Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID	DTD0082 Transporter Info
Gene Name	SLC12A1
Transporter Name	Bumetanide-sensitive sodium-(potassium)-chloride cotransporter 2
Gene ID	6557
UniProt ID	Q13621

Epigenetic Regulations of This DT (EGR)
Methylation
Hepatocellular carcinoma	7 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC12A1 in hepatocellular carcinoma			[ 1 ]
Location	5'UTR (cg10829727)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.60E+00	Statistic Test	p-value: 6.02E-17; Z-score: 2.91E+00
Methylation in Case	4.93E-01 (Median)	Methylation in Control	3.07E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC12A1 in hepatocellular carcinoma			[ 1 ]
Location	Body (cg14583675)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.28E+00	Statistic Test	p-value: 9.67E-14; Z-score: 2.18E+00
Methylation in Case	6.71E-01 (Median)	Methylation in Control	5.23E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC12A1 in hepatocellular carcinoma			[ 1 ]
Location	Body (cg20388916)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.42E+00	Statistic Test	p-value: 6.55E-11; Z-score: -3.28E+00
Methylation in Case	4.47E-01 (Median)	Methylation in Control	6.37E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC12A1 in hepatocellular carcinoma			[ 1 ]
Location	Body (cg14229516)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.29E+00	Statistic Test	p-value: 1.04E-08; Z-score: -2.79E+00
Methylation in Case	5.77E-01 (Median)	Methylation in Control	7.45E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC12A1 in hepatocellular carcinoma			[ 1 ]
Location	Body (cg14857792)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.36E+00	Statistic Test	p-value: 1.99E-08; Z-score: -3.11E+00
Methylation in Case	4.28E-01 (Median)	Methylation in Control	5.82E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC12A1 in hepatocellular carcinoma			[ 1 ]
Location	Body (cg10616694)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.09E+00	Statistic Test	p-value: 5.97E-05; Z-score: -1.22E+00
Methylation in Case	6.82E-01 (Median)	Methylation in Control	7.46E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC12A1 in hepatocellular carcinoma			[ 1 ]
Location	Body (cg23530596)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.34E+00	Statistic Test	p-value: 4.13E-04; Z-score: -2.21E+00
Methylation in Case	3.08E-01 (Median)	Methylation in Control	4.13E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Bladder cancer	10 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC12A1 in bladder cancer			[ 2 ]
Location	TSS1500 (cg26317549)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -2.29E+00	Statistic Test	p-value: 2.95E-12; Z-score: -1.44E+01
Methylation in Case	3.20E-01 (Median)	Methylation in Control	7.31E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC12A1 in bladder cancer			[ 2 ]
Location	TSS1500 (cg07915221)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.26E+00	Statistic Test	p-value: 9.45E-06; Z-score: -2.03E+01
Methylation in Case	7.38E-01 (Median)	Methylation in Control	9.31E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC12A1 in bladder cancer			[ 2 ]
Location	TSS1500 (cg21384789)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.04E+00	Statistic Test	p-value: 4.28E-04; Z-score: -3.57E+00
Methylation in Case	8.33E-01 (Median)	Methylation in Control	8.66E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC12A1 in bladder cancer			[ 2 ]
Location	Body (cg14167964)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -2.57E+00	Statistic Test	p-value: 6.03E-09; Z-score: -8.44E+00
Methylation in Case	3.29E-01 (Median)	Methylation in Control	8.45E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC12A1 in bladder cancer			[ 2 ]
Location	Body (cg14930674)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.45E+00	Statistic Test	p-value: 6.81E-07; Z-score: -6.57E+01
Methylation in Case	5.30E-01 (Median)	Methylation in Control	7.71E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC12A1 in bladder cancer			[ 2 ]
Location	Body (cg23530596)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.90E+00	Statistic Test	p-value: 1.30E-06; Z-score: -8.61E+00
Methylation in Case	2.37E-01 (Median)	Methylation in Control	4.49E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC12A1 in bladder cancer			[ 2 ]
Location	Body (cg10616694)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.57E+00	Statistic Test	p-value: 1.57E-06; Z-score: -1.21E+01
Methylation in Case	5.29E-01 (Median)	Methylation in Control	8.34E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of SLC12A1 in bladder cancer			[ 2 ]
Location	Body (cg14857792)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.83E+00	Statistic Test	p-value: 4.00E-06; Z-score: -7.06E+00
Methylation in Case	3.73E-01 (Median)	Methylation in Control	6.85E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 9	Methylation of SLC12A1 in bladder cancer			[ 2 ]
Location	Body (cg14229516)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.36E+00	Statistic Test	p-value: 6.16E-06; Z-score: -1.60E+01
Methylation in Case	6.48E-01 (Median)	Methylation in Control	8.83E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 10	Methylation of SLC12A1 in bladder cancer			[ 2 ]
Location	Body (cg13944105)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.40E+00	Statistic Test	p-value: 6.70E-04; Z-score: -7.55E+00
Methylation in Case	3.66E-01 (Median)	Methylation in Control	5.12E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Breast cancer	8 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC12A1 in breast cancer			[ 3 ]
Location	TSS1500 (cg07915221)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.03E+00	Statistic Test	p-value: 5.71E-06; Z-score: -1.26E+00
Methylation in Case	8.87E-01 (Median)	Methylation in Control	9.11E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC12A1 in breast cancer			[ 3 ]
Location	TSS1500 (cg26317549)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.21E+00	Statistic Test	p-value: 1.90E-03; Z-score: -1.15E+00
Methylation in Case	5.66E-01 (Median)	Methylation in Control	6.84E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC12A1 in breast cancer			[ 3 ]
Location	Body (cg10616694)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.14E+00	Statistic Test	p-value: 9.85E-14; Z-score: -2.54E+00
Methylation in Case	7.44E-01 (Median)	Methylation in Control	8.50E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC12A1 in breast cancer			[ 3 ]
Location	Body (cg23530596)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.36E+00	Statistic Test	p-value: 9.25E-09; Z-score: 1.74E+00
Methylation in Case	3.58E-01 (Median)	Methylation in Control	2.64E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC12A1 in breast cancer			[ 3 ]
Location	Body (cg14229516)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.07E+00	Statistic Test	p-value: 9.24E-08; Z-score: -1.37E+00
Methylation in Case	8.03E-01 (Median)	Methylation in Control	8.59E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC12A1 in breast cancer			[ 3 ]
Location	Body (cg14167964)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.08E+00	Statistic Test	p-value: 1.87E-07; Z-score: -1.26E+00
Methylation in Case	7.23E-01 (Median)	Methylation in Control	7.78E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC12A1 in breast cancer			[ 3 ]
Location	Body (cg14930674)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.01E+00	Statistic Test	p-value: 6.06E-03; Z-score: -3.35E-01
Methylation in Case	7.72E-01 (Median)	Methylation in Control	7.80E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of SLC12A1 in breast cancer			[ 3 ]
Location	Body (cg14857792)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.08E+00	Statistic Test	p-value: 4.21E-02; Z-score: -5.35E-01
Methylation in Case	6.36E-01 (Median)	Methylation in Control	6.89E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Colorectal cancer	9 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC12A1 in colorectal cancer			[ 4 ]
Location	TSS1500 (cg26317549)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.30E+00	Statistic Test	p-value: 9.68E-15; Z-score: -6.11E+00
Methylation in Case	6.57E-01 (Median)	Methylation in Control	8.57E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC12A1 in colorectal cancer			[ 4 ]
Location	TSS1500 (cg07915221)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.00E+00	Statistic Test	p-value: 2.90E-02; Z-score: 3.47E-02
Methylation in Case	9.43E-01 (Median)	Methylation in Control	9.42E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC12A1 in colorectal cancer			[ 4 ]
Location	Body (cg23530596)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.40E+00	Statistic Test	p-value: 1.07E-15; Z-score: -4.25E+00
Methylation in Case	5.08E-01 (Median)	Methylation in Control	7.14E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC12A1 in colorectal cancer			[ 4 ]
Location	Body (cg14857792)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.27E+00	Statistic Test	p-value: 4.94E-12; Z-score: -4.99E+00
Methylation in Case	6.55E-01 (Median)	Methylation in Control	8.30E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC12A1 in colorectal cancer			[ 4 ]
Location	Body (cg10616694)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.08E+00	Statistic Test	p-value: 4.44E-09; Z-score: -2.80E+00
Methylation in Case	8.35E-01 (Median)	Methylation in Control	9.02E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC12A1 in colorectal cancer			[ 4 ]
Location	Body (cg14229516)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.06E+00	Statistic Test	p-value: 2.68E-06; Z-score: -3.16E+00
Methylation in Case	8.68E-01 (Median)	Methylation in Control	9.17E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC12A1 in colorectal cancer			[ 4 ]
Location	Body (cg14930674)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.05E+00	Statistic Test	p-value: 1.72E-05; Z-score: -2.28E+00
Methylation in Case	8.53E-01 (Median)	Methylation in Control	8.93E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of SLC12A1 in colorectal cancer			[ 4 ]
Location	Body (cg13944105)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.20E+00	Statistic Test	p-value: 6.20E-05; Z-score: -1.12E+00
Methylation in Case	6.65E-01 (Median)	Methylation in Control	7.99E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 9	Methylation of SLC12A1 in colorectal cancer			[ 4 ]
Location	Body (cg14167964)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.03E+00	Statistic Test	p-value: 1.66E-03; Z-score: -5.46E-01
Methylation in Case	8.67E-01 (Median)	Methylation in Control	8.97E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
HIV infection	7 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC12A1 in HIV infection			[ 5 ]
Location	TSS1500 (cg26317549)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.07E+00	Statistic Test	p-value: 4.50E-05; Z-score: -1.43E+00
Methylation in Case	7.40E-01 (Median)	Methylation in Control	7.92E-01 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC12A1 in HIV infection			[ 5 ]
Location	Body (cg23530596)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.14E+00	Statistic Test	p-value: 4.84E-07; Z-score: -2.03E+00
Methylation in Case	6.73E-01 (Median)	Methylation in Control	7.64E-01 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC12A1 in HIV infection			[ 5 ]
Location	Body (cg13944105)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.10E+00	Statistic Test	p-value: 5.50E-06; Z-score: -2.28E+00
Methylation in Case	7.80E-01 (Median)	Methylation in Control	8.59E-01 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC12A1 in HIV infection			[ 5 ]
Location	Body (cg10616694)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.06E+00	Statistic Test	p-value: 3.29E-04; Z-score: -1.22E+00
Methylation in Case	8.40E-01 (Median)	Methylation in Control	8.92E-01 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC12A1 in HIV infection			[ 5 ]
Location	Body (cg14857792)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.08E+00	Statistic Test	p-value: 1.46E-03; Z-score: -1.22E+00
Methylation in Case	7.57E-01 (Median)	Methylation in Control	8.17E-01 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC12A1 in HIV infection			[ 5 ]
Location	Body (cg14167964)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.01E+00	Statistic Test	p-value: 2.02E-02; Z-score: -6.81E-01
Methylation in Case	9.21E-01 (Median)	Methylation in Control	9.34E-01 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC12A1 in HIV infection			[ 5 ]
Location	Body (cg14229516)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.02E+00	Statistic Test	p-value: 2.09E-02; Z-score: -4.83E-01
Methylation in Case	8.60E-01 (Median)	Methylation in Control	8.80E-01 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Pancretic ductal adenocarcinoma	6 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC12A1 in pancretic ductal adenocarcinoma			[ 6 ]
Location	TSS1500 (cg20392607)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 6.84E+00	Statistic Test	p-value: 3.19E-30; Z-score: 4.90E+00
Methylation in Case	3.63E-01 (Median)	Methylation in Control	5.30E-02 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC12A1 in pancretic ductal adenocarcinoma			[ 6 ]
Location	TSS1500 (cg12367786)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.21E+00	Statistic Test	p-value: 1.80E-04; Z-score: -1.08E+00
Methylation in Case	3.98E-01 (Median)	Methylation in Control	4.82E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC12A1 in pancretic ductal adenocarcinoma			[ 6 ]
Location	TSS1500 (cg16667710)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.01E+00	Statistic Test	p-value: 1.94E-02; Z-score: -3.07E-01
Methylation in Case	8.86E-01 (Median)	Methylation in Control	8.90E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC12A1 in pancretic ductal adenocarcinoma			[ 6 ]
Location	Body (cg10841552)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.77E+00	Statistic Test	p-value: 1.35E-21; Z-score: 3.72E+00
Methylation in Case	4.33E-01 (Median)	Methylation in Control	2.44E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC12A1 in pancretic ductal adenocarcinoma			[ 6 ]
Location	Body (cg04408162)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.25E+00	Statistic Test	p-value: 4.24E-10; Z-score: -2.14E+00
Methylation in Case	2.79E-01 (Median)	Methylation in Control	3.49E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC12A1 in pancretic ductal adenocarcinoma			[ 6 ]
Location	Body (cg25196715)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.03E+00	Statistic Test	p-value: 1.08E-03; Z-score: 9.34E-01
Methylation in Case	8.92E-01 (Median)	Methylation in Control	8.67E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Panic disorder	5 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC12A1 in panic disorder			[ 7 ]
Location	TSS1500 (cg26317549)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.09E+00	Statistic Test	p-value: 6.05E-03; Z-score: 4.56E-01
Methylation in Case	1.94E+00 (Median)	Methylation in Control	1.79E+00 (Median)
Studied Phenotype	Panic disorder [ ICD-11: 6B01]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC12A1 in panic disorder			[ 7 ]
Location	TSS1500 (cg07915221)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.38E+00	Statistic Test	p-value: 2.57E-02; Z-score: 5.07E-01
Methylation in Case	7.59E-01 (Median)	Methylation in Control	5.50E-01 (Median)
Studied Phenotype	Panic disorder [ ICD-11: 6B01]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC12A1 in panic disorder			[ 7 ]
Location	Body (cg14167964)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -2.70E+00	Statistic Test	p-value: 1.16E-04; Z-score: -7.15E-01
Methylation in Case	1.95E-01 (Median)	Methylation in Control	5.27E-01 (Median)
Studied Phenotype	Panic disorder [ ICD-11: 6B01]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC12A1 in panic disorder			[ 7 ]
Location	Body (cg13944105)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.16E+00	Statistic Test	p-value: 5.36E-03; Z-score: 5.99E-01
Methylation in Case	1.67E+00 (Median)	Methylation in Control	1.45E+00 (Median)
Studied Phenotype	Panic disorder [ ICD-11: 6B01]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC12A1 in panic disorder			[ 7 ]
Location	Body (cg14229516)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.31E+00	Statistic Test	p-value: 9.73E-03; Z-score: 5.28E-01
Methylation in Case	9.10E-01 (Median)	Methylation in Control	6.97E-01 (Median)
Studied Phenotype	Panic disorder [ ICD-11: 6B01]
Experimental Material	Patient tissue samples
Papillary thyroid cancer	5 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC12A1 in papillary thyroid cancer			[ 8 ]
Location	TSS1500 (cg26317549)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.01E+00	Statistic Test	p-value: 8.12E-03; Z-score: -1.26E-01
Methylation in Case	7.71E-01 (Median)	Methylation in Control	7.76E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC12A1 in papillary thyroid cancer			[ 8 ]
Location	TSS1500 (cg07915221)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.01E+00	Statistic Test	p-value: 4.06E-02; Z-score: -4.70E-01
Methylation in Case	9.40E-01 (Median)	Methylation in Control	9.46E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC12A1 in papillary thyroid cancer			[ 8 ]
Location	Body (cg14229516)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.02E+00	Statistic Test	p-value: 1.90E-03; Z-score: -6.38E-01
Methylation in Case	9.13E-01 (Median)	Methylation in Control	9.28E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC12A1 in papillary thyroid cancer			[ 8 ]
Location	Body (cg23530596)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.08E+00	Statistic Test	p-value: 6.13E-03; Z-score: -9.49E-01
Methylation in Case	6.16E-01 (Median)	Methylation in Control	6.65E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC12A1 in papillary thyroid cancer			[ 8 ]
Location	Body (cg10616694)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.02E+00	Statistic Test	p-value: 7.32E-03; Z-score: -4.36E-01
Methylation in Case	8.63E-01 (Median)	Methylation in Control	8.76E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Prostate cancer	2 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC12A1 in prostate cancer			[ 9 ]
Location	TSS1500 (cg22294577)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.07E+00	Statistic Test	p-value: 1.10E-02; Z-score: 5.09E+00
Methylation in Case	9.10E-01 (Median)	Methylation in Control	8.49E-01 (Median)
Studied Phenotype	Prostate cancer [ ICD-11: 2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC12A1 in prostate cancer			[ 9 ]
Location	TSS1500 (cg02428538)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.03E+00	Statistic Test	p-value: 3.98E-02; Z-score: 1.48E+00
Methylation in Case	9.50E-01 (Median)	Methylation in Control	9.22E-01 (Median)
Studied Phenotype	Prostate cancer [ ICD-11: 2C82]
Experimental Material	Patient tissue samples
Systemic lupus erythematosus	6 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC12A1 in systemic lupus erythematosus			[ 10 ]
Location	TSS1500 (cg26317549)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.01E+00	Statistic Test	p-value: 8.95E-03; Z-score: -1.50E-01
Methylation in Case	7.92E-01 (Median)	Methylation in Control	8.02E-01 (Median)
Studied Phenotype	Systemic lupus erythematosus [ ICD-11: 4A40.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC12A1 in systemic lupus erythematosus			[ 10 ]
Location	Body (cg14930674)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.01E+00	Statistic Test	p-value: 2.31E-03; Z-score: -2.27E-01
Methylation in Case	8.89E-01 (Median)	Methylation in Control	8.95E-01 (Median)
Studied Phenotype	Systemic lupus erythematosus [ ICD-11: 4A40.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC12A1 in systemic lupus erythematosus			[ 10 ]
Location	Body (cg14857792)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.02E+00	Statistic Test	p-value: 4.32E-03; Z-score: -3.11E-01
Methylation in Case	7.84E-01 (Median)	Methylation in Control	8.04E-01 (Median)
Studied Phenotype	Systemic lupus erythematosus [ ICD-11: 4A40.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC12A1 in systemic lupus erythematosus			[ 10 ]
Location	Body (cg10616694)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.02E+00	Statistic Test	p-value: 1.97E-02; Z-score: -2.20E-01
Methylation in Case	8.29E-01 (Median)	Methylation in Control	8.45E-01 (Median)
Studied Phenotype	Systemic lupus erythematosus [ ICD-11: 4A40.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC12A1 in systemic lupus erythematosus			[ 10 ]
Location	Body (cg13944105)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.01E+00	Statistic Test	p-value: 2.19E-02; Z-score: -1.27E-01
Methylation in Case	8.14E-01 (Median)	Methylation in Control	8.25E-01 (Median)
Studied Phenotype	Systemic lupus erythematosus [ ICD-11: 4A40.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC12A1 in systemic lupus erythematosus			[ 10 ]
Location	Body (cg23530596)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.00E+00	Statistic Test	p-value: 3.74E-02; Z-score: 4.30E-03
Methylation in Case	7.27E-01 (Median)	Methylation in Control	7.26E-01 (Median)
Studied Phenotype	Systemic lupus erythematosus [ ICD-11: 4A40.0]
Experimental Material	Patient tissue samples
Atypical teratoid rhabdoid tumor	4 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC12A1 in atypical teratoid rhabdoid tumor			[ 11 ]
Location	Body (cg10616694)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -2.28E+00	Statistic Test	p-value: 1.66E-02; Z-score: -3.16E-01
Methylation in Case	3.45E-02 (Median)	Methylation in Control	7.86E-02 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC12A1 in atypical teratoid rhabdoid tumor			[ 11 ]
Location	Body (cg13944105)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.04E+00	Statistic Test	p-value: 4.01E-02; Z-score: 4.34E-01
Methylation in Case	8.85E-01 (Median)	Methylation in Control	8.53E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC12A1 in atypical teratoid rhabdoid tumor			[ 11 ]
Location	Body (cg14167964)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.29E+00	Statistic Test	p-value: 4.28E-02; Z-score: -6.74E-01
Methylation in Case	1.51E-01 (Median)	Methylation in Control	1.94E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC12A1 in atypical teratoid rhabdoid tumor			[ 11 ]
Location	Body (cg14229516)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.04E+00	Statistic Test	p-value: 4.36E-02; Z-score: 2.81E-01
Methylation in Case	7.66E-01 (Median)	Methylation in Control	7.36E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Lung adenocarcinoma	3 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC12A1 in lung adenocarcinoma			[ 12 ]
Location	Body (cg14229516)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.05E+00	Statistic Test	p-value: 6.27E-03; Z-score: -1.78E+00
Methylation in Case	8.03E-01 (Median)	Methylation in Control	8.44E-01 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC12A1 in lung adenocarcinoma			[ 12 ]
Location	Body (cg10616694)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.09E+00	Statistic Test	p-value: 1.57E-02; Z-score: -1.67E+00
Methylation in Case	7.60E-01 (Median)	Methylation in Control	8.30E-01 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC12A1 in lung adenocarcinoma			[ 12 ]
Location	Body (cg14930674)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.04E+00	Statistic Test	p-value: 3.56E-02; Z-score: -1.20E+00
Methylation in Case	7.94E-01 (Median)	Methylation in Control	8.30E-01 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
microRNA
Renal cell carcinoma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Higher expression of miR-21 in clear cell renal cell carcinoma (compare with normal kidney tissue)			[ 13 ]
Epigenetic Type	microRNA	Experiment Method	Chromatin immunoprecipitation
Related Molecular Changes	Down regulation of SLC12A1	Experiment Method	RT-qPCR
miRNA Stemloop ID	miR-21	miRNA Mature ID	miR-21-5p
miRNA Sequence	UAGCUUAUCAGACUGAUGUUGA
miRNA Target Type	Direct
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Additional Notes	miR-21 was up-regulated in clear cell renal cell carcinoma and regulated SLC12A1 expression via binding to the SLC12A1 mRNA.

References
1	Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
2	DNA Methylation Dynamics in Urological Tumors.
3	Genome-wide Scan for Methylation Profiles in Breast Cancer
4	Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
5	HIV-1 Infection Accelerates Age According to the Epigenetic Clock. J Infect Dis. 2015 Nov 15;212(10):1563-73.
6	Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
7	DNA Methylation signatures in panic disorder. Transl Psychiatry. 2017 Dec 18;7(12):1287.
8	Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
9	Reducing the risk of false discovery enabling identification of biologically significant genome-wide methylation status using the HumanMethylation450 array. BMC Genomics. 2014 Jan 22;15:51.
10	Genome-wide DNA methylation analysis of systemic lupus erythematosus reveals persistent hypomethylation of interferon genes and compositional changes to CD4+ T-cell populations. PLoS Genet. 2013;9(8):e1003678.
11	Atypical Teratoid/Rhabdoid Tumors Are Comprised of Three Epigenetic Subgroups with Distinct Enhancer Landscapes. Cancer Cell. 2016 Mar 14;29(3):379-393.
12	DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
13	Identifying mRNA targets of microRNA dysregulated in cancer: with application to clear cell Renal Cell Carcinoma. BMC Syst Biol. 2010 Apr 27;4:51.

If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.

Detail Information of Epigenetic Regulations

Visitor Map

Correspondence