Detail Information of Epigenetic Regulations
General Information of Drug Transporter (DT) | |||||
---|---|---|---|---|---|
DT ID | DTD0104 Transporter Info | ||||
Gene Name | SLC16A13 | ||||
Transporter Name | Monocarboxylate transporter 13 | ||||
Gene ID | |||||
UniProt ID | |||||
Epigenetic Regulations of This DT (EGR) | |||||
---|---|---|---|---|---|
Methylation |
|||||
Bladder cancer |
2 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon 1 |
Methylation of SLC16A13 in bladder cancer | [ 1 ] | |||
Location |
TSS1500 (cg03569506) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: 1.57E+00 | Statistic Test | p-value: 5.85E-03; Z-score: 2.11E+00 | ||
Methylation in Case |
1.66E-02 (Median) | Methylation in Control | 1.06E-02 (Median) | ||
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon 2 |
Methylation of SLC16A13 in bladder cancer | [ 1 ] | |||
Location |
1stExon (cg24173049) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: -1.48E+00 | Statistic Test | p-value: 2.67E-02; Z-score: -2.14E+00 | ||
Methylation in Case |
7.01E-02 (Median) | Methylation in Control | 1.04E-01 (Median) | ||
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
Experimental Material |
Patient tissue samples | ||||
Breast cancer |
3 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon 1 |
Methylation of SLC16A13 in breast cancer | [ 2 ] | |||
Location |
TSS1500 (cg24535234) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: 1.32E+00 | Statistic Test | p-value: 4.78E-02; Z-score: 3.76E-01 | ||
Methylation in Case |
2.56E-02 (Median) | Methylation in Control | 1.94E-02 (Median) | ||
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon 2 |
Methylation of SLC16A13 in breast cancer | [ 2 ] | |||
Location |
TSS1500 (cg03569506) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: 1.03E+00 | Statistic Test | p-value: 4.84E-02; Z-score: 5.51E-02 | ||
Methylation in Case |
1.83E-02 (Median) | Methylation in Control | 1.78E-02 (Median) | ||
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon 3 |
Methylation of SLC16A13 in breast cancer | [ 2 ] | |||
Location |
3'UTR (cg05174446) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: -1.06E+00 | Statistic Test | p-value: 7.56E-08; Z-score: -1.27E+00 | ||
Methylation in Case |
7.28E-01 (Median) | Methylation in Control | 7.70E-01 (Median) | ||
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
Experimental Material |
Patient tissue samples | ||||
Renal cell carcinoma |
2 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon 1 |
Methylation of SLC16A13 in clear cell renal cell carcinoma | [ 3 ] | |||
Location |
TSS1500 (cg09941770) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: -2.22E+00 | Statistic Test | p-value: 1.20E-05; Z-score: -1.59E+00 | ||
Methylation in Case |
4.65E-02 (Median) | Methylation in Control | 1.03E-01 (Median) | ||
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon 2 |
Methylation of SLC16A13 in clear cell renal cell carcinoma | [ 3 ] | |||
Location |
Body (cg07261015) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: 1.08E+00 | Statistic Test | p-value: 2.64E-02; Z-score: 1.74E+00 | ||
Methylation in Case |
9.08E-01 (Median) | Methylation in Control | 8.39E-01 (Median) | ||
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
Experimental Material |
Patient tissue samples | ||||
Lung adenocarcinoma |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon 1 |
Methylation of SLC16A13 in lung adenocarcinoma | [ 4 ] | |||
Location |
TSS200 (cg22884899) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: 1.23E+00 | Statistic Test | p-value: 3.71E-02; Z-score: 1.42E+00 | ||
Methylation in Case |
1.11E-01 (Median) | Methylation in Control | 9.01E-02 (Median) | ||
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
Experimental Material |
Patient tissue samples | ||||
Hepatocellular carcinoma |
4 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon 1 |
Methylation of SLC16A13 in hepatocellular carcinoma | [ 5 ] | |||
Location |
1stExon (cg24173049) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: -1.28E+00 | Statistic Test | p-value: 1.14E-05; Z-score: -8.54E-01 | ||
Methylation in Case |
1.05E-01 (Median) | Methylation in Control | 1.35E-01 (Median) | ||
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon 2 |
Methylation of SLC16A13 in hepatocellular carcinoma | [ 5 ] | |||
Location |
Body (cg00108873) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: -1.29E+00 | Statistic Test | p-value: 8.68E-11; Z-score: -2.42E+00 | ||
Methylation in Case |
4.68E-01 (Median) | Methylation in Control | 6.05E-01 (Median) | ||
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon 3 |
Methylation of SLC16A13 in hepatocellular carcinoma | [ 5 ] | |||
Location |
Body (cg07261015) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: -1.19E+00 | Statistic Test | p-value: 1.75E-05; Z-score: -1.27E+00 | ||
Methylation in Case |
5.95E-01 (Median) | Methylation in Control | 7.07E-01 (Median) | ||
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon 4 |
Methylation of SLC16A13 in hepatocellular carcinoma | [ 5 ] | |||
Location |
3'UTR (cg05174446) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: -1.02E+00 | Statistic Test | p-value: 2.51E-03; Z-score: -5.07E-01 | ||
Methylation in Case |
6.95E-01 (Median) | Methylation in Control | 7.09E-01 (Median) | ||
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
Experimental Material |
Patient tissue samples | ||||
Colon cancer |
2 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon 1 |
Methylation of SLC16A13 in colon adenocarcinoma | [ 6 ] | |||
Location |
Body (cg05658173) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: -1.45E+00 | Statistic Test | p-value: 8.02E-06; Z-score: -4.92E+00 | ||
Methylation in Case |
5.10E-01 (Median) | Methylation in Control | 7.38E-01 (Median) | ||
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon 2 |
Methylation of SLC16A13 in colon adenocarcinoma | [ 6 ] | |||
Location |
Body (cg10767665) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: 1.32E+00 | Statistic Test | p-value: 3.85E-03; Z-score: 2.00E+00 | ||
Methylation in Case |
4.94E-01 (Median) | Methylation in Control | 3.73E-01 (Median) | ||
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
Experimental Material |
Patient tissue samples | ||||
Pancretic ductal adenocarcinoma |
3 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon 1 |
Methylation of SLC16A13 in pancretic ductal adenocarcinoma | [ 7 ] | |||
Location |
Body (cg27568165) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: -1.28E+00 | Statistic Test | p-value: 2.65E-33; Z-score: -5.69E+00 | ||
Methylation in Case |
5.69E-01 (Median) | Methylation in Control | 7.30E-01 (Median) | ||
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon 2 |
Methylation of SLC16A13 in pancretic ductal adenocarcinoma | [ 7 ] | |||
Location |
Body (cg17749454) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: 1.16E+00 | Statistic Test | p-value: 2.37E-02; Z-score: 5.24E-01 | ||
Methylation in Case |
5.05E-01 (Median) | Methylation in Control | 4.35E-01 (Median) | ||
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon 3 |
Methylation of SLC16A13 in pancretic ductal adenocarcinoma | [ 7 ] | |||
Location |
Body (cg04976746) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: -1.14E+00 | Statistic Test | p-value: 2.41E-02; Z-score: -4.41E-01 | ||
Methylation in Case |
3.71E-02 (Median) | Methylation in Control | 4.25E-02 (Median) | ||
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
Experimental Material |
Patient tissue samples | ||||
Colorectal cancer |
2 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon 1 |
Methylation of SLC16A13 in colorectal cancer | [ 8 ] | |||
Location |
3'UTR (cg05174446) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 4.05E-03; Z-score: -5.17E-01 | ||
Methylation in Case |
8.57E-01 (Median) | Methylation in Control | 8.67E-01 (Median) | ||
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
Experimental Material |
Patient tissue samples | ||||
Papillary thyroid cancer |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon 1 |
Methylation of SLC16A13 in papillary thyroid cancer | [ 9 ] | |||
Location |
3'UTR (cg05174446) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: -1.02E+00 | Statistic Test | p-value: 2.95E-04; Z-score: -7.39E-01 | ||
Methylation in Case |
8.51E-01 (Median) | Methylation in Control | 8.67E-01 (Median) | ||
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
Experimental Material |
Patient tissue samples | ||||
Melanocytoma |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon 1 |
Moderate hypermethylation of SLC16A13 in melanocytoma than that in healthy individual | ||||
Studied Phenotype |
Melanocytoma [ICD-11:2F36.2] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value: 4.36E-07; Fold-change: 0.273265595; Z-score: 7.952747497 | ||||
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
![]() |
![]() |
||||
Prostate cancer metastasis |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon 1 |
Significant hypermethylation of SLC16A13 in prostate cancer metastasis than that in healthy individual | ||||
Studied Phenotype |
Prostate cancer metastasis [ICD-11:2.00E+06] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value: 0.005248769; Fold-change: 0.348021073; Z-score: 48.52654643 | ||||
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
![]() |
![]() |
||||
microRNA |
|||||
Unclear Phenotype |
26 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon 1 |
miR-1229 directly targets SLC16A13 | [ 10 ] | |||
Epigenetic Type |
microRNA | Experiment Method | CLASH | ||
miRNA Stemloop ID |
miR-1229 | miRNA Mature ID | miR-1229-3p | ||
miRNA Sequence |
CUCUCACCACUGCCCUCCCACAG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 2 |
miR-186 directly targets SLC16A13 | [ 11 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-186 | miRNA Mature ID | miR-186-3p | ||
miRNA Sequence |
GCCCAAAGGUGAAUUUUUUGGG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 3 |
miR-24 directly targets SLC16A13 | [ 12 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-24 | miRNA Mature ID | miR-24-3p | ||
miRNA Sequence |
UGGCUCAGUUCAGCAGGAACAG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 4 |
miR-3147 directly targets SLC16A13 | [ 11 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-3147 | miRNA Mature ID | miR-3147 | ||
miRNA Sequence |
GGUUGGGCAGUGAGGAGGGUGUGA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 5 |
miR-3202 directly targets SLC16A13 | [ 12 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-3202 | miRNA Mature ID | miR-3202 | ||
miRNA Sequence |
UGGAAGGGAGAAGAGCUUUAAU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 6 |
miR-383 directly targets SLC16A13 | [ 12 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-383 | miRNA Mature ID | miR-383-3p | ||
miRNA Sequence |
ACAGCACUGCCUGGUCAGA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 7 |
miR-4284 directly targets SLC16A13 | [ 12 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-4284 | miRNA Mature ID | miR-4284 | ||
miRNA Sequence |
GGGCUCACAUCACCCCAU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 8 |
miR-4425 directly targets SLC16A13 | [ 11 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-4425 | miRNA Mature ID | miR-4425 | ||
miRNA Sequence |
UGUUGGGAUUCAGCAGGACCAU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 9 |
miR-4455 directly targets SLC16A13 | [ 12 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-4455 | miRNA Mature ID | miR-4455 | ||
miRNA Sequence |
AGGGUGUGUGUGUUUUU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 10 |
miR-4493 directly targets SLC16A13 | [ 12 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-4493 | miRNA Mature ID | miR-4493 | ||
miRNA Sequence |
AGAAGGCCUUUCCAUCUCUGU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 11 |
miR-450b directly targets SLC16A13 | [ 11 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-450b | miRNA Mature ID | miR-450b-3p | ||
miRNA Sequence |
UUGGGAUCAUUUUGCAUCCAUA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 12 |
miR-4533 directly targets SLC16A13 | [ 12 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-4533 | miRNA Mature ID | miR-4533 | ||
miRNA Sequence |
UGGAAGGAGGUUGCCGGACGCU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 13 |
miR-4687 directly targets SLC16A13 | [ 13 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-4687 | miRNA Mature ID | miR-4687-5p | ||
miRNA Sequence |
CAGCCCUCCUCCCGCACCCAAA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 14 |
miR-4763 directly targets SLC16A13 | [ 13 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-4763 | miRNA Mature ID | miR-4763-5p | ||
miRNA Sequence |
CGCCUGCCCAGCCCUCCUGCU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 15 |
miR-5089 directly targets SLC16A13 | [ 11 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-5089 | miRNA Mature ID | miR-5089-5p | ||
miRNA Sequence |
GUGGGAUUUCUGAGUAGCAUC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 16 |
miR-520g directly targets SLC16A13 | [ 11 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-520g | miRNA Mature ID | miR-520g-3p | ||
miRNA Sequence |
ACAAAGUGCUUCCCUUUAGAGUGU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 17 |
miR-520h directly targets SLC16A13 | [ 11 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-520h | miRNA Mature ID | miR-520h | ||
miRNA Sequence |
ACAAAGUGCUUCCCUUUAGAGU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 18 |
miR-6079 directly targets SLC16A13 | [ 12 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-6079 | miRNA Mature ID | miR-6079 | ||
miRNA Sequence |
UUGGAAGCUUGGACCAACUAGCUG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 19 |
miR-6504 directly targets SLC16A13 | [ 11 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-6504 | miRNA Mature ID | miR-6504-3p | ||
miRNA Sequence |
CAUUACAGCACAGCCAUUCU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 20 |
miR-6513 directly targets SLC16A13 | [ 11 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-6513 | miRNA Mature ID | miR-6513-5p | ||
miRNA Sequence |
UUUGGGAUUGACGCCACAUGUCU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 21 |
miR-6728 directly targets SLC16A13 | [ 11 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-6728 | miRNA Mature ID | miR-6728-5p | ||
miRNA Sequence |
UUGGGAUGGUAGGACCAGAGGGG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 22 |
miR-6807 directly targets SLC16A13 | [ 13 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-6807 | miRNA Mature ID | miR-6807-5p | ||
miRNA Sequence |
GUGAGCCAGUGGAAUGGAGAGG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 23 |
miR-6863 directly targets SLC16A13 | [ 11 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-6863 | miRNA Mature ID | miR-6863 | ||
miRNA Sequence |
UAGACGUGGUGAAGGAUUGAGUG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 24 |
miR-6872 directly targets SLC16A13 | [ 13 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-6872 | miRNA Mature ID | miR-6872-3p | ||
miRNA Sequence |
CCCAUGCCUCCUGCCGCGGUC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 25 |
miR-769 directly targets SLC16A13 | [ 11 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-769 | miRNA Mature ID | miR-769-3p | ||
miRNA Sequence |
CUGGGAUCUCCGGGGUCUUGGUU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 26 |
miR-7977 directly targets SLC16A13 | [ 12 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-7977 | miRNA Mature ID | miR-7977 | ||
miRNA Sequence |
UUCCCAGCCAACGCACCA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.