Detail Information of Epigenetic Regulations
General Information of Drug Transporter (DT) | |||||
---|---|---|---|---|---|
DT ID | DTD0085 Transporter Info | ||||
Gene Name | SLC12A4 | ||||
Transporter Name | Electroneutral potassium-chloride cotransporter 1 | ||||
Gene ID | |||||
UniProt ID | |||||
Epigenetic Regulations of This DT (EGR) | |||||
---|---|---|---|---|---|
microRNA |
|||||
Unclear Phenotype |
5 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon 1 |
let-7e directly targets SLC12A4 | [ 1 ] | |||
Epigenetic Type |
microRNA | Experiment Method | CLASH | ||
miRNA Stemloop ID |
let-7e | miRNA Mature ID | let-7e-5p | ||
miRNA Sequence |
UGAGGUAGGAGGUUGUAUAGUU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 2 |
miR-155 directly targets SLC12A4 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | Proteomics | ||
miRNA Stemloop ID |
miR-155 | miRNA Mature ID | miR-155-5p | ||
miRNA Sequence |
UUAAUGCUAAUCGUGAUAGGGGUU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human cervical cancer cell line (Hela) | ||||
Epigenetic Phenomenon 3 |
miR-25 directly targets SLC12A4 | [ 1 ] | |||
Epigenetic Type |
microRNA | Experiment Method | CLASH | ||
miRNA Stemloop ID |
miR-25 | miRNA Mature ID | miR-25-3p | ||
miRNA Sequence |
CAUUGCACUUGUCUCGGUCUGA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 4 |
miR-30a directly targets SLC12A4 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | pSILAC//Proteomics;Other | ||
miRNA Stemloop ID |
miR-30a | miRNA Mature ID | miR-30a-5p | ||
miRNA Sequence |
UGUAAACAUCCUCGACUGGAAG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human cervical cancer cell line (Hela) | ||||
Epigenetic Phenomenon 5 |
miR-92a directly targets SLC12A4 | [ 1 ] | |||
Epigenetic Type |
microRNA | Experiment Method | CLASH | ||
miRNA Stemloop ID |
miR-92a | miRNA Mature ID | miR-92a-3p | ||
miRNA Sequence |
UAUUGCACUUGUCCCGGCCUGU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Methylation |
|||||
If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.