Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID DTD0083 Transporter Info
Gene Name SLC12A2
Transporter Name Basolateral Na-K-Cl symporter
Gene ID
6558
UniProt ID
P55011
Epigenetic Regulations of This DT (EGR)

Methylation

  Pancretic ductal adenocarcinoma

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC12A2 in pancretic ductal adenocarcinoma [ 1 ]

Location

 TSS1500 (cg19932080)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.11E+00 Statistic Test p-value: 4.33E-03; Z-score: 1.46E+00

Methylation in Case

 7.85E-01 (Median) Methylation in Control 7.07E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Atypical teratoid rhabdoid tumor

            4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC12A2 in atypical teratoid rhabdoid tumor [ 2 ]

Location

 Body (cg00308508)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.50E+00 Statistic Test p-value: 2.15E-05; Z-score: 1.25E+00

Methylation in Case

 8.25E-01 (Median) Methylation in Control 5.50E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC12A2 in atypical teratoid rhabdoid tumor [ 2 ]

Location

 Body (cg01159515)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.04E+00 Statistic Test p-value: 4.88E-05; Z-score: -9.56E-01

Methylation in Case

 9.11E-01 (Median) Methylation in Control 9.51E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC12A2 in atypical teratoid rhabdoid tumor [ 2 ]

Location

 Body (cg13676672)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.03E+00 Statistic Test p-value: 3.79E-02; Z-score: -1.94E-01

Methylation in Case

 6.79E-01 (Median) Methylation in Control 7.00E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC12A2 in atypical teratoid rhabdoid tumor [ 2 ]

Location

 3'UTR (cg19637461)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.43E+00 Statistic Test p-value: 3.18E-10; Z-score: -1.53E+00

Methylation in Case

 4.71E-01 (Median) Methylation in Control 6.72E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Bladder cancer

            3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC12A2 in bladder cancer [ 3 ]

Location

 Body (cg13676672)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -2.14E+00 Statistic Test p-value: 3.63E-05; Z-score: -4.22E+00

Methylation in Case

 1.49E-01 (Median) Methylation in Control 3.19E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC12A2 in bladder cancer [ 3 ]

Location

 Body (cg19767477)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -2.92E+00 Statistic Test p-value: 1.64E-03; Z-score: -2.75E+00

Methylation in Case

 4.40E-02 (Median) Methylation in Control 1.29E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC12A2 in bladder cancer [ 3 ]

Location

 Body (cg00308508)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.03E+00 Statistic Test p-value: 5.93E-03; Z-score: -2.11E+00

Methylation in Case

 8.45E-01 (Median) Methylation in Control 8.69E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Breast cancer

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC12A2 in breast cancer [ 4 ]

Location

 Body (cg00308508)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.07E+00 Statistic Test p-value: 1.52E-02; Z-score: 9.53E-01

Methylation in Case

 8.37E-01 (Median) Methylation in Control 7.81E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Hepatocellular carcinoma

            3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC12A2 in hepatocellular carcinoma [ 5 ]

Location

 Body (cg13676672)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.44E+00 Statistic Test p-value: 4.48E-04; Z-score: -1.52E+00

Methylation in Case

 3.04E-01 (Median) Methylation in Control 4.37E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC12A2 in hepatocellular carcinoma [ 5 ]

Location

 Body (cg19767477)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -2.02E+00 Statistic Test p-value: 1.63E-02; Z-score: -1.55E+00

Methylation in Case

 9.64E-02 (Median) Methylation in Control 1.95E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC12A2 in hepatocellular carcinoma [ 5 ]

Location

 3'UTR (cg19637461)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.01E+00 Statistic Test p-value: 5.16E-03; Z-score: -2.11E-01

Methylation in Case

 8.21E-01 (Median) Methylation in Control 8.30E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Panic disorder

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC12A2 in panic disorder [ 6 ]

Location

 Body (cg01159515)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -9.52E-01 Statistic Test p-value: 2.78E-03; Z-score: -3.23E-01

Methylation in Case

 -3.30E+00 (Median) Methylation in Control -3.14E+00 (Median)

Studied Phenotype

 Panic disorder [ ICD-11: 6B01]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC12A2 in panic disorder [ 6 ]

Location

 3'UTR (cg19637461)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -3.09E+00 Statistic Test p-value: 1.12E-02; Z-score: -4.73E-01

Methylation in Case

 8.78E-02 (Median) Methylation in Control 2.71E-01 (Median)

Studied Phenotype

 Panic disorder [ ICD-11: 6B01]

Experimental Material

 Patient tissue samples

  Papillary thyroid cancer

            3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC12A2 in papillary thyroid cancer [ 7 ]

Location

 Body (cg19767477)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -2.67E+00 Statistic Test p-value: 1.52E-14; Z-score: -2.83E+00

Methylation in Case

 9.47E-02 (Median) Methylation in Control 2.53E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC12A2 in papillary thyroid cancer [ 7 ]

Location

 Body (cg01159515)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.26E+00 Statistic Test p-value: 2.78E-09; Z-score: -1.37E+00

Methylation in Case

 1.41E-01 (Median) Methylation in Control 1.77E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC12A2 in papillary thyroid cancer [ 7 ]

Location

 Body (cg00308508)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.01E+00 Statistic Test p-value: 7.51E-03; Z-score: -4.08E-01

Methylation in Case

 9.03E-01 (Median) Methylation in Control 9.11E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Systemic lupus erythematosus

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC12A2 in systemic lupus erythematosus [ 8 ]

Location

 Body (cg13676672)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.16E+00 Statistic Test p-value: 2.46E-04; Z-score: 4.60E-01

Methylation in Case

 5.68E-01 (Median) Methylation in Control 4.88E-01 (Median)

Studied Phenotype

 Systemic lupus erythematosus [ ICD-11: 4A40.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC12A2 in systemic lupus erythematosus [ 8 ]

Location

 Body (cg19767477)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.20E+00 Statistic Test p-value: 1.91E-03; Z-score: 4.13E-01

Methylation in Case

 9.71E-02 (Median) Methylation in Control 8.06E-02 (Median)

Studied Phenotype

 Systemic lupus erythematosus [ ICD-11: 4A40.0]

Experimental Material

 Patient tissue samples

Histone dimethylation

  Hypertension

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Higher level of histone dimethylation of Slc12a2 in hypertension (compare with normal rats) [ 9 ]

Location

 Promoter

Epigenetic Type

 Histone dimethylation Experiment Method Chromatin immunoprecipitation

Related Molecular Changes

 Up regulation of Slc12a2 Experiment Method RT-qPCR

Studied Phenotype

 Hypertension [ ICD-11: BA00-BA04]

Experimental Material

 Model organism in vivo (mouse)

Additional Notes

 The increased levels of mRNA expression correlated with increment of dimethylation on H3K4 at the Slc12a2 promoter region in spontaneously hypertensive rat.

  Epigenetic Phenomenon 2

 Lower level of histone dimethylation of Slc12a2 in hypertension (compare with normal rats) [ 9 ]

Location

 Promoter

Epigenetic Type

 Histone dimethylation Experiment Method Chromatin immunoprecipitation

Related Molecular Changes

 Up regulation of Slc12a2 Experiment Method RT-qPCR

Studied Phenotype

 Hypertension [ ICD-11: BA00-BA04]

Experimental Material

 Model organism in vivo (mouse)

Additional Notes

 The decreased levels of mRNA expression correlated with increment of dimethylation on H3K4 at the Slc12a2 promoter region in spontaneously hypertensive rat.

Histone acetylation

  Hypertension

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Hyperacetylation of Slc12a2 in hypertension (compare with normal rats) [ 9 ]

Location

 Promoter

Epigenetic Type

 Histone acetylation Experiment Method Chromatin immunoprecipitation

Related Molecular Changes

 Up regulation of Slc12a2 Experiment Method RT-qPCR

Studied Phenotype

 Hypertension [ ICD-11: BA00-BA04]

Experimental Material

 Model organism in vivo (mouse)

Additional Notes

 The increased levels of mRNA expression correlated with increment of acetylation on H3K4 at the Slc12a2 promoter region in spontaneously hypertensive rat.

  Epigenetic Phenomenon 2

 Hypoacetylation of Slc12a2 in hypertension (compare with Ang II-treatment counterpart hypertension rats) [ 10 ]

Location

 Promoter

Epigenetic Type

 Histone acetylation Experiment Method Chromatin immunoprecipitation

Related Molecular Changes

 Down regulation of Slc12a2 Experiment Method RT-qPCR

Studied Phenotype

 Hypertension [ ICD-11: BA00-BA04]

Experimental Material

 Model organism in vivo (mouse)

Additional Notes

 Slc12a2 is upregulated via histone modification in the aortas of Ang II-induced hypertensive SD rats.

Histone trimethylation

  Hypertension

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Hypoacetylation of Slc12a2 in hypertension (compare with Ang II-treatment counterpart hypertension rats) [ 10 ]

Location

 Promoter

Epigenetic Type

 Histone trimethylation Experiment Method Chromatin immunoprecipitation

Related Molecular Changes

 Down regulation of Slc12a2 Experiment Method RT-qPCR

Studied Phenotype

 Hypertension [ ICD-11: BA00-BA04]

Experimental Material

 Model organism in vivo (mouse)

Additional Notes

 Slc12a2 is upregulated via histone modification in the aortas of Ang II-induced hypertensive SD rats.

microRNA

  Unclear Phenotype

          15 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 let-7c directly targets SLC12A2 [ 11 ]

Epigenetic Type

 microRNA Experiment Method CLASH

miRNA Stemloop ID

 let-7c miRNA Mature ID let-7c-5p

miRNA Sequence

 UGAGGUAGUAGGUUGUAUGGUU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 2

 miR-16 directly targets SLC12A2 [ 12 ]

Epigenetic Type

 microRNA Experiment Method pSILAC//Proteomics;Other

miRNA Stemloop ID

 miR-16 miRNA Mature ID miR-16-5p

miRNA Sequence

 UAGCAGCACGUAAAUAUUGGCG

miRNA Target Type

 Direct

Experimental Material

 Human cervical cancer cell line (Hela)

  Epigenetic Phenomenon 3

 miR-190a directly targets SLC12A2 [ 13 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP//HITS-CLIP

miRNA Stemloop ID

 miR-190a miRNA Mature ID miR-190a-3p

miRNA Sequence

 CUAUAUAUCAAACAUAUUCCU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 4

 miR-30a directly targets SLC12A2 [ 12 ]

Epigenetic Type

 microRNA Experiment Method Proteomics

miRNA Stemloop ID

 miR-30a miRNA Mature ID miR-30a-5p

miRNA Sequence

 UGUAAACAUCCUCGACUGGAAG

miRNA Target Type

 Direct

Experimental Material

 Human cervical cancer cell line (Hela)

  Epigenetic Phenomenon 5

 miR-329 directly targets SLC12A2 [ 13 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP//HITS-CLIP

miRNA Stemloop ID

 miR-329 miRNA Mature ID miR-329-3p

miRNA Sequence

 AACACACCUGGUUAACCUCUUU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 6

 miR-362 directly targets SLC12A2 [ 13 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP//HITS-CLIP

miRNA Stemloop ID

 miR-362 miRNA Mature ID miR-362-3p

miRNA Sequence

 AACACACCUAUUCAAGGAUUCA

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 7

 miR-3941 directly targets SLC12A2 [ 13 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP//HITS-CLIP

miRNA Stemloop ID

 miR-3941 miRNA Mature ID miR-3941

miRNA Sequence

 UUACACACAACUGAGGAUCAUA

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 8

 miR-4719 directly targets SLC12A2 [ 13 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP//HITS-CLIP

miRNA Stemloop ID

 miR-4719 miRNA Mature ID miR-4719

miRNA Sequence

 UCACAAAUCUAUAAUAUGCAGG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 9

 miR-4789 directly targets SLC12A2 [ 13 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP//HITS-CLIP

miRNA Stemloop ID

 miR-4789 miRNA Mature ID miR-4789-5p

miRNA Sequence

 GUAUACACCUGAUAUGUGUAUG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 10

 miR-5011 directly targets SLC12A2 [ 13 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP//HITS-CLIP

miRNA Stemloop ID

 miR-5011 miRNA Mature ID miR-5011-5p

miRNA Sequence

 UAUAUAUACAGCCAUGCACUC

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 11

 miR-5580 directly targets SLC12A2 [ 13 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP//HITS-CLIP

miRNA Stemloop ID

 miR-5580 miRNA Mature ID miR-5580-3p

miRNA Sequence

 CACAUAUGAAGUGAGCCAGCAC

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 12

 miR-603 directly targets SLC12A2 [ 13 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP//HITS-CLIP

miRNA Stemloop ID

 miR-603 miRNA Mature ID miR-603

miRNA Sequence

 CACACACUGCAAUUACUUUUGC

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 13

 miR-6504 directly targets SLC12A2 [ 13 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP//HITS-CLIP

miRNA Stemloop ID

 miR-6504 miRNA Mature ID miR-6504-3p

miRNA Sequence

 CAUUACAGCACAGCCAUUCU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 14

 miR-8485 directly targets SLC12A2 [ 13 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP//HITS-CLIP

miRNA Stemloop ID

 miR-8485 miRNA Mature ID miR-8485

miRNA Sequence

 CACACACACACACACACGUAU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 15

 miR-935 directly targets SLC12A2 [ 14 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-935 miRNA Mature ID miR-935

miRNA Sequence

 CCAGUUACCGCUUCCGCUACCGC

miRNA Target Type

 Direct

Experimental Material

 Left ventricular cardiac tissues of human
References
1 Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
2 Atypical Teratoid/Rhabdoid Tumors Are Comprised of Three Epigenetic Subgroups with Distinct Enhancer Landscapes. Cancer Cell. 2016 Mar 14;29(3):379-393.
3 DNA Methylation Dynamics in Urological Tumors.
4 Genome-wide Scan for Methylation Profiles in Breast Cancer
5 Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
6 DNA Methylation signatures in panic disorder. Transl Psychiatry. 2017 Dec 18;7(12):1287.
7 Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
8 Genome-wide DNA methylation analysis of systemic lupus erythematosus reveals persistent hypomethylation of interferon genes and compositional changes to CD4+ T-cell populations. PLoS Genet. 2013;9(8):e1003678.
9 Expression of Na+-K+ -2Cl- cotransporter 1 is epigenetically regulated during postnatal development of hypertension. Am J Hypertens. 2011 Dec;24(12):1286-93.
10 Upregulation of the Na(+)-K(+)-2Cl(-) cotransporter 1 via histone modification in the aortas of angiotensin II-induced hypertensive rats. Hypertens Res. 2012 Aug;35(8):819-24.
11 Mapping the human miRNA interactome by CLASH reveals frequent noncanonical binding. Cell. 2013 Apr 25;153(3):654-65.
12 Widespread changes in protein synthesis induced by microRNAs. Nature. 2008 Sep 4;455(7209):58-63.
13 A quantitative analysis of CLIP methods for identifying binding sites of RNA-binding proteins. Nat Methods. 2011 May 15;8(7):559-64.
14 Elucidation of transcriptome-wide microRNA binding sites in human cardiac tissues by Ago2 HITS-CLIP. Nucleic Acids Res. 2016 Sep 6;44(15):7120-31.

If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.