
Methylation in Case	7.90E-02 (Median)	Methylation in Control	7.67E-02 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC11A2 in papillary thyroid cancer			[ 9 ]
Location	Body (cg14688905)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.13E+00	Statistic Test	p-value: 1.50E-03; Z-score: -6.39E-01
Methylation in Case	3.32E-01 (Median)	Methylation in Control	3.74E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Systemic lupus erythematosus	4 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC11A2 in systemic lupus erythematosus			[ 10 ]
Location	5'UTR (cg22789605)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.03E+00	Statistic Test	p-value: 3.21E-02; Z-score: -4.42E-02
Methylation in Case	1.06E-01 (Median)	Methylation in Control	1.10E-01 (Median)
Studied Phenotype	Systemic lupus erythematosus [ ICD-11: 4A40.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC11A2 in systemic lupus erythematosus			[ 10 ]
Location	TSS200 (cg26360533)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.02E+00	Statistic Test	p-value: 3.12E-02; Z-score: -9.46E-02
Methylation in Case	1.09E-01 (Median)	Methylation in Control	1.11E-01 (Median)
Studied Phenotype	Systemic lupus erythematosus [ ICD-11: 4A40.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC11A2 in systemic lupus erythematosus			[ 10 ]
Location	TSS200 (cg03403662)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.03E+00	Statistic Test	p-value: 3.43E-02; Z-score: -1.90E-01
Methylation in Case	9.41E-02 (Median)	Methylation in Control	9.73E-02 (Median)
Studied Phenotype	Systemic lupus erythematosus [ ICD-11: 4A40.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC11A2 in systemic lupus erythematosus			[ 10 ]
Location	Body (cg21574681)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.00E+00	Statistic Test	p-value: 4.98E-02; Z-score: -2.37E-01
Methylation in Case	9.19E-01 (Median)	Methylation in Control	9.23E-01 (Median)
Studied Phenotype	Systemic lupus erythematosus [ ICD-11: 4A40.0]
Experimental Material	Patient tissue samples
HIV infection	2 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC11A2 in HIV infection			[ 11 ]
Location	TSS1500 (cg16362133)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.25E+00	Statistic Test	p-value: 1.30E-03; Z-score: 9.65E-01
Methylation in Case	1.03E-01 (Median)	Methylation in Control	8.21E-02 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC11A2 in HIV infection			[ 11 ]
Location	Body (cg14688905)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.76E+00	Statistic Test	p-value: 1.11E-08; Z-score: 3.36E+00
Methylation in Case	4.20E-01 (Median)	Methylation in Control	2.39E-01 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Panic disorder	3 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC11A2 in panic disorder			[ 12 ]
Location	TSS1500 (cg16362133)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 9.58E-01	Statistic Test	p-value: 1.94E-02; Z-score: 4.18E-01
Methylation in Case	-4.27E+00 (Median)	Methylation in Control	-4.46E+00 (Median)
Studied Phenotype	Panic disorder [ ICD-11: 6B01]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC11A2 in panic disorder			[ 12 ]
Location	TSS1500 (cg22826226)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 3.49E-01	Statistic Test	p-value: 1.95E-02; Z-score: 4.01E-01
Methylation in Case	-6.78E-02 (Median)	Methylation in Control	-1.94E-01 (Median)
Studied Phenotype	Panic disorder [ ICD-11: 6B01]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC11A2 in panic disorder			[ 12 ]
Location	Body (cg14688905)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -9.38E-01	Statistic Test	p-value: 2.13E-03; Z-score: -2.63E-01
Methylation in Case	-2.68E+00 (Median)	Methylation in Control	-2.51E+00 (Median)
Studied Phenotype	Panic disorder [ ICD-11: 6B01]
Experimental Material	Patient tissue samples
Prostate cancer	3 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC11A2 in prostate cancer			[ 13 ]
Location	TSS1500 (cg27315635)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.94E+00	Statistic Test	p-value: 3.31E-04; Z-score: -7.38E+00
Methylation in Case	3.21E-01 (Median)	Methylation in Control	6.22E-01 (Median)
Studied Phenotype	Prostate cancer [ ICD-11: 2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC11A2 in prostate cancer			[ 13 ]
Location	Body (cg17172593)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.38E+00	Statistic Test	p-value: 1.78E-03; Z-score: 9.04E+00
Methylation in Case	7.31E-01 (Median)	Methylation in Control	5.31E-01 (Median)
Studied Phenotype	Prostate cancer [ ICD-11: 2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC11A2 in prostate cancer			[ 13 ]
Location	Body (cg17559156)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.48E+00	Statistic Test	p-value: 8.13E-03; Z-score: -4.72E+00
Methylation in Case	5.35E-01 (Median)	Methylation in Control	7.94E-01 (Median)
Studied Phenotype	Prostate cancer [ ICD-11: 2C82]
Experimental Material	Patient tissue samples
Depression	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC11A2 in depression			[ 14 ]
Location	TSS200 (cg12258176)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.08E+00	Statistic Test	p-value: 3.19E-02; Z-score: -4.34E-01
Methylation in Case	5.20E-02 (Median)	Methylation in Control	5.60E-02 (Median)
Studied Phenotype	Depression [ ICD-11: 6A8Z]
Experimental Material	Patient tissue samples
Aged mice	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Hypermethylation of Slc11a2 in aged mice			[ 15 ]
Location	Exon 2
Epigenetic Type	Methylation	Experiment Method	.
Studied Phenotype	Aged mice
Experimental Material	Model organism in vivo (mouse)
microRNA
Unclear Phenotype	99 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	let-7a directly targets SLC11A2			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	let-7a	miRNA Mature ID	let-7a-5p
miRNA Sequence	UGAGGUAGUAGGUUGUAUAGUU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 2	let-7b directly targets SLC11A2			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	let-7b	miRNA Mature ID	let-7b-5p
miRNA Sequence	UGAGGUAGUAGGUUGUGUGGUU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 3	let-7c directly targets SLC11A2			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	let-7c	miRNA Mature ID	let-7c-5p
miRNA Sequence	UGAGGUAGUAGGUUGUAUGGUU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 4	let-7d directly targets SLC11A2			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	let-7d	miRNA Mature ID	let-7d-5p
miRNA Sequence	AGAGGUAGUAGGUUGCAUAGUU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 5	let-7e directly targets SLC11A2			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	let-7e	miRNA Mature ID	let-7e-5p
miRNA Sequence	UGAGGUAGGAGGUUGUAUAGUU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 6	let-7f directly targets SLC11A2			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	let-7f	miRNA Mature ID	let-7f-5p
miRNA Sequence	UGAGGUAGUAGAUUGUAUAGUU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 7	let-7g directly targets SLC11A2			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	let-7g	miRNA Mature ID	let-7g-5p
miRNA Sequence	UGAGGUAGUAGUUUGUACAGUU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 8	let-7i directly targets SLC11A2			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	let-7i	miRNA Mature ID	let-7i-5p
miRNA Sequence	UGAGGUAGUAGUUUGUGCUGUU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 9	miR-101 directly targets SLC11A2			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-101	miRNA Mature ID	miR-101-3p
miRNA Sequence	UACAGUACUGUGAUAACUGAA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 10	miR-10a directly targets SLC11A2			[ 17 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-10a	miRNA Mature ID	miR-10a-5p
miRNA Sequence	UACCCUGUAGAUCCGAAUUUGUG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 11	miR-10b directly targets SLC11A2			[ 17 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-10b	miRNA Mature ID	miR-10b-5p
miRNA Sequence	UACCCUGUAGAACCGAAUUUGUG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 12	miR-122 directly targets SLC11A2			[ 18 ]
Epigenetic Type	microRNA	Experiment Method	Microarray
miRNA Stemloop ID	miR-122	miRNA Mature ID	miR-122-5p
miRNA Sequence	UGGAGUGUGACAAUGGUGUUUG
miRNA Target Type	Direct
Experimental Material	Human cervical cancer cell line (Hela)
Epigenetic Phenomenon 13	miR-1273h directly targets SLC11A2			[ 19 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-1273h	miRNA Mature ID	miR-1273h-5p
miRNA Sequence	CUGGGAGGUCAAGGCUGCAGU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 14	miR-1285 directly targets SLC11A2			[ 17 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-1285	miRNA Mature ID	miR-1285-3p
miRNA Sequence	UCUGGGCAACAAAGUGAGACCU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 15	miR-149 directly targets SLC11A2			[ 19 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-149	miRNA Mature ID	miR-149-3p
miRNA Sequence	AGGGAGGGACGGGGGCUGUGC
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 16	miR-1537 directly targets SLC11A2			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-1537	miRNA Mature ID	miR-1537-3p
miRNA Sequence	AAAACCGUCUAGUUACAGUUGU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 17	miR-155 directly targets SLC11A2			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-155	miRNA Mature ID	miR-155-5p
miRNA Sequence	UUAAUGCUAAUCGUGAUAGGGGUU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 18	miR-16 directly targets SLC11A2			[ 21 ]
Epigenetic Type	microRNA	Experiment Method	Sequencing
miRNA Stemloop ID	miR-16	miRNA Mature ID	miR-16-5p
miRNA Sequence	UAGCAGCACGUAAAUAUUGGCG
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 19	miR-1827 directly targets SLC11A2			[ 19 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-1827	miRNA Mature ID	miR-1827
miRNA Sequence	UGAGGCAGUAGAUUGAAU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 20	miR-196a directly targets SLC11A2			[ 17 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-196a	miRNA Mature ID	miR-196a-3p
miRNA Sequence	CGGCAACAAGAAACUGCCUGAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 21	miR-200c directly targets SLC11A2			[ 17 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-200c	miRNA Mature ID	miR-200c-5p
miRNA Sequence	CGUCUUACCCAGCAGUGUUUGG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 22	miR-203b directly targets SLC11A2			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-203b	miRNA Mature ID	miR-203b-3p
miRNA Sequence	UUGAACUGUUAAGAACCACUGGA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 23	miR-218 directly targets SLC11A2			[ 21 ]
Epigenetic Type	microRNA	Experiment Method	Sequencing
miRNA Stemloop ID	miR-218	miRNA Mature ID	miR-218-5p
miRNA Sequence	UUGUGCUUGAUCUAACCAUGU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 24	miR-24 directly targets SLC11A2			[ 22 ]
Epigenetic Type	microRNA	Experiment Method	Microarray
miRNA Stemloop ID	miR-24	miRNA Mature ID	miR-24-3p
miRNA Sequence	UGGCUCAGUUCAGCAGGAACAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 25	miR-30b directly targets SLC11A2			[ 19 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-30b	miRNA Mature ID	miR-30b-3p
miRNA Sequence	CUGGGAGGUGGAUGUUUACUUC
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 26	miR-30c-1 directly targets SLC11A2			[ 19 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-30c-1	miRNA Mature ID	miR-30c-1-3p
miRNA Sequence	CUGGGAGAGGGUUGUUUACUCC
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 27	miR-30c-2 directly targets SLC11A2			[ 19 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-30c-2	miRNA Mature ID	miR-30c-2-3p
miRNA Sequence	CUGGGAGAAGGCUGUUUACUCU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 28	miR-3122 directly targets SLC11A2			[ 19 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-3122	miRNA Mature ID	miR-3122
miRNA Sequence	GUUGGGACAAGAGGACGGUCUU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 29	miR-3187 directly targets SLC11A2			[ 17 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-3187	miRNA Mature ID	miR-3187-5p
miRNA Sequence	CCUGGGCAGCGUGUGGCUGAAGG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 30	miR-3190 directly targets SLC11A2			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-3190	miRNA Mature ID	miR-3190-5p
miRNA Sequence	UCUGGCCAGCUACGUCCCCA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 31	miR-339 directly targets SLC11A2			[ 17 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-339	miRNA Mature ID	miR-339-5p
miRNA Sequence	UCCCUGUCCUCCAGGAGCUCACG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 32	miR-3614 directly targets SLC11A2			[ 19 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-3614	miRNA Mature ID	miR-3614-5p
miRNA Sequence	CCACUUGGAUCUGAAGGCUGCCC
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 33	miR-3667 directly targets SLC11A2			[ 17 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-3667	miRNA Mature ID	miR-3667-5p
miRNA Sequence	AAAGACCCAUUGAGGAGAAGGU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 34	miR-3689a directly targets SLC11A2			[ 19 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-3689a	miRNA Mature ID	miR-3689a-3p
miRNA Sequence	CUGGGAGGUGUGAUAUCGUGGU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 35	miR-3689b directly targets SLC11A2			[ 19 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-3689b	miRNA Mature ID	miR-3689b-3p
miRNA Sequence	CUGGGAGGUGUGAUAUUGUGGU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 36	miR-3689c directly targets SLC11A2			[ 19 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-3689c	miRNA Mature ID	miR-3689c
miRNA Sequence	CUGGGAGGUGUGAUAUUGUGGU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 37	miR-374b directly targets SLC11A2			[ 21 ]
Epigenetic Type	microRNA	Experiment Method	Sequencing
miRNA Stemloop ID	miR-374b	miRNA Mature ID	miR-374b-5p
miRNA Sequence	AUAUAAUACAACCUGCUAAGUG
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 38	miR-383 directly targets SLC11A2			[ 19 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-383	miRNA Mature ID	miR-383-5p
miRNA Sequence	AGAUCAGAAGGUGAUUGUGGCU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 39	miR-3913 directly targets SLC11A2			[ 19 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-3913	miRNA Mature ID	miR-3913-5p
miRNA Sequence	UUUGGGACUGAUCUUGAUGUCU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 40	miR-3926 directly targets SLC11A2			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-3926	miRNA Mature ID	miR-3926
miRNA Sequence	UGGCCAAAAAGCAGGCAGAGA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 41	miR-3927 directly targets SLC11A2			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-3927	miRNA Mature ID	miR-3927-3p
miRNA Sequence	CAGGUAGAUAUUUGAUAGGCAU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 42	miR-3929 directly targets SLC11A2			[ 19 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-3929	miRNA Mature ID	miR-3929
miRNA Sequence	GAGGCUGAUGUGAGUAGACCACU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 43	miR-423 directly targets SLC11A2			[ 21 ]
Epigenetic Type	microRNA	Experiment Method	Sequencing
miRNA Stemloop ID	miR-423	miRNA Mature ID	miR-423-3p
miRNA Sequence	AGCUCGGUCUGAGGCCCCUCAGU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 44	miR-4421 directly targets SLC11A2			[ 17 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4421	miRNA Mature ID	miR-4421
miRNA Sequence	ACCUGUCUGUGGAAAGGAGCUA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 45	miR-4451 directly targets SLC11A2			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4451	miRNA Mature ID	miR-4451
miRNA Sequence	UGGUAGAGCUGAGGACA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 46	miR-4458 directly targets SLC11A2			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4458	miRNA Mature ID	miR-4458
miRNA Sequence	AGAGGUAGGUGUGGAAGAA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 47	miR-4478 directly targets SLC11A2			[ 19 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4478	miRNA Mature ID	miR-4478
miRNA Sequence	GAGGCUGAGCUGAGGAG
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 48	miR-4500 directly targets SLC11A2			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4500	miRNA Mature ID	miR-4500
miRNA Sequence	UGAGGUAGUAGUUUCUU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 49	miR-451b directly targets SLC11A2			[ 17 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-451b	miRNA Mature ID	miR-451b
miRNA Sequence	UAGCAAGAGAACCAUUACCAUU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 50	miR-4649 directly targets SLC11A2			[ 19 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4649	miRNA Mature ID	miR-4649-3p
miRNA Sequence	UCUGAGGCCUGCCUCUCCCCA
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 51	miR-4655 directly targets SLC11A2			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4655	miRNA Mature ID	miR-4655-5p
miRNA Sequence	CACCGGGGAUGGCAGAGGGUCG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 52	miR-4696 directly targets SLC11A2			[ 17 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4696	miRNA Mature ID	miR-4696
miRNA Sequence	UGCAAGACGGAUACUGUCAUCU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 53	miR-4725 directly targets SLC11A2			[ 17 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4725	miRNA Mature ID	miR-4725-5p
miRNA Sequence	AGACCCUGCAGCCUUCCCACC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 54	miR-4728 directly targets SLC11A2			[ 19 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4728	miRNA Mature ID	miR-4728-5p
miRNA Sequence	UGGGAGGGGAGAGGCAGCAAGCA
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 55	miR-4736 directly targets SLC11A2			[ 19 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4736	miRNA Mature ID	miR-4736
miRNA Sequence	AGGCAGGUUAUCUGGGCUG
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 56	miR-4793 directly targets SLC11A2			[ 17 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4793	miRNA Mature ID	miR-4793-3p
miRNA Sequence	UCUGCACUGUGAGUUGGCUGGCU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 57	miR-484 directly targets SLC11A2			[ 23 ]
Epigenetic Type	microRNA	Experiment Method	CLASH
miRNA Stemloop ID	miR-484	miRNA Mature ID	miR-484
miRNA Sequence	UCAGGCUCAGUCCCCUCCCGAU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 58	miR-485 directly targets SLC11A2			[ 19 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-485	miRNA Mature ID	miR-485-5p
miRNA Sequence	AGAGGCUGGCCGUGAUGAAUUC
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 59	miR-508 directly targets SLC11A2			[ 17 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-508	miRNA Mature ID	miR-508-5p
miRNA Sequence	UACUCCAGAGGGCGUCACUCAUG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 60	miR-5189 directly targets SLC11A2			[ 17 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-5189	miRNA Mature ID	miR-5189-5p
miRNA Sequence	UCUGGGCACAGGCGGAUGGACAGG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 61	miR-548c directly targets SLC11A2			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-548c	miRNA Mature ID	miR-548c-3p
miRNA Sequence	CAAAAAUCUCAAUUACUUUUGC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 62	miR-548s directly targets SLC11A2			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-548s	miRNA Mature ID	miR-548s
miRNA Sequence	AUGGCCAAAACUGCAGUUAUUUU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 63	miR-550a directly targets SLC11A2			[ 17 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-550a	miRNA Mature ID	miR-550a-3p
miRNA Sequence	UGUCUUACUCCCUCAGGCACAU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 64	miR-5694 directly targets SLC11A2			[ 19 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-5694	miRNA Mature ID	miR-5694
miRNA Sequence	CAGAUCAUGGGACUGUCUCAG
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 65	miR-5699 directly targets SLC11A2			[ 17 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-5699	miRNA Mature ID	miR-5699-3p
miRNA Sequence	UCCUGUCUUUCCUUGUUGGAGC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 66	miR-582 directly targets SLC11A2			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-582	miRNA Mature ID	miR-582-5p
miRNA Sequence	UUACAGUUGUUCAACCAGUUACU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 67	miR-612 directly targets SLC11A2			[ 17 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-612	miRNA Mature ID	miR-612
miRNA Sequence	GCUGGGCAGGGCUUCUGAGCUCCUU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 68	miR-6500 directly targets SLC11A2			[ 19 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6500	miRNA Mature ID	miR-6500-3p
miRNA Sequence	ACACUUGUUGGGAUGACCUGC
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 69	miR-6501 directly targets SLC11A2			[ 17 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6501	miRNA Mature ID	miR-6501-3p
miRNA Sequence	CCAGAGCAGCCUGCGGUAACAGU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 70	miR-6512 directly targets SLC11A2			[ 17 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6512	miRNA Mature ID	miR-6512-3p
miRNA Sequence	UUCCAGCCCUUCUAAUGGUAGG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 71	miR-6513 directly targets SLC11A2			[ 19 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6513	miRNA Mature ID	miR-6513-5p
miRNA Sequence	UUUGGGAUUGACGCCACAUGUCU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 72	miR-655 directly targets SLC11A2			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-655	miRNA Mature ID	miR-655-5p
miRNA Sequence	AGAGGUUAUCCGUGUUAUGUUC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 73	miR-661 directly targets SLC11A2			[ 17 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-661	miRNA Mature ID	miR-661
miRNA Sequence	UGCCUGGGUCUCUGGCCUGCGCGU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 74	miR-665 directly targets SLC11A2			[ 19 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-665	miRNA Mature ID	miR-665
miRNA Sequence	ACCAGGAGGCUGAGGCCCCU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 75	miR-6720 directly targets SLC11A2			[ 17 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6720	miRNA Mature ID	miR-6720-5p
miRNA Sequence	UUCCAGCCCUGGUAGGCGCCGCG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 76	miR-6771 directly targets SLC11A2			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6771	miRNA Mature ID	miR-6771-3p
miRNA Sequence	CAAACCCCUGUCUACCCGCAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 77	miR-6777 directly targets SLC11A2			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6777	miRNA Mature ID	miR-6777-5p
miRNA Sequence	ACGGGGAGUCAGGCAGUGGUGGA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 78	miR-6779 directly targets SLC11A2			[ 19 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6779	miRNA Mature ID	miR-6779-5p
miRNA Sequence	CUGGGAGGGGCUGGGUUUGGC
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 79	miR-6780a directly targets SLC11A2			[ 19 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6780a	miRNA Mature ID	miR-6780a-5p
miRNA Sequence	UUGGGAGGGAAGACAGCUGGAGA
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 80	miR-6785 directly targets SLC11A2			[ 19 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6785	miRNA Mature ID	miR-6785-5p
miRNA Sequence	UGGGAGGGCGUGGAUGAUGGUG
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 81	miR-6788 directly targets SLC11A2			[ 19 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6788	miRNA Mature ID	miR-6788-5p
miRNA Sequence	CUGGGAGAAGAGUGGUGAAGA
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 82	miR-6799 directly targets SLC11A2			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6799	miRNA Mature ID	miR-6799-5p
miRNA Sequence	GGGGAGGUGUGCAGGGCUGG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 83	miR-6808 directly targets SLC11A2			[ 19 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6808	miRNA Mature ID	miR-6808-5p
miRNA Sequence	CAGGCAGGGAGGUGGGACCAUG
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 84	miR-6825 directly targets SLC11A2			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6825	miRNA Mature ID	miR-6825-5p
miRNA Sequence	UGGGGAGGUGUGGAGUCAGCAU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 85	miR-6831 directly targets SLC11A2			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6831	miRNA Mature ID	miR-6831-5p
miRNA Sequence	UAGGUAGAGUGUGAGGAGGAGGUC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 86	miR-6849 directly targets SLC11A2			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6849	miRNA Mature ID	miR-6849-3p
miRNA Sequence	ACCAGCCUGUGUCCACCUCCAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 87	miR-6860 directly targets SLC11A2			[ 17 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6860	miRNA Mature ID	miR-6860
miRNA Sequence	ACUGGGCAGGGCUGUGGUGAGU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 88	miR-6883 directly targets SLC11A2			[ 19 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6883	miRNA Mature ID	miR-6883-5p
miRNA Sequence	AGGGAGGGUGUGGUAUGGAUGU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 89	miR-6884 directly targets SLC11A2			[ 19 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6884	miRNA Mature ID	miR-6884-5p
miRNA Sequence	AGAGGCUGAGAAGGUGAUGUUG
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 90	miR-6889 directly targets SLC11A2			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6889	miRNA Mature ID	miR-6889-5p
miRNA Sequence	UCGGGGAGUCUGGGGUCCGGAAU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 91	miR-6893 directly targets SLC11A2			[ 19 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6893	miRNA Mature ID	miR-6893-5p
miRNA Sequence	CAGGCAGGUGUAGGGUGGAGC
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 92	miR-7106 directly targets SLC11A2			[ 19 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-7106	miRNA Mature ID	miR-7106-5p
miRNA Sequence	UGGGAGGAGGGGAUCUUGGG
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 93	miR-7160 directly targets SLC11A2			[ 19 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-7160	miRNA Mature ID	miR-7160-5p
miRNA Sequence	UGCUGAGGUCCGGGCUGUGCC
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 94	miR-766 directly targets SLC11A2			[ 17 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-766	miRNA Mature ID	miR-766-3p
miRNA Sequence	ACUCCAGCCCCACAGCCUCAGC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 95	miR-7703 directly targets SLC11A2			[ 17 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-7703	miRNA Mature ID	miR-7703
miRNA Sequence	UUGCACUCUGGCCUUCUCCCAGG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 96	miR-887 directly targets SLC11A2			[ 19 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-887	miRNA Mature ID	miR-887-5p
miRNA Sequence	CUUGGGAGCCCUGUUAGACUC
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 97	miR-939 directly targets SLC11A2			[ 17 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-939	miRNA Mature ID	miR-939-3p
miRNA Sequence	CCCUGGGCCUCUGCUCCCCAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 98	miR-940 directly targets SLC11A2			[ 19 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-940	miRNA Mature ID	miR-940
miRNA Sequence	AAGGCAGGGCCCCCGCUCCCC
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 99	miR-98 directly targets SLC11A2			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-98	miRNA Mature ID	miR-98-5p
miRNA Sequence	UGAGGUAGUAAGUUGUAUUGUU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human

References
1	Atypical Teratoid/Rhabdoid Tumors Are Comprised of Three Epigenetic Subgroups with Distinct Enhancer Landscapes. Cancer Cell. 2016 Mar 14;29(3):379-393.
2	DNA Methylation Dynamics in Urological Tumors.
3	Genome-wide Scan for Methylation Profiles in Breast Cancer
4	A CpG-methylation-based assay to predict survival in clear cell renal cell carcinoma. Nat Commun. 2015 Oct 30;6:8699.
5	Genome-scale analysis of DNA methylation in colorectal cancer using Infinium HumanMethylation450 BeadChips. Epigenetics. 2013 Sep;8(9):921-34.
6	Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
7	Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
8	Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
9	Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
10	Genome-wide DNA methylation analysis of systemic lupus erythematosus reveals persistent hypomethylation of interferon genes and compositional changes to CD4+ T-cell populations. PLoS Genet. 2013;9(8):e1003678.
11	HIV-1 Infection Accelerates Age According to the Epigenetic Clock. J Infect Dis. 2015 Nov 15;212(10):1563-73.
12	DNA Methylation signatures in panic disorder. Transl Psychiatry. 2017 Dec 18;7(12):1287.
13	Reducing the risk of false discovery enabling identification of biologically significant genome-wide methylation status using the HumanMethylation450 array. BMC Genomics. 2014 Jan 22;15:51.
14	DNA methylation and inflammation marker profiles associated with a history of depression. Hum Mol Genet. 2018 Aug 15;27(16):2840-2850.
15	Age-specific changes in genome-wide methylation enrich for Foxa2 and estrogen receptor alpha binding sites. PLoS One. 2018 Sep 26;13(9):e0203147.
16	Direct conversion of fibroblasts to neurons by reprogramming PTB-regulated microRNA circuits. Cell. 2013 Jan 17;152(1-2):82-96.
17	Remodeling of Ago2-mRNA interactions upon cellular stress reflects miRNA complementarity and correlates with altered translation rates. Genes Dev. 2013 Jul 15;27(14):1624-32.
18	MicroRNA targeting specificity in mammals: determinants beyond seed pairing. Mol Cell. 2007 Jul 6;27(1):91-105.
19	Insights into snoRNA biogenesis and processing from PAR-CLIP of snoRNA core proteins and small RNA sequencing. Genome Biol. 2013 May 26;14(5):R45.
20	EBV and human microRNAs co-target oncogenic and apoptotic viral and human genes during latency. EMBO J. 2012 May 2;31(9):2207-21.
21	Transcriptome-wide identification of RNA-binding protein and microRNA target sites by PAR-CLIP. Cell. 2010 Apr 2;141(1):129-41.
22	miR-24 Inhibits cell proliferation by targeting E2F2, MYC, and other cell-cycle genes via binding to "seedless" 3'UTR microRNA recognition elements. Mol Cell. 2009 Sep 11;35(5):610-25.
23	Mapping the human miRNA interactome by CLASH reveals frequent noncanonical binding. Cell. 2013 Apr 25;153(3):654-65.

If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.

Detail Information of Epigenetic Regulations

Visitor Map

Correspondence