Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID DTD0094 Transporter Info
Gene Name SLC13A4
Transporter Name Na(+)/sulfate cotransporter SUT-1
Gene ID
26266
UniProt ID
Q9UKG4
Epigenetic Regulations of This DT (EGR)

Methylation

  Pancretic ductal adenocarcinoma

            7 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC13A4 in pancretic ductal adenocarcinoma [ 1 ]

Location

 5'UTR (cg04783228)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.02E+00 Statistic Test p-value: 1.18E-02; Z-score: 4.12E-01

Methylation in Case

 6.90E-01 (Median) Methylation in Control 6.74E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC13A4 in pancretic ductal adenocarcinoma [ 1 ]

Location

 TSS200 (cg08530317)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.69E+00 Statistic Test p-value: 2.73E-07; Z-score: 1.37E+00

Methylation in Case

 2.16E-01 (Median) Methylation in Control 1.28E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC13A4 in pancretic ductal adenocarcinoma [ 1 ]

Location

 Body (cg27138584)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.26E+00 Statistic Test p-value: 1.71E-05; Z-score: 8.78E-01

Methylation in Case

 1.97E-01 (Median) Methylation in Control 1.57E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC13A4 in pancretic ductal adenocarcinoma [ 1 ]

Location

 Body (cg13298691)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.01E+00 Statistic Test p-value: 1.81E-05; Z-score: -9.51E-01

Methylation in Case

 9.18E-01 (Median) Methylation in Control 9.26E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC13A4 in pancretic ductal adenocarcinoma [ 1 ]

Location

 Body (cg16087482)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.02E+00 Statistic Test p-value: 3.01E-04; Z-score: 9.64E-01

Methylation in Case

 8.87E-01 (Median) Methylation in Control 8.67E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLC13A4 in pancretic ductal adenocarcinoma [ 1 ]

Location

 Body (cg13551263)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.03E+00 Statistic Test p-value: 5.38E-04; Z-score: -4.13E-01

Methylation in Case

 5.37E-01 (Median) Methylation in Control 5.51E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 7

 Methylation of SLC13A4 in pancretic ductal adenocarcinoma [ 1 ]

Location

 3'UTR (cg17557366)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.05E+00 Statistic Test p-value: 1.30E-03; Z-score: 8.51E-01

Methylation in Case

 6.75E-01 (Median) Methylation in Control 6.44E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Bladder cancer

            9 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC13A4 in bladder cancer [ 2 ]

Location

 TSS1500 (cg11608654)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.19E+00 Statistic Test p-value: 6.28E-04; Z-score: -3.19E+00

Methylation in Case

 6.66E-01 (Median) Methylation in Control 7.92E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC13A4 in bladder cancer [ 2 ]

Location

 TSS200 (cg17382310)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.10E+00 Statistic Test p-value: 5.36E-03; Z-score: -2.53E+00

Methylation in Case

 7.77E-01 (Median) Methylation in Control 8.53E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC13A4 in bladder cancer [ 2 ]

Location

 TSS200 (cg19548649)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.04E+00 Statistic Test p-value: 1.43E-02; Z-score: -1.67E+00

Methylation in Case

 8.72E-01 (Median) Methylation in Control 9.06E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC13A4 in bladder cancer [ 2 ]

Location

 1stExon (cg06869796)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.13E+00 Statistic Test p-value: 1.74E-05; Z-score: -1.01E+01

Methylation in Case

 6.71E-01 (Median) Methylation in Control 7.58E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC13A4 in bladder cancer [ 2 ]

Location

 Body (cg20392616)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -2.84E+00 Statistic Test p-value: 7.34E-14; Z-score: -1.45E+01

Methylation in Case

 2.50E-01 (Median) Methylation in Control 7.10E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLC13A4 in bladder cancer [ 2 ]

Location

 Body (cg21403761)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.47E+00 Statistic Test p-value: 2.56E-05; Z-score: -6.69E+00

Methylation in Case

 4.96E-01 (Median) Methylation in Control 7.28E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 7

 Methylation of SLC13A4 in bladder cancer [ 2 ]

Location

 Body (cg13459035)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.26E+00 Statistic Test p-value: 2.14E-04; Z-score: 3.99E+00

Methylation in Case

 5.30E-01 (Median) Methylation in Control 4.21E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 8

 Methylation of SLC13A4 in bladder cancer [ 2 ]

Location

 Body (cg10624823)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.03E+00 Statistic Test p-value: 1.47E-02; Z-score: -7.95E-01

Methylation in Case

 7.99E-01 (Median) Methylation in Control 8.21E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 9

 Methylation of SLC13A4 in bladder cancer [ 2 ]

Location

 3'UTR (cg23063666)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.03E+00 Statistic Test p-value: 1.86E-02; Z-score: -1.20E+00

Methylation in Case

 8.76E-01 (Median) Methylation in Control 9.02E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Breast cancer

          10 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC13A4 in breast cancer [ 3 ]

Location

 TSS1500 (cg03640993)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.03E+00 Statistic Test p-value: 5.11E-04; Z-score: -9.69E-01

Methylation in Case

 8.23E-01 (Median) Methylation in Control 8.51E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC13A4 in breast cancer [ 3 ]

Location

 TSS200 (cg23715104)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.06E+00 Statistic Test p-value: 5.44E-04; Z-score: 7.17E-01

Methylation in Case

 7.25E-01 (Median) Methylation in Control 6.83E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC13A4 in breast cancer [ 3 ]

Location

 TSS200 (cg25963505)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.02E+00 Statistic Test p-value: 3.55E-03; Z-score: -2.39E-01

Methylation in Case

 7.09E-01 (Median) Methylation in Control 7.21E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC13A4 in breast cancer [ 3 ]

Location

 1stExon (cg06869796)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.05E+00 Statistic Test p-value: 6.28E-05; Z-score: -1.12E+00

Methylation in Case

 7.42E-01 (Median) Methylation in Control 7.81E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC13A4 in breast cancer [ 3 ]

Location

 Body (cg20392616)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.28E+00 Statistic Test p-value: 1.14E-19; Z-score: -6.17E+00

Methylation in Case

 6.65E-01 (Median) Methylation in Control 8.54E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLC13A4 in breast cancer [ 3 ]

Location

 Body (cg13459035)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.34E+00 Statistic Test p-value: 2.06E-17; Z-score: 3.13E+00

Methylation in Case

 6.38E-01 (Median) Methylation in Control 4.77E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 7

 Methylation of SLC13A4 in breast cancer [ 3 ]

Location

 Body (cg21403761)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.23E+00 Statistic Test p-value: 2.09E-11; Z-score: -3.19E+00

Methylation in Case

 5.46E-01 (Median) Methylation in Control 6.74E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 8

 Methylation of SLC13A4 in breast cancer [ 3 ]

Location

 Body (cg26773342)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.03E+00 Statistic Test p-value: 2.52E-03; Z-score: -7.56E-01

Methylation in Case

 7.92E-01 (Median) Methylation in Control 8.16E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 9

 Methylation of SLC13A4 in breast cancer [ 3 ]

Location

 Body (cg10624823)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.02E+00 Statistic Test p-value: 7.06E-03; Z-score: -5.99E-01

Methylation in Case

 8.20E-01 (Median) Methylation in Control 8.36E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 10

 Methylation of SLC13A4 in breast cancer [ 3 ]

Location

 3'UTR (cg23063666)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.01E+00 Statistic Test p-value: 2.90E-02; Z-score: -3.35E-01

Methylation in Case

 8.93E-01 (Median) Methylation in Control 9.01E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Colorectal cancer

          11 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC13A4 in colorectal cancer [ 4 ]

Location

 TSS1500 (cg03640993)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.08E+00 Statistic Test p-value: 5.77E-04; Z-score: -9.43E-01

Methylation in Case

 6.95E-01 (Median) Methylation in Control 7.50E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC13A4 in colorectal cancer [ 4 ]

Location

 TSS200 (cg25963505)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.15E+00 Statistic Test p-value: 5.81E-08; Z-score: -2.86E+00

Methylation in Case

 7.17E-01 (Median) Methylation in Control 8.23E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC13A4 in colorectal cancer [ 4 ]

Location

 TSS200 (cg17382310)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.01E+00 Statistic Test p-value: 2.88E-04; Z-score: -3.60E-01

Methylation in Case

 9.21E-01 (Median) Methylation in Control 9.32E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC13A4 in colorectal cancer [ 4 ]

Location

 TSS200 (cg19548649)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.01E+00 Statistic Test p-value: 1.56E-03; Z-score: -4.40E-01

Methylation in Case

 9.15E-01 (Median) Methylation in Control 9.22E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC13A4 in colorectal cancer [ 4 ]

Location

 TSS200 (cg23715104)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.04E+00 Statistic Test p-value: 8.34E-03; Z-score: -6.53E-01

Methylation in Case

 8.52E-01 (Median) Methylation in Control 8.83E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLC13A4 in colorectal cancer [ 4 ]

Location

 1stExon (cg06869796)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.04E+00 Statistic Test p-value: 1.22E-07; Z-score: -2.35E+00

Methylation in Case

 8.62E-01 (Median) Methylation in Control 9.01E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 7

 Methylation of SLC13A4 in colorectal cancer [ 4 ]

Location

 Body (cg21403761)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.16E+00 Statistic Test p-value: 3.99E-11; Z-score: -3.77E+00

Methylation in Case

 7.11E-01 (Median) Methylation in Control 8.27E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 8

 Methylation of SLC13A4 in colorectal cancer [ 4 ]

Location

 Body (cg20392616)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.05E+00 Statistic Test p-value: 1.46E-08; Z-score: -2.74E+00

Methylation in Case

 8.75E-01 (Median) Methylation in Control 9.22E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 9

 Methylation of SLC13A4 in colorectal cancer [ 4 ]

Location

 Body (cg26773342)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.03E+00 Statistic Test p-value: 8.06E-07; Z-score: -1.83E+00

Methylation in Case

 8.92E-01 (Median) Methylation in Control 9.19E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 10

 Methylation of SLC13A4 in colorectal cancer [ 4 ]

Location

 Body (cg10624823)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.00E+00 Statistic Test p-value: 3.37E-02; Z-score: 7.82E-02

Methylation in Case

 9.25E-01 (Median) Methylation in Control 9.25E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Hepatocellular carcinoma

            8 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC13A4 in hepatocellular carcinoma [ 5 ]

Location

 TSS1500 (cg25771897)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.97E+00 Statistic Test p-value: 8.59E-11; Z-score: 3.70E+00

Methylation in Case

 2.91E-01 (Median) Methylation in Control 1.48E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC13A4 in hepatocellular carcinoma [ 5 ]

Location

 TSS1500 (cg17495154)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 2.37E+00 Statistic Test p-value: 1.87E-10; Z-score: 4.41E+00

Methylation in Case

 2.08E-01 (Median) Methylation in Control 8.77E-02 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC13A4 in hepatocellular carcinoma [ 5 ]

Location

 TSS200 (cg19548649)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.02E+00 Statistic Test p-value: 3.39E-05; Z-score: -4.11E-01

Methylation in Case

 8.60E-01 (Median) Methylation in Control 8.76E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC13A4 in hepatocellular carcinoma [ 5 ]

Location

 TSS200 (cg17382310)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.04E+00 Statistic Test p-value: 1.93E-04; Z-score: -5.35E-01

Methylation in Case

 8.07E-01 (Median) Methylation in Control 8.40E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC13A4 in hepatocellular carcinoma [ 5 ]

Location

 Body (cg19631651)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.60E+00 Statistic Test p-value: 3.96E-16; Z-score: -3.35E+00

Methylation in Case

 3.86E-01 (Median) Methylation in Control 6.18E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLC13A4 in hepatocellular carcinoma [ 5 ]

Location

 Body (cg20392616)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.06E+00 Statistic Test p-value: 4.15E-07; Z-score: -1.96E+00

Methylation in Case

 8.05E-01 (Median) Methylation in Control 8.55E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 7

 Methylation of SLC13A4 in hepatocellular carcinoma [ 5 ]

Location

 Body (cg10624823)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.06E+00 Statistic Test p-value: 2.18E-06; Z-score: -2.21E+00

Methylation in Case

 7.89E-01 (Median) Methylation in Control 8.40E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 8

 Methylation of SLC13A4 in hepatocellular carcinoma [ 5 ]

Location

 Body (cg13459035)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.08E+00 Statistic Test p-value: 3.20E-05; Z-score: 9.97E-01

Methylation in Case

 6.86E-01 (Median) Methylation in Control 6.33E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Panic disorder

            4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC13A4 in panic disorder [ 6 ]

Location

 TSS1500 (cg11608654)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.34E+00 Statistic Test p-value: 9.19E-03; Z-score: 3.35E-01

Methylation in Case

 5.12E-01 (Median) Methylation in Control 3.82E-01 (Median)

Studied Phenotype

 Panic disorder [ ICD-11: 6B01]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC13A4 in panic disorder [ 6 ]

Location

 TSS200 (cg19548649)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.09E+00 Statistic Test p-value: 6.70E-03; Z-score: 4.25E-01

Methylation in Case

 2.44E+00 (Median) Methylation in Control 2.23E+00 (Median)

Studied Phenotype

 Panic disorder [ ICD-11: 6B01]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC13A4 in panic disorder [ 6 ]

Location

 TSS200 (cg25963505)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.16E+00 Statistic Test p-value: 1.85E-02; Z-score: 5.15E-01

Methylation in Case

 2.05E+00 (Median) Methylation in Control 1.77E+00 (Median)

Studied Phenotype

 Panic disorder [ ICD-11: 6B01]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC13A4 in panic disorder [ 6 ]

Location

 Body (cg20392616)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.03E+00 Statistic Test p-value: 5.98E-03; Z-score: 3.24E-01

Methylation in Case

 3.21E+00 (Median) Methylation in Control 3.11E+00 (Median)

Studied Phenotype

 Panic disorder [ ICD-11: 6B01]

Experimental Material

 Patient tissue samples

  Papillary thyroid cancer

            5 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC13A4 in papillary thyroid cancer [ 7 ]

Location

 TSS1500 (cg11608654)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.03E+00 Statistic Test p-value: 2.21E-04; Z-score: -8.76E-01

Methylation in Case

 8.58E-01 (Median) Methylation in Control 8.81E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC13A4 in papillary thyroid cancer [ 7 ]

Location

 TSS200 (cg17382310)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.05E+00 Statistic Test p-value: 5.57E-05; Z-score: 1.32E+00

Methylation in Case

 8.61E-01 (Median) Methylation in Control 8.17E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC13A4 in papillary thyroid cancer [ 7 ]

Location

 TSS200 (cg23715104)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.05E+00 Statistic Test p-value: 7.71E-03; Z-score: 4.43E-01

Methylation in Case

 6.03E-01 (Median) Methylation in Control 5.73E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC13A4 in papillary thyroid cancer [ 7 ]

Location

 Body (cg13459035)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.12E+00 Statistic Test p-value: 7.16E-05; Z-score: -1.10E+00

Methylation in Case

 5.47E-01 (Median) Methylation in Control 6.10E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC13A4 in papillary thyroid cancer [ 7 ]

Location

 Body (cg10624823)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.01E+00 Statistic Test p-value: 6.63E-03; Z-score: -4.85E-01

Methylation in Case

 9.04E-01 (Median) Methylation in Control 9.11E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Prostate cancer

            3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC13A4 in prostate cancer [ 8 ]

Location

 TSS1500 (cg06895831)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.13E+00 Statistic Test p-value: 4.18E-03; Z-score: 3.03E+00

Methylation in Case

 8.96E-01 (Median) Methylation in Control 7.96E-01 (Median)

Studied Phenotype

 Prostate cancer [ ICD-11: 2C82]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC13A4 in prostate cancer [ 8 ]

Location

 Body (cg16073846)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.82E+00 Statistic Test p-value: 5.98E-03; Z-score: -3.33E+00

Methylation in Case

 1.66E-02 (Median) Methylation in Control 3.01E-02 (Median)

Studied Phenotype

 Prostate cancer [ ICD-11: 2C82]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC13A4 in prostate cancer [ 8 ]

Location

 Body (cg08034816)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.06E+00 Statistic Test p-value: 1.92E-02; Z-score: 1.95E+00

Methylation in Case

 9.13E-01 (Median) Methylation in Control 8.59E-01 (Median)

Studied Phenotype

 Prostate cancer [ ICD-11: 2C82]

Experimental Material

 Patient tissue samples

  Lung adenocarcinoma

            3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC13A4 in lung adenocarcinoma [ 9 ]

Location

 TSS200 (cg23715104)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.12E+00 Statistic Test p-value: 3.70E-02; Z-score: 1.38E+00

Methylation in Case

 7.30E-01 (Median) Methylation in Control 6.51E-01 (Median)

Studied Phenotype

 Lung adenocarcinoma [ ICD-11: 2C25.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC13A4 in lung adenocarcinoma [ 9 ]

Location

 Body (cg13459035)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.23E+00 Statistic Test p-value: 7.57E-03; Z-score: 2.66E+00

Methylation in Case

 7.25E-01 (Median) Methylation in Control 5.87E-01 (Median)

Studied Phenotype

 Lung adenocarcinoma [ ICD-11: 2C25.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC13A4 in lung adenocarcinoma [ 9 ]

Location

 Body (cg20392616)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.04E+00 Statistic Test p-value: 3.93E-02; Z-score: -1.26E+00

Methylation in Case

 8.30E-01 (Median) Methylation in Control 8.64E-01 (Median)

Studied Phenotype

 Lung adenocarcinoma [ ICD-11: 2C25.0]

Experimental Material

 Patient tissue samples

  Atypical teratoid rhabdoid tumor

            4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC13A4 in atypical teratoid rhabdoid tumor [ 10 ]

Location

 1stExon (cg06869796)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.79E+00 Statistic Test p-value: 3.04E-22; Z-score: -3.53E+00

Methylation in Case

 4.18E-01 (Median) Methylation in Control 7.48E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC13A4 in atypical teratoid rhabdoid tumor [ 10 ]

Location

 Body (cg10624823)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.11E+00 Statistic Test p-value: 1.70E-02; Z-score: 4.12E-01

Methylation in Case

 7.01E-01 (Median) Methylation in Control 6.30E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC13A4 in atypical teratoid rhabdoid tumor [ 10 ]

Location

 Body (cg13459035)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.02E+00 Statistic Test p-value: 3.62E-02; Z-score: 4.02E-01

Methylation in Case

 9.57E-01 (Median) Methylation in Control 9.37E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC13A4 in atypical teratoid rhabdoid tumor [ 10 ]

Location

 3'UTR (cg23063666)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.36E+00 Statistic Test p-value: 8.30E-10; Z-score: 1.58E+00

Methylation in Case

 8.12E-01 (Median) Methylation in Control 5.97E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  HIV infection

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC13A4 in HIV infection [ 11 ]

Location

 1stExon (cg06869796)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.04E+00 Statistic Test p-value: 2.22E-02; Z-score: -1.11E+00

Methylation in Case

 8.31E-01 (Median) Methylation in Control 8.67E-01 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC13A4 in HIV infection [ 11 ]

Location

 Body (cg20392616)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.04E+00 Statistic Test p-value: 1.33E-02; Z-score: -6.60E-01

Methylation in Case

 8.65E-01 (Median) Methylation in Control 8.96E-01 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

microRNA

  Unclear Phenotype

          11 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 miR-145 directly targets SLC13A4 [ 12 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-145 miRNA Mature ID miR-145-3p

miRNA Sequence

 GGAUUCCUGGAAAUACUGUUCU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 2

 miR-17 directly targets SLC13A4 [ 12 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-17 miRNA Mature ID miR-17-3p

miRNA Sequence

 ACUGCAGUGAAGGCACUUGUAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 3

 miR-26b directly targets SLC13A4 [ 13 ]

Epigenetic Type

 microRNA Experiment Method Microarray

miRNA Stemloop ID

 miR-26b miRNA Mature ID miR-26b-5p

miRNA Sequence

 UUCAAGUAAUUCAGGAUAGGU

miRNA Target Type

 Direct

Experimental Material

 Human cervical cancer cell line (Hela)

  Epigenetic Phenomenon 4

 miR-3074 directly targets SLC13A4 [ 12 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-3074 miRNA Mature ID miR-3074-5p

miRNA Sequence

 GUUCCUGCUGAACUGAGCCAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 5

 miR-335 directly targets SLC13A4 [ 14 ]

Epigenetic Type

 microRNA Experiment Method Microarray

miRNA Stemloop ID

 miR-335 miRNA Mature ID miR-335-5p

miRNA Sequence

 UCAAGAGCAAUAACGAAAAAUGU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 6

 miR-3614 directly targets SLC13A4 [ 12 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-3614 miRNA Mature ID miR-3614-5p

miRNA Sequence

 CCACUUGGAUCUGAAGGCUGCCC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 7

 miR-6134 directly targets SLC13A4 [ 12 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6134 miRNA Mature ID miR-6134

miRNA Sequence

 UGAGGUGGUAGGAUGUAGA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 8

 miR-6500 directly targets SLC13A4 [ 12 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6500 miRNA Mature ID miR-6500-3p

miRNA Sequence

 ACACUUGUUGGGAUGACCUGC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 9

 miR-6815 directly targets SLC13A4 [ 12 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6815 miRNA Mature ID miR-6815-5p

miRNA Sequence

 UAGGUGGCGCCGGAGGAGUCAUU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 10

 miR-6865 directly targets SLC13A4 [ 12 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6865 miRNA Mature ID miR-6865-5p

miRNA Sequence

 UAGGUGGCAGAGGAGGGACUUCA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 11

 miR-7854 directly targets SLC13A4 [ 12 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-7854 miRNA Mature ID miR-7854-3p

miRNA Sequence

 UGAGGUGACCGCAGAUGGGAA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human
References
1 Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
2 DNA Methylation Dynamics in Urological Tumors.
3 Genome-wide Scan for Methylation Profiles in Breast Cancer
4 Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
5 Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
6 DNA Methylation signatures in panic disorder. Transl Psychiatry. 2017 Dec 18;7(12):1287.
7 Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
8 Reducing the risk of false discovery enabling identification of biologically significant genome-wide methylation status using the HumanMethylation450 array. BMC Genomics. 2014 Jan 22;15:51.
9 DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
10 Atypical Teratoid/Rhabdoid Tumors Are Comprised of Three Epigenetic Subgroups with Distinct Enhancer Landscapes. Cancer Cell. 2016 Mar 14;29(3):379-393.
11 HIV-1 Infection Accelerates Age According to the Epigenetic Clock. J Infect Dis. 2015 Nov 15;212(10):1563-73.
12 The viral and cellular microRNA targetome in lymphoblastoid cell lines. PLoS Pathog. 2012 Jan;8(1):e1002484.
13 MicroRNA target prediction by expression analysis of host genes. Genome Res. 2009 Mar;19(3):481-90.
14 Endogenous human microRNAs that suppress breast cancer metastasis. Nature. 2008 Jan 10;451(7175):147-52.

If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.