Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID DTD0087 Transporter Info
Gene Name SLC12A6
Transporter Name Electroneutral potassium-chloride cotransporter 3
Gene ID
9990
UniProt ID
Q9UHW9
Epigenetic Regulations of This DT (EGR)

Methylation

  Bladder cancer

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC12A6 in bladder cancer [ 1 ]

Location

 TSS1500 (cg01053714)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.10E+00 Statistic Test p-value: 1.33E-02; Z-score: -1.37E+00

Methylation in Case

 5.50E-01 (Median) Methylation in Control 6.05E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Breast cancer

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC12A6 in breast cancer [ 2 ]

Location

 TSS1500 (cg01053714)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.02E+00 Statistic Test p-value: 9.18E-03; Z-score: 1.94E-01

Methylation in Case

 6.53E-01 (Median) Methylation in Control 6.39E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Hepatocellular carcinoma

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC12A6 in hepatocellular carcinoma [ 3 ]

Location

 TSS1500 (cg01053714)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.04E+00 Statistic Test p-value: 1.21E-03; Z-score: -7.34E-01

Methylation in Case

 7.09E-01 (Median) Methylation in Control 7.37E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Papillary thyroid cancer

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC12A6 in papillary thyroid cancer [ 4 ]

Location

 TSS1500 (cg01053714)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.08E+00 Statistic Test p-value: 1.61E-02; Z-score: 1.68E+00

Methylation in Case

 7.91E-01 (Median) Methylation in Control 7.32E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Pancretic ductal adenocarcinoma

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC12A6 in pancretic ductal adenocarcinoma [ 5 ]

Location

 1stExon (cg04643655)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.04E+00 Statistic Test p-value: 1.89E-03; Z-score: -6.56E-01

Methylation in Case

 4.77E-01 (Median) Methylation in Control 4.99E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

microRNA

  Unclear Phenotype

          38 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 miR-106a directly targets SLC12A6 [ 6 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-106a miRNA Mature ID miR-106a-5p

miRNA Sequence

 AAAAGUGCUUACAGUGCAGGUAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 2

 miR-106b directly targets SLC12A6 [ 6 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-106b miRNA Mature ID miR-106b-5p

miRNA Sequence

 UAAAGUGCUGACAGUGCAGAU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 3

 miR-126 directly targets SLC12A6 [ 7 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-126 miRNA Mature ID miR-126-5p

miRNA Sequence

 CAUUAUUACUUUUGGUACGCG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 4

 miR-17 directly targets SLC12A6 [ 6 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-17 miRNA Mature ID miR-17-5p

miRNA Sequence

 CAAAGUGCUUACAGUGCAGGUAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 5

 miR-186 directly targets SLC12A6 [ 6 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-186 miRNA Mature ID miR-186-3p

miRNA Sequence

 GCCCAAAGGUGAAUUUUUUGGG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 6

 miR-20a directly targets SLC12A6 [ 6 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-20a miRNA Mature ID miR-20a-5p

miRNA Sequence

 UAAAGUGCUUAUAGUGCAGGUAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 7

 miR-20b directly targets SLC12A6 [ 6 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-20b miRNA Mature ID miR-20b-5p

miRNA Sequence

 CAAAGUGCUCAUAGUGCAGGUAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 8

 miR-302a directly targets SLC12A6 [ 6 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-302a miRNA Mature ID miR-302a-3p

miRNA Sequence

 UAAGUGCUUCCAUGUUUUGGUGA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 9

 miR-302b directly targets SLC12A6 [ 6 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-302b miRNA Mature ID miR-302b-3p

miRNA Sequence

 UAAGUGCUUCCAUGUUUUAGUAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 10

 miR-302c directly targets SLC12A6 [ 6 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-302c miRNA Mature ID miR-302c-3p

miRNA Sequence

 UAAGUGCUUCCAUGUUUCAGUGG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 11

 miR-302d directly targets SLC12A6 [ 6 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-302d miRNA Mature ID miR-302d-3p

miRNA Sequence

 UAAGUGCUUCCAUGUUUGAGUGU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 12

 miR-302e directly targets SLC12A6 [ 6 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-302e miRNA Mature ID miR-302e

miRNA Sequence

 UAAGUGCUUCCAUGCUU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 13

 miR-372 directly targets SLC12A6 [ 6 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-372 miRNA Mature ID miR-372-3p

miRNA Sequence

 AAAGUGCUGCGACAUUUGAGCGU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 14

 miR-373 directly targets SLC12A6 [ 6 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-373 miRNA Mature ID miR-373-3p

miRNA Sequence

 GAAGUGCUUCGAUUUUGGGGUGU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 15

 miR-4438 directly targets SLC12A6 [ 6 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4438 miRNA Mature ID miR-4438

miRNA Sequence

 CACAGGCUUAGAAAAGACAGU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 16

 miR-4731 directly targets SLC12A6 [ 6 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4731 miRNA Mature ID miR-4731-5p

miRNA Sequence

 UGCUGGGGGCCACAUGAGUGUG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 17

 miR-4795 directly targets SLC12A6 [ 7 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4795 miRNA Mature ID miR-4795-3p

miRNA Sequence

 AUAUUAUUAGCCACUUCUGGAU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 18

 miR-5089 directly targets SLC12A6 [ 6 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-5089 miRNA Mature ID miR-5089-5p

miRNA Sequence

 GUGGGAUUUCUGAGUAGCAUC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 19

 miR-512 directly targets SLC12A6 [ 6 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-512 miRNA Mature ID miR-512-3p

miRNA Sequence

 AAGUGCUGUCAUAGCUGAGGUC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 20

 miR-519d directly targets SLC12A6 [ 6 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-519d miRNA Mature ID miR-519d-3p

miRNA Sequence

 CAAAGUGCCUCCCUUUAGAGUG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 21

 miR-520a directly targets SLC12A6 [ 6 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-520a miRNA Mature ID miR-520a-3p

miRNA Sequence

 AAAGUGCUUCCCUUUGGACUGU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 22

 miR-520c directly targets SLC12A6 [ 6 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-520c miRNA Mature ID miR-520c-3p

miRNA Sequence

 AAAGUGCUUCCUUUUAGAGGGU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 23

 miR-520d directly targets SLC12A6 [ 6 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-520d miRNA Mature ID miR-520d-3p

miRNA Sequence

 AAAGUGCUUCUCUUUGGUGGGU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 24

 miR-520g directly targets SLC12A6 [ 6 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-520g miRNA Mature ID miR-520g-3p

miRNA Sequence

 ACAAAGUGCUUCCCUUUAGAGUGU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 25

 miR-520h directly targets SLC12A6 [ 6 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-520h miRNA Mature ID miR-520h

miRNA Sequence

 ACAAAGUGCUUCCCUUUAGAGU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 26

 miR-526b directly targets SLC12A6 [ 6 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-526b miRNA Mature ID miR-526b-3p

miRNA Sequence

 GAAAGUGCUUCCUUUUAGAGGC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 27

 miR-5589 directly targets SLC12A6 [ 6 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-5589 miRNA Mature ID miR-5589-5p

miRNA Sequence

 GGCUGGGUGCUCUUGUGCAGU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 28

 miR-5689 directly targets SLC12A6 [ 7 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-5689 miRNA Mature ID miR-5689

miRNA Sequence

 AGCAUACACCUGUAGUCCUAGA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 29

 miR-5702 directly targets SLC12A6 [ 6 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-5702 miRNA Mature ID miR-5702

miRNA Sequence

 UGAGUCAGCAACAUAUCCCAUG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 30

 miR-619 directly targets SLC12A6 [ 6 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-619 miRNA Mature ID miR-619-5p

miRNA Sequence

 GCUGGGAUUACAGGCAUGAGCC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 31

 miR-6504 directly targets SLC12A6 [ 6 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6504 miRNA Mature ID miR-6504-3p

miRNA Sequence

 CAUUACAGCACAGCCAUUCU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 32

 miR-6506 directly targets SLC12A6 [ 6 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6506 miRNA Mature ID miR-6506-5p

miRNA Sequence

 ACUGGGAUGUCACUGAAUAUGGU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 33

 miR-652 directly targets SLC12A6 [ 8 ]

Epigenetic Type

 microRNA Experiment Method CLASH

miRNA Stemloop ID

 miR-652 miRNA Mature ID miR-652-3p

miRNA Sequence

 AAUGGCGCCACUAGGGUUGUG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 34

 miR-6890 directly targets SLC12A6 [ 6 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6890 miRNA Mature ID miR-6890-3p

miRNA Sequence

 CCACUGCCUAUGCCCCACAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 35

 miR-7151 directly targets SLC12A6 [ 6 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-7151 miRNA Mature ID miR-7151-3p

miRNA Sequence

 CUACAGGCUGGAAUGGGCUCA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 36

 miR-888 directly targets SLC12A6 [ 9 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-888 miRNA Mature ID miR-888-5p

miRNA Sequence

 UACUCAAAAAGCUGUCAGUCA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 37

 miR-93 directly targets SLC12A6 [ 6 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-93 miRNA Mature ID miR-93-5p

miRNA Sequence

 CAAAGUGCUGUUCGUGCAGGUAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 38

 miR-937 directly targets SLC12A6 [ 6 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-937 miRNA Mature ID miR-937-5p

miRNA Sequence

 GUGAGUCAGGGUGGGGCUGG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human
References
1 DNA Methylation Dynamics in Urological Tumors.
2 Genome-wide Scan for Methylation Profiles in Breast Cancer
3 Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
4 Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
5 Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
6 The Landscape of microRNA Targeting in Prostate Cancer Defined by AGO-PAR-CLIP. Neoplasia. 2016 Jun;18(6):356-70.
7 Direct conversion of fibroblasts to neurons by reprogramming PTB-regulated microRNA circuits. Cell. 2013 Jan 17;152(1-2):82-96.
8 Mapping the human miRNA interactome by CLASH reveals frequent noncanonical binding. Cell. 2013 Apr 25;153(3):654-65.
9 Remodeling of Ago2-mRNA interactions upon cellular stress reflects miRNA complementarity and correlates with altered translation rates. Genes Dev. 2013 Jul 15;27(14):1624-32.

If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.